Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.62456988 |
A number of intriguing interactions between HP 1 and other proteins have been described , implicating HP 1 in gene regulation , DNA replication , and nuclear architecture . . 0.62456988^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.80607211 |
Whereas in wild type cells Dnmt3b interacts with HP 1 alpha and is concentrated at heterochromatic foci , it fails to localize to these regions in Suv39h double null ( dn ) mouse embryonic stem ( ES ) cells . 0.80607211^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Competent Haemophilus influenzae Rd recipients , either as phage HP 1 restricting ( r+ ) or nonrestricting ( r ) nonlysogens or defective lysogens , were exposed to deoxyribonucleic acids from various wild type phage HP 1 lysogenic H . influenzae serotype strains ( non encapsulated derivatives of serotypes a , b , c , d , and e ) , to DNA from lysogenic Haemophilus parahaemolyticus , and to DNA from modified and nonmodified phage HP 1 . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Mutants is cistron 9 , coding for the tail protein , TP 1 , produce DNA free prolate heads with an internal core ; these particles are abortive and contain the head proteins HPO , HP 1 and HP 3 , the upper collar protein NP 2 and the nonstructural proteins p 7 , p 15 and p 16 . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
The biological fate of temperate phage HP 1 deoxyribonucleic acid ( DNA ) was followed after uptake by defectively lysogenic competent Haemophilus influenzae cultures . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Gene libraries have been established using genomic DNA from the wild type strain , S . coelicolor DSM 3030 , and from an overproducing mutant , S . coelicolor HP 1 , which exhibits about a twofold increase in lysozyme production . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Plasmids containing DNA segments from the attachment region of phage HP 1 were constructed and tested for the ability to replace the phage attachment site substrate in site specific recombination reactions . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
The effect of HP 1 and related neutrophil granule peptides on DNA synthesis in HL 60 cells . ^^^ We report the effects of three of these peptides HP 1 , HP 1 56 and HP 4 on the incorporation of [ 3H ] thymidine into the DNA of the leukemic cell line HL 60 . ^^^ HP 1 and HP 1 56 , but not HP 4 , inhibited DNA synthesis at 1 50 nM without causing cell death . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
The specific DNA binding protein integration host factor ( IHF ) of Escherichia coli stimulates the site specific recombination reaction between the attP site of bacteriophage HP 1 and the attB site of its host , Haemophilus influenzae , in vitro and also appears to regulate the expression of HP 1 integrase . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Expression of this DNA segment in Escherichia coli provided extracts which promoted site specific recombination between plasmids containing cloned HP 1 attP and Haemophilus influenzae attB sites . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Plasmids were constructed which contain both attP and attB DNA segments derived from the insertion sites of the lysogenic bacteriophage HP 1 and its host , Haemophilus influenzae . ^^^ Deletion of the phage DNA segment adjacent to the attP site from the attP attB constructions eliminated detectable recombination , suggesting that this sequence contains the gene encoding the HP 1 integrase . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
In a rec 1 strain of H . influenzae , the cloned genes restored resistance to UV irradiation , transformation by chromosomal DNA , and spontaneous release of HP 1 prophage to wild type levels . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
DNA cloning of murine interleukin HP 1 : homology with human interleukin 6 . ^^^ Comparison of the cDNA sequence of HP 1 with that of human interleukin 6 disclosed a homology of 65 % at the DNA level and of 42 % at the protein level with a maximum of 57 % for the segment spanning residues 42 102 of mature HP 1 . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Competent Haemophilus influenzae bacteria were exposed to purified phage HP 1 DNA and then plated for transfectants ( PFU ) . ^^^ It also had little effect on transformation with chromosomal DNA or on transformation of defective HP 1 lysogens with phage HP 1 DNA . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Origin and direction of Haemophilus bacteriophage HP 1 DNA replication . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
DNA sequencing shows that the intragenic duplication within the human haptoglobin Hp 2 allele was formed by a non homologous , probably random , crossing over within different introns of two Hp 1 genes , probably in an Hp1F / Hp1S heterozygote . . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Whole phages HP 1 and HP 3 , vegetative phage deoxyribonucleic acid ( DNA ) , and single and tandem double prophage DNA were exposed to ultraviolet radiation and then assayed on a wild type ( DNA repair proficient ) Haemophilus influenzae Rd strain and on a repair deficient uvr 1 strain . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
A complete EcoRI digest of Haemophilus influenzae phage HP 1 deoxyribonucleic acid ( DNA ) was mixed with incomplete digests of various H . influenzae R plasmids , sealed with T 4 ligase , and transformed into an HP 1 lysogen . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
In contrast to another chromo domain protein , HP 1 , CHD 1 is not preferentially located in condensed centromeric heterochromatin , even though centromeric DNA is highly enriched in ( A+T ) rich tracts . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Characterization of a new class of transcribed repetitive DNA sequence which also exists as a hybrid with HP 1 mRNA ; potential for site specific recombination in Drosophila melanogaster . ^^^ Such sequences are also present in the HP 1 DNA . ^^^ We propose that ( a ) the HP 1 VS composite transcript represented by the fl cDNA may be the product of recombination between the two sequences , ( b ) that the process is mediated by the RSS and / or the DNA downstream of the junction between HP 1 and the VS and ( c ) that the recombination event may lead to the inactivation of the HP 1 gene in a cell and tissue specific manner . . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
The interaction of two classes of human sperm protamines , P 1 ( HP 1 ) and P 2 ( HP 2 , HP 3 , HP 4 ) , with DNA was investigated . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Binding sites for bacteriophage HP 1 integrase on its DNA substrates . ^^^ The temperate phage HP 1 integrates its genome into the chromosome of Haemophilus influenzae by site specific recombination between host and phage DNA segments , the attachment sites . ^^^ The interactions of HP 1 integrase with its DNA substrates have been characterized by DNase 1 footprinting . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
By analysis of DNA from a pannel of hamster / human hybrid cell lines , the HP 4 gene was found to be on chromosome 8 , as is the gene for human peptide HP 1 . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
DNA sequence analysis reveals this protein to be a human homologue of HP 1 , a heterochromatin protein of Drosophila melanogaster . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
The complete nucleotide sequence of bacteriophage HP 1 DNA . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
The integrase encoded by the temperate phage HP 1 promotes the site specific recombination between DNA sites on its genome ( the attP site ) and on the genome of the host Haemophilus influenzae ( the attB site ) . ^^^ The reaction promoted by HP 1 integrase produced a four stranded initial reaction product in which one pair of DNA strands had undergone transfer while the other pair remained intact . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Human homolog of Drosophila heterochromatin associated protein 1 ( HP 1 ) is a DNA binding protein which possesses a DNA binding motif with weak similarity to that of human centromere protein C ( CENP C ) . ^^^ Here , we show that human HP 1 , which is also an autoantigen targeted by some types of anticentromere autosera , is a DNA binding protein . ^^^ The DNA binding activity of the recombinant HP 1 was demonstrated by gel mobility shift assay and South Western type blotting . ^^^ This suggests that HP 1 is involved in the pericentromeric heterochromatin formation by directly associating with genomic DNA . . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Cloning and characterization of bacteriophage like DNA from Haemophilus somnus homologous to phages P 2 and HP 1 . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
METHODS : Clinical features of the HP 1 kindreds were compared with those of the new kindreds ( HP 2 ) , and genetic linkage analysis , screening for mutations through DNA sequencing , and screening an unaffected population were performed . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Unexpectedly , Ikaros localized to discrete heterochromatin containing foci in interphase nuclei , which comprise clusters of centromeric DNA as defined by gamma satellite sequences and the abundance of heterochromatin protein 1 ( HP 1 ) . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Furthermore , when compared with wild type HGF / SF , the HP 1 mutant exhibited a delayed clearance from the blood , higher tissue levels and a higher induction of DNA synthesis in normal , adult murine liver . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
We identified two 186 late genes with unknown function ; one is homologous to previously unrecognised genes in P 2 , HP 1 , and phiCTX , and the other may modulate DNA packaging . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
The HP 1 class of chromobox genes are thought to encode proteins involved in the packaging of chromosomal DNA into repressive heterochromatin domains , as seen , for example , in position effect variegation . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
We demonstrate that chromatin assembly factor 1 ( CAF 1 ) binds to mouse HP 1 proteins via an N terminal domain of its p 150 subunit , a domain dispensable for nucleosome assembly during DNA replication . ^^^ Mutations in p 150 prevent association with HP 1 in heterochromatin in cells that are not in S phase and the formation of CAF 1 HP 1 complexes in nascent chromatin during DNA replication in vitro . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Despite this fact , a DNA sequence of HP 1 bacteriophage of Haemophilus influenzae encoding methyltransferase activity was cloned and expressed in Escherichia coli using pMPMT 4 omega expression vector . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
At the light microscopy level , within these entities , we followed DNA synthesis , histone H 4 acetylation , heterochromatin protein 1 ( Hp1alpha and beta ) , and chromatin assembly factor 1 ( CAF 1 ) . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Antisera to CENP A , CENP B , CENP C , CENP E , CENP F , INCENP , CLIP 170 , dynein , dynactin subunits p 150 ( Glued ) and Arp 1 , MCAK , Tsg 24 , p55CDC , HZW 10 , HBUB 1 , HBUBR 1 , BUB 3 , MAD 2 , ERK 1 , 3F3 / 2 , topoisomerase 2 and a murine HP 1 homologue , M 31 , were used in immuno fluorescence experiments in conjunction with FISH employing specific DNA probes to clearly identify neocentromeric DNA . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
The lamins and the lamin binding proteins lamina associated polypeptide ( LAP ) 2beta and lamin B receptor ( LBR ) have been described to bind to DNA or to interact with chromatin via histones , BAF 1 , and HP 1 chromodomain proteins , respectively , and may provide anchorage sites for chromatin fibers at the nuclear periphery . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Cytological analysis suggests that the bulk of the fourth , including the portion that appears banded in the polytene chromosomes , is heterochromatic ; the banded region includes blocks of middle repetitious DNA associated with heterochromatin protein 1 ( HP 1 ) . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
HP 1 binds nucleosome core particles and naked DNA . ^^^ HP 1 DNA complex formation is length dependent and cooperative but relatively sequence independent . ^^^ Neither the chromo domain nor chromo shadow domain alone binds DNA ; intact native HP 1 is required for such interactions . ^^^ Together , these observations suggest that HP 1 may serve as a cross linker in chromatin , linking nucleosomal DNA and nonhistone protein complexes to form higher order chromatin structures . . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Differences among the HP 1 binding partners could also be discerned by fusion to a heterologous DNA binding domain and by the potential to act as dominant negative molecules . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
In contrast to HP1alpha , Ku 70 did not repress transcriptional activity of the reporter gene when tethered to DNA after transfection to mammalian cells . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Phosphorylation has no effect on HP 1 self association but alters the DNA binding properties of HP 1 , suggesting that phosphorylation could differentially regulate HP 1 dependent interactions . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Binding dissociation constant ( Kd ) values were determined to be 0 . 22 + / 0 . 11 microM for the hairpin formed from the single stranded DNA 5 ' AAAAAAATAGTTTTAAATATTTTTTT 3 ' ( dubbed HP 1 ) . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Indeed , a chimeric protein , made of the DNA binding site of GAL 4 and of HP 1 , the modifier of PEV encoded by Su ( var ) 2 5 , is shown to enhance variegation of Heidi and Tell . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Protein and DNA requirements of the bacteriophage HP 1 recombination system : a model for intasome formation . ^^^ By mutating individual DNA binding sites and observing the effects of various mixtures of recombination proteins on the mutated substrates , we have begun to categorize the requirements for intasome formation in the site specific recombination system of bacteriophage HP 1 . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Heterochromatin is characterized by the methylation of cytosine nucleotides of the DNA , the methylation of histone H 3 at lysine 9 ( H 3 Lys 9 ) , and the specific binding of heterochromatin protein 1 ( HP 1 ) to methylated H 3 Lys 9 ( refs 1 7 ) . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
In this paper we report cloning and experimental characterization of the DNA adenine methyltransferase ( dam ) gene from Haemophilus influenzae and comparison of its product with the Dam protein from the lysogenic phage of H . influenzae , HP 1 . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Finally , we provide evidence that Me9H3 is neither necessary nor sufficient for localisation of heterochromatin protein 1 ( HP 1 ) to chromosomal DNA . . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
However , a strong competition is observed between AMD and 7AAMD for binding site in oligonucleotide HP 1 used as DNA hairpin model . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
METHODS : Taking advantage of the selectivity of PCR , we amplified DNA segments specifically representing haptoglobin alleles Hp 1 and Hp 2 from genomic DNA . ^^^ RESULTS : Exploiting the known size difference between Hp 1 and Hp 2 , we amplified allele specific DNA molecules with one pair of oligonucleotide primers . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Although the HP 1 proteins are known to be involved in the packaging of chromosomal DNA into repressive heterochromatin domains , their involvement in facultative heterochromatinization has not been precisely determined . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Methyl CpG binding domain 1 ( MBD 1 ) interacts with the Suv39h1 HP 1 heterochromatic complex for DNA methylation based transcriptional repression . ^^^ These data indicate that MBD 1 may tether the Suv39h1 HP 1 complex to methylated DNA regions , suggesting the presence of a pathway from DNA methylation to the modifications of histones for epigenetic gene regulation . . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
The DNA methyltransferases associate with HP 1 and the SUV39H1 histone methyltransferase . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
These results suggested that TFL 2 might function as an HP 1 in Arabidopsis : Gene expression analyses using DNA microarrays , however , did not show an increase in the expression of heterochromatin genes in tfl 2 mutants but instead showed the upregulation of the floral homeotic genes APETALA 3 , PISTILLATA , AGAMOUS and SEPALLATA 3 . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Specific DNA binding activities are also likely to be required for targeting this activity along with HP 1 to specific chromosomal regions . ^^^ The Drosophila HOAP protein is a DNA binding protein that was identified as a component of a multiprotein complex of HP 1 containing Drosophila origin recognition complex ( ORC ) subunits in the early Drosophila embryo . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
We performed DNA localization mapping for the heterochromatin protein HP 1 and for the sequence specific GAGA transcription factor , producing a comprehensive , high resolution map of in vivo protein DNA interactions throughout these regions of the Drosophila genome . . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
We show that plant cells competent for fate switch display a disruption of nucleolar domain appearance associated with condensation of 18S ribosomal DNA , as well as modifications of histone H 3 and redistribution of heterochromatin protein 1 ( HP 1 ) . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
The NaV1 . 2 gene is actively transcribed but repressed by REST independently of histone deacetylation or DNA methylation and does not co localize with epigenetic markers of silence , including dimethylation of H3K9 and HP 1 . ^^^ In contrast , the M 4 gene is maintained in a silent state independently of REST and co localizes with dimethylated H3K9 and HP1alpha and HP1gamma , characteristic of silenced or senescent euchromatic DNA . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Genetic epistasis analyses suggest that the Swi 5 Sfr1 Rhp 51 interactions function specifically in DNA recombination repair , whereas the Swi 5 Swi2 Rhp 51 interactions may function , together with chromodomain protein Swi 6 ( HP 1 homolog ) , in mating type switching . . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
HP 1 is essential for DNA methylation in neurospora . ^^^ We therefore investigated the possibility that a Neurospora HP 1 homolog reads the methyl Lys 9 mark to signal DNA methylation . ^^^ We identified an HP 1 homolog and showed that it is essential for DNA methylation , is localized to heterochromatic foci , and that this localization is dependent on the catalytic activity of DIM 5 . ^^^ We conclude that HP 1 serves as an adaptor between methylated H 3 Lys9 and the DNA methylation machinery . ^^^ Unlike mutants that lack DNA methyltransferase , mutants with defects in the HP 1 gene hpo exhibit severe growth defects , suggesting that HP 1 is required for processes besides DNA methylation . . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Here , we tested this model , and we found that the capping function of HP 1 is due to its direct binding to telomeric DNA , while the silencing of telomeric sequences and telomere elongation is due to its interaction with H 3 MeK9 . . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Genetic mapping and DNA sequencing identified the TU 8 mutation as tfl 2 6 , a new allele of TERMINAL FLOWER 2 ( TFL 2 ) , the only Arabidopsis homolog of animal HETEROCHROMATIN PROTEIN 1 ( HP 1 ) . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
In order to investigate the effect of DNA hypomethylation on heterochromatin organization , we analyzed the in vivo distribution of HP 1 proteins , essential components of heterochromatin , in three ICF patients . ^^^ Our results show that satellite DNA hypomethylation does not prevent HP 1 proteins from associating with heterochromatin . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
In interphase nuclei , the noncoding sequences were only rarely found associated with heterochromatic sites marked by the satellite 3 DNA D1Z1 or clusters of mammalian heterochromatin proteins ( HP1alpha , HP1beta , HP1gamma ) . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Here , we provide evidence that Drosophila HP 1 is essential for the maintenance of active transcription of euchromatic genes functionally involved in cell cycle progression , including those required for DNA replication and mitosis . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
The effects of Pycnogenol on DNA damage in vitro and expression of superoxide dismutase and HP 1 in Escherichia coli SOD and catalase deficient mutant cells . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
These proteins include the telomere capping factors HP1 / ORC associated protein ( HOAP ) and heterochromatin protein 1 ( HP 1 ) , the Rad 50 and Mre 11 DNA repair proteins that are required for HOAP and HP 1 localization at telomeres , and the ATM kinase . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
The method was successfully applied to the DNA binding proteins histone H2B and the glucocorticoid receptor and to the heterochromatin associated proteins HP1alpha and HP1beta . . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
In recent studies , roles have been identified for replication factors in reinstating heterochromatin , particularly functions for origin recognition complex , proliferating cell nuclear antigen , and chromatin assembly factor 1 in recruiting the heterochromatin binding protein HP 1 , a histone methyltransferase , a DNA methyltransferase , and a chromatin remodeling complex . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Consistent with the hypothesis that post translational modifications of histones may functionally ' mark ' DNA sequences , HP 1 was found to bind to ' silent ' chromatin via the methylated lysine 9 ( K 9 ) residue on the histone H 3 tail that protrudes from the nucleosome . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Other target genes that might promote incorporation of DNA and / or pluripotency of cells include HP 1 , CycD 3 and CycD 1 . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Conversely , targeting of ( AAGAG ) n satellite 5 repeats by the P 31 polyamide results in the displacement of HP 1 from these sequences , indicating that HP 1 interactions with chromatin are sensitive to DNA binding ligands . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
This change is also associated with global relocation of heterochromatin protein HP 1 and histone H 3 methyltransferase Suv39h1 away from constitutive heterochromatin ; however , it does not affect DNA methylation or chromosome segregation , phenotypes commonly associated with impaired histone H 3 ( K 9 ) methylation . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Mutations in Drosophila DNA damage response genes such as atm / tefu , mre 11 , or rad 50 disrupt telomere protection and localization of the telomere associated proteins HP 1 and HOAP , suggesting that recognition of chromosome ends contributes to telomere protection . ^^^ We propose that recognition of chromosome ends and recruitment of HP 1 and HOAP by DNA damage response proteins is essential for the epigenetic protection of Drosophila telomeres . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Moreover , based on the presence of satellite DNA and the proteins HP 1 , BRCA 1 , ATRX and DAXX within the PML NBs , we propose that these structures have a specific function : the re establishment of the condensed heterochromatic state on late replicated satellite DNA . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Deletion of the HP 1 or HMG 2 binding domain had no effect on DNA binding . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Directional motion of foreign plasmid DNA to nuclear HP 1 foci . ^^^ Movement of labelled plasmid DNA relative to heterochromatin foci in nuclei , visualized with HP 1 GFP , was studied using live cell imaging and object tracking . ^^^ In addition to Brownian motion of plasmid DNA we found a pronounced , non random movement of plasmid DNA towards the nearest HP 1 focus , while time lapse microscopy showed that HP 1 foci are relatively immobile and positionally stable . ^^^ The movement of plasmid DNA was much faster than that of the HP 1 foci . ^^^ Contact of transgene DNA with an HP 1 focus usually resulted in cessation of the directional motion . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
However , in cells lacking the Suv39h1 , 2 methyltransferases responsible for K9H3 trimethylation and HP 1 binding at chromocenters , replication of chromocenter DNA was advanced by 10 15 % of the length of S phase . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
Most of these proteins fall into two distinct chromosomal distribution patterns : ( a ) kinetochore associated proteins ( Sin3A , PCAF , MYST and BAF 180 ) , which colocalize with metaphase kinetochores , but not any of the pericentric and other major heterochromatic regions ; and ( b ) heterochromatin associated proteins ( MeCP 2 , MBD 1 , MBD 2 , ATRX , HP1alpha , HDAC 1 , HDAC 2 , DNMT 1 and DNMT3b ) , which colocalize with centromeric / pericentric heterochromatin and all other major heterochromatic sites . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
By immunoprecipitation and GST pull down , we show that DNMT3B interacts with HDAC 1 , HDAC 2 , HP 1 proteins , Suv39h1 , and the ATP dependent chromatin remodeling enzyme hSNF2H . ^^^ |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|
Interacting proteins: Q9UBC3 and P45973 |
Pubmed |
SVM Score :0.0 |
NA |
|