Pubmed abstracts for Protein-Protein Interaction search result :


Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.5545486
We analyzed DNA samples from 100 families with a set of flanking DNA markers linked to the fra ( 10 ) locus . 0.5545486^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :1.4521054
One primer set was selected from sequences encoding a capsulation associated protein and reacted with target DNA from all 15 capsulate H . influenzae strains ( all serotypes ) examined . 1.4521054^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.65357733
A linear DNA containing two FLP sites in a direct orientation was treated with the double strand specific 3 ' exonuclease , exonuclease 3 , to generate molecules with a nested set of single strand deletions that extended into one of the FLP sites . 0.65357733^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.60934688
Analysis of cellular DNA from secondary mouse cell subclones with a probe specific for human repetitive DNA sequences revealed a minimal human DNA complement containing a characteristic set of restriction fragments common to independently derived subclones . 0.60934688^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.5201915
The patient ' s DNA was amplified using the polymerase chain reaction with a set of synthetic oligonucleotide primers spanning amino acid residues 1646 1714 . 0.5201915^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.53392611
This information can be obtained by digesting DNA with a set of restriction endonucleases , or by PCR with primers complementary to certain DNA regions , with subsequent measurement of the length of the resulting fragments in gel electrophoresis . 0.53392611^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.56876625
Further identification of the amplified DNA sequences was performed with a set of YAC probes localized to 5q12 > q 14 . 0.56876625^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.59993129
The PCR amplifies a part of the DNA coding for 16S rRNA with a set of primers that is specific for the genus Mycobacterium and that flanks species specific sequences within the genes coding for 16S rRNA . 0.59993129^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.51667078
The chip , containing a set of 10mers , was enzymatically phosphorylated , then hybridized with DNA and ligated in a site directed manner with a contiguously stacked 5mer . 0.51667078^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.65954287
Analysis of an extensive set of individual and combined alanine substitutions over a 61 amino acid region of VP 16 shows that , even within a region as small as 13 amino acids , there are separate residues involved in association with either HCF , DNA , or Oct 1 bound to DNA ; indeed , of two immediately adjacent amino acids in VP 16 , one is important for DNA binding and the other is important for HCF binding . 0.65954287^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.59988628
Based upon genomic sequences of the HTR 4 gene , a primer set was selected that reacted with human genomic DNA but not mouse or hamster genomic DNA . 0.59988628^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.68552668
METHODS AND RESULTS : DNA from 12 HH was extracted and subjected to polymerase chain reaction analysis for HHV 8 DNA using two independent protocols with a single set of primers and a nested PCR approach , respectively . 0.68552668^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.54861325
METHODS : DNA from 29 men with idiopathic azoospermia was screened by polymerase chain reaction ( PCR ) analysis with a set of gamma chromosome specific sequence tagged sites ( STSs ) to determine microdeletions in the gamma chromosome . 0.54861325^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.76577532
DNA obtained from three samples was hybridized with a set of oligonucleotide probes targeting selected microbial groups encompassing key genera of thermophilic bacteria and archaea . 0.76577532^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.59174998
Here we found that TAF 1 interacts with the Ad DNA through core protein 7 in infected cells in early phases of infection . 0.59174998^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.53331847
A minimal amount of extranucleosomal DNA was required for nucleosome mobilization by ISW 2 as shown by using a photochemical histone mapping approach to analyze nucleosome movement on a set of nucleosomes with varied lengths of extranucleosomal DNA . 0.53331847^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.55229053
TAF 1 associates with chromatin in vitro and can substitute for the related protein NAP 1 in assembling chromatin onto cloned DNA templates in cooperation with the remodeling enzyme ATP dependent chromatin assembly factor ( ACF ) . 0.55229053^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.61734603
Recently , it was reported that the adenovirus DNA interacts with TAF 1 and pp 32 , another host acidic protein ( Y . 0.61734603^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.64719264
We compared a set of early CCR 5 tropic viruses with low viral DNA content in CCR 5 negative cells to a set of late CCR 5 tropic viruses with high viral DNA content in CCR 5 negative cells . 0.64719264^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.53912537
For MLPA , DNA was extracted from frozen samples , PCR amplified with a probe set containing three hemi primer sets for the HER 2 locus and another nine control probes spread over chromosome 17 and other chromosomes , and analyzed on a gene scanner . 0.53912537^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
ApEn was tested on a small patient set containing VF , VT , and sinus rhythm ( SR ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Pincus introduced approximate entropy ( ApEn ) , a set of measures of system complexity closely related to entropy , which is easily applied to clinical cardiovascular and other time series . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In DNA of similar density obtained from senescent cultures of the same race s , about 11 % of the molecules consisted of a multimeric set of circles ranging in size from 0 . 9 to 15 micrometer , with most being in the 1 . 8 and 2 . 7 micrometer classes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Dose response curves were compared for deletions [ ColBR ( resistant to colicin B ) mutations being more than 80 % deletions ] and base changes ( reversion of argFam to prototrophy argplus ) induced in the same set of E . coli strains ( wild type for DNA repair , uvrA , polA and recA ) by N methyl N ' nitro N nitrosoguanidine ( NTG ) , ethyl methanesulfonate ( EMS ) , hydroxylamine ( HA ) , 4 nitroquinoline 1 oxide ( 4NQO ) , mitomycin C ( MTC , UV and 10 rays . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A linear arrangement for nucleolar DNA and a model of DNA organization in the neighbourhood of a set of ribosomal genes , which may play a fundamental role in the elaboration of nucleolar chromatin tertiary structure , are presented . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thus a segment of mitochondrial DNA corresponding to a given mit mutation or to a set of mutations can be delineated . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A mathematical model is presented that permits simulation of a time sequence of DNA distributions with a single set of cell cycle parameters . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In all normal mouse cells tested , the cellular set of M MSV specific nucleotide sequences was present in DNA as one to a few copies per cell . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The mutants have been crossed to a set of rho tester strains with different segments of mitochondrial DNA . ^^^ Mutants in class 2 were restored by a set of rho clones whose retained segments of mitochondrial DNA contained the cytochrome b but not the cytochrome oxidase loci . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The singly cleaved DNA is a complete set of full length permuted linear molecules . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A new set of hybrid viruses has been isolated whose closed circular genomes 5 to 6 kB in size , contain DNA sequences derived in part from adenoviruses 2 and in part from SV 40 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This fragment mapped between 750 and 2250 base pairs from the right end of the proviral DNA ( corresponding th the 3 ' terminus of the viral RNA ) and contained the whole set of the sarcoma specific information . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Moreover , it provided a set of twenty three p petite mutants , each containing a differentially deleted mit DNA segment included in the oxi 3 region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Included among this new set of RNA ' s are sequences that are transcribed from the DNA genome of the endogenous AKR type murine leukemia virus present in AKR 2B cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The cell line 5A was found to contain a contiguous set of viral DNA sequences mapping between 0 . 26 and 0 . 41 on the HSV 1 genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Since Eco RI and Bam HI cleavage of DNA from each mammary tumor generates a unique set of viral specific fragments , we propose that the tumors are composed principally of cells derived from a subset of the many infected cells in a mammary gland ; this proposal is supported by our finding that Eco RI digestion of DNA from several transplants of a primary tumor yields the pattern characteristic of the primary tumor . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By molecular hybridization , each set of FeSV specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
On the other hand , the region between the N terminus of the T antigen genes and the origin of replication is dominated by a similar set of palindromic sequences in BKV and SV 40 DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Each sample consisted of a set of closed circular DNA molecules differing by one turn in their number of superhelical turns . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
T 3 bound to a single set of binding sites in normal adult lymphocyte nuclei with a mean Ka of 8 . 9 + / 7 . 1 10 109 M 1 , and a capacity of 4 . 4 + / 2 . 9 fmol / 100 micrograms DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This complex set of reactions is initiated when lambda DNA is mixed with the product of the phage A gene , and proheads . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA molecules of the plasmid ColEl are normally recovered from wild type cells as a set of monomer and multimer size rings . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Heat treated samples of human mitochondrial DNA ( mtDNA ) exhibited a set of three low molecular weight DNA bands in addition to the major mtDNA band when electrophoresed in polyacrylamide gels . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analysis of the set with 10 ranging from 1 to 58 gives the DNA helix repeat in solution as 10 . 4 base pairs per turn under physiological conditions , with an estimated probable error of + / 0 . 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
First , a multimeric set of circular DNA was observed for both race s and A , with a monomeric repeat size of 0 . 89 mu . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DDVI specific enzyme , similar to B specific type , methylates DNA with a normal set of nitrogenous bases ( phages Sd and DDII ) , as well as DNAs containing 5 oxymethylcytosine and glucose ( phages T 2 and DDVI ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Third , the radioactive plasmid DNA was digested with restriction enzyme ( EcoRI ) , producing a set of RTF Tc and r determinant fragments with differing 3H / 14C isotpe ratios . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of partially overlapping DNA restriction fragments that support promoter dependent transcription of the tRNATyr 1 gene of Escherichia coli has been used to study site specific termination in vitro . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of mutants at the lexA locus produced protein 10 at different rates and degraded their DNA at rates which were inversely correlated to their rates of protein 10 production . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The effect of the chemical is apparently selective with respect to base damage ; coliphages containing cytosine in their DNA are inactivated by treatment with sodium bisulfite , whereas those containing hydroxymethylcytosine are not . ura DNA glycosylase and the major apurinic apyrimidinic endonuclease of E . coli may function in the same repair pathway , since the extent of inactivation of a congenic set of strains which are ung xth ( structural gene for the major apurinic apyrimidinic endonuclease of E . coli ) or ung xth+ is the same . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Error analysis is presented as a method to select a model of optimal complexity in relation to the resolution provided by the data in a given set of DNA histograms . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of vector DNAs ( Y vectors ) useful for the cloning of DNA fragments in Saccharomyces cerevisiae ( yeast ) and in Escherichia coli are characterized . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of four plasmids containing overlapping segments comprising a total of about 30 kbp of cloned DNA from chromosome 3 of yeast ( Saccharomyces cerevisiae ) has been isolated and characterized by restriction endonuclease analyses and DNA : DNA hybridizations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Fragments of lambda drifd 18 DNA with different end points within the set of structural genes of ribosomal proteins L 11 ( RPLK ) , Li ( rplA ) , L 10 ( rplJ ) and L 12 ( rplL ) as well as the beta ( rpoB ) ANd beta ' ( rpoC ) subunits of RNA polymerase have been cloned on plasmids . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Cell kinetics , which for a long time could only be worked out at the level of mitosis , has now at its disposal a set of technics which make it possible to label cells which replicate their DNA , to appraise the DNA content of individual cells and to synchronise cell populations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This has enabled us to show that there are two gamma globin genes per haploid set , that the genes contain ' introns ' within the same regions of DNA as the human beta and delta globin genes , and that the genes are 3 , 500 base pairs apart . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Though many nuclear RNA transcripts of single copy DNA sequences are held in common between tissues , an additional set , probably consisting of non message sequences , is not shared . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It may be assumed that brain nucleosomes are characterized by a higher size heterogeneity of linked DNA , part of which are mostly covered by non histone proteins , and / or are characterized by a greater set variety . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A batch elution method with hydroxylapatite was developed to assay DNA damage by a set of antitumor anthracycline derivatives and was standardized with respect to the kinetics of unwinding , size of the alkaline unwinding unit , and fidelity of selective elution of single and double stranded DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Four different regions of rabbit beta like globin gene sequences designated beta 1 , beta 2 , beta 3 and beta 4 were identified in a set of clones isolated from a bacteriophage lambda library of chromosomal DNA fragments ( Maniatis et al . , 1978 ) . ^^^ Cross hybridization and transcriptional orientation experiments indicate that the set of beta like gene clones contains overlapping restriction fragments encompassing 44 kb of rabbit chromosomal DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Four components of three sets of DNA constituents , bases , deoxyribonucleosides and deoxyribonucleoside 5 ' monophosphate , were sufficiently resolved under one set of chromatographic conditions using high performance liquid chromatography with a reversed phase column ( Zorbax ODS ) and the solvent 0 . 4 M NH4H2PO4 ( pH 3 . 5 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Furthermore , hybridization of expressed DNA to nRNA mixtures showed that nRNA from nonwithdrawn and withdrawn oviduct contained a similar set of unique sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We thus conclude that the cloned DNA represents a set of genes which is active early in development . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of nomographs for determination of standard sedimentation constant values for DNA and RNA directly from the results of centrifugation without any marker is calculated and plotted for 9 Spinco bucket rotors , 5 temperatures , and two commonly used sucrose gradients ( 5 20 and 15 30 % ) . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The proportion of total cell DNA which is mitochondrial DNA was measured in haploid , diploid and tetraploid strains of S . cerevisiae grown under a standard set of conditions . ^^^ This regulation is mediated through the availability of a set of nuclear coded components , possibly a mitochondrial membrane site , which are required for the replication of mitochondrial DNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
They suggest that ribonuclease H 1 belongs to the set of enzymes which are involved in DNA synthesis . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The presence of extra sugar in DNA with standard set of nitrous bases is discussed . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Chromatin which has been hydrodynamically sheared in a low ionic strength buffer lacking divalent cations ( 1 = 0 . 0005 M ) contains a heterogeneous set of deoxyribonucleoprotein particles but no molecules of free DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The second set corresponds to alpha = 0 . 82 and the corresponding binding constant is only three or four times lower than that of pure DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The results are consistent with the hypothesis that a complete or nearly complete set or tRNAs can be transcribed from chloroplast DNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Chromatin which was hydrodynamically sheared in a low ionic strength buffer lacking divalent cations ( mu = 0 . 005 ) contains a heterogeneous set of DNP particles but no molecules of free DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Since guanosine tetraphosphate ( ppGpp ) has been implicated in stringent control , we examined the effects of ppGpp on the in vitro synthesis of r proteins directed by DNA from transducing phage lambdafus 3 and lambdarifd 18 . lambdafus 3 carries genes for protein elongation factors EF Tu and EF G , and RNA polymerase subunit alpha , in addition to genes for approximately 27 r proteins . lambdarifd 18 carries genes for EF Tu , RNA polymerase subunits beta and beta 1 , and a set of rRNAs , in addition to genes for approximately five r proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA of the AKR mouse contains a set of murine leukemia virus sequences that are not present in DNA of the NIH Swiss mouse . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Polynucleotide ligase , acting on nicked circular DNA , forms under the same conditions , the same set of closed DNAs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using RNA polymerase purified from Escherichia coli , DNA isolated from the bacteriophage T 4 , and a bacterial supernatant fraction containing the necessary processing enzymes , a set of transfer RNAs can be formed in vitro . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The pattern of divergent transcription of the argEC BH cluster of genes previously demonstrated by the hybridization of RNA to the separated strand of a phi 80 darg transducing phage , is confirmed with the DNA of a set of different lambdadarg phages . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This virus was shown to contain a molecule of double strander DNA with the standard set of nitrous bases ( 37 . 8 mol % GC ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The approximate DNA content is 0 . 51 0 . 58 picogram per diploid set . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Approximate DNA content is 0 . 51 0 . 58 picogram per a diploid set . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Digestion of this monomeric subunit results in the solubilization of 46 % of the DNA and analysis of the resistant DNA again reveals the set of eight lower molecular weight fragments . ^^^ Further attack results in cleavage at a set of sites within the monomer liberating a pattern of smaller DNA fragments which probably represents the points of intimate contact between the histones and DNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The proposed model of the nucleosome , being more detailed than earlier models permits us to explain in direct structural terms the yet unordered set of data bearing on the pattern of histone histone interactions in chromatin , the results of a mild deoxyribonuclease digestion of DNA within the nucleosomal particle and also the quantitative data on the unwinding of the DNA duplex upon formation of the nucleosome . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Half of hydrogen bonds normally existing in beta structure are broken upon complex formation with DNA and a new set of hydrogen bonds is formed between polypeptide amide groups and DNA base pairs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of covalently closed circular duplex simian virus 40 DNA preparations of varying superhelical densities was prepared by closure of nicked duplex DNA with polynucleotide ligase in the presence of varying amounts of ethidium . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Half of the hydrogen bonds normally existing in beta structure are broken upon complex formation with DNA and a new set of hydrogen bonds is formed between polypeptide amide groups and DNA base pairs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Two out of the nine sets of promoters prepared , each covering about 650 nucleotides spanning from 16S RNA to 23S RNA regions , produced the corresponding DNA fragments from all the strains tested , and another set did so from all species but Mycoplasma . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our results lead us to propose a new hypothesis in which it is suggested that metaphase corresponds to the arrangement of condensed DNA bodies , or `` chromosomes ' ' around the MTOC and , through the assembly of microtubules , one set of uncondensed chromatin is displaced to the opposite pole of the nucleus , while the other remains condensed and associated to the original MTOC . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analysis by in situ plaque hybridization of a set of 1132 clones has revealed the presence of repetitive DNA sequences in about 38 . 1 % of the clones screened . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of experiments has been conducted to choose the optimal conditions for DNA transfer and fixation on two types of the nitrocellulose , three types of nylon membranes and on capron filters . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
As part of a strategy to clone the HD gene on the basis of its chromosomal location , we isolated genomic DNA from the HD region as a set of overlapping yeast artificial chromosome ( YAC ) clones . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By recording the coordinates of positive hybridization signals , the subset of clones within the library detected by each STR probe can be defined , and directly compared with the set of clones detected by naturally occurring ( cloned ) DNA fingerprinting probes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In another set of experiments the mice were treated up to three months of age , whereafter islet insulin release , islet insulin content and DNA content was measured together with an evaluation of spleen cell proliferation rates . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The authors utilized a set of satellite DNA probes , specific for chromosomes 7 , 17 , 10 , Y in order to detect numerical chromosome aberrations in tumor cell nuclei . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The 5 ' NC region primer set detected HCV specific RNA , verified by high stringency Southern blot hybridization and DNA sequencing , in 100 % of 15 acute and 33 chronic non A , non B hepatitis patients from the United States , Europe , and Asia and 10 hepatocellular carcinoma patients from Africa and Asia that tested negative for the hepatitis B virus encoded surface antigen . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The minimal set of seven herpes simplex virus type 1 ( HSV 1 ) genes required for viral origin dependent DNA synthesis was previously identified using a transient replication assay in a mammalian cell line permissive for HSV 1 growth . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For this set of radiation hybrids , one map unit ( centiray ) corresponds to 20 50 kb of DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We describe a set of IBM compatible computer programs designed to selectively identify the potential sites for silent mutagenesis within a target DNA sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results suggest that sequence dependent groove width may play an important role in allowing an expanded set of DNA binding motifs for synthetic peptides . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Presently , we describe a set of assays directed toward the discovery of novel inhibitors of eukaryotic topoisomerase 1 , an enzyme critical to maintenance of chromosomal DNA topology and therefore essential for normal replication and transcription . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of transgenic yeast strains carrying the 1 Sce 1 sites at various locations along a chromosome defines physical intervals against which new genes , DNA fragments or clones can be mapped directly by simple hybridizations . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Transposon based PCR allows us to study amplification of DNA fragments that vary in size and sequence using only a single set of primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
From each set of six , one sequence was found to be identical to the genomic sequence , which we have isolated from a subgenomic library of 108F DNA in lambda NM 1149 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This review will focus on experimental data supporting this new representation of this set of autoantibodies directed against DNA , histone and the nucleosome , and their possible intervention in SLE pathogenesis . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Simian virus 40 chromosomes can be replicated in vitro with the same set of purified proteins required for the replication of naked DNA containing the viral origin . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a set of four DNA probes spanning the coding region and part of the flanking region of the E . histolytica ribosomal RNA genes , an analysis of the DNA bands generated by EcoRI digestion of Entamoeba DNA is presented . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The ODC related sequence family thus comprises a set of genomically dispersed `` marker ' ' loci , and alleles for several of these loci can be analyzed simultaneously in DNA from mice or cell lines . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The remaining five DNA probes are closely linked to MEN 1 , with no crossovers in our set of families . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genomic DNA from the somatic cell hybrids was tested for hybridization with each of an ordered set of probes used previously to construct a genetic map of chromosome 10 , as well as several additional probes , previously localized by in situ hybridization . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Recombinant DNA technologies have facilitated the development of a set of polymorphic DNA markers covering the human genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Further studies with a series of back mutants of the ftz msh chimera have revealed that a set of class specific DNA backbone contacting residues in the HTH , particularly Arg 28 and Arg 43 , are required for efficient target site recognition and , hence , full ftz activity both in vitro and in vivo . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
From a set of 600 human brain complementary DNA clones , 348 were informative nuclear encoded messenger RNAs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The extent and the variation of losses of genetic material were examined in a series of 191 human breast cancers by means of a set of 18 polymorphic DNA probes , specific of 7 chromosomal arms ( 1p , 1q , 3p , 11p , 13q , 17p and 18q ) known to be frequently affected by allele losses . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of anonymous DNA clones as markers for mouse gene mapping . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have identified , in Southern blots , a set of P 40 related sequences in BXD recombinant inbred mouse DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have also begun testing non human primates for a set of human DNA polymorphisms . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this paper we describe a method for the statistical reconstruction of a large DNA sequence from a set of sequenced fragments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Forty one deletions for chromosomes 7A , 7B , and 7D , and a set of genetically mapped DNA probes , were used to construct physical maps . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Northern blot analysis , using a set of DNA probes corresponding to various parts of the human PDGF A chain gene , indicated heterogeneity in both the 5 ' and 3 ' end of the transcripts . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the disassembly pathway , a set of Escherichia coli heat shock proteins termed the Hsp 70 complex DnaK , DnaJ , and GrpE act with ATP to release lambda P protein from the nucleo protein complex , freeing the DnaB helicase for its DNA unwinding reaction . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This set of oligonucleotides can be used also for amplification of genomic DNA or cDNA libraries . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have previously made a set of DNA constructs by fusing the mature part of Bacillus licheniformis alpha amylase with the signal sequence of B . amyloliquefaciens alpha amylase at various distances from the signal sequence cleavage site . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It is easy to envisage , for example , an automated method for large scale DNA fingerprinting of individuals based upon a standard set of highly informative , dependable microsatellite polymorphisms . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this study , to gain a general insight into the structural features of sequence directed DNA curvatures , we constructed a set of plasmids carrying curved DNA segments , which were randomly cloned from Streptomyces total DNA with extremely high G / C contents . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An additional ttk related cDNA clone was isolated which gives rise to an 88 kDa protein with an alternative set of zinc fingers having a DNA binding specificity distinct from that of the 69 kDa protein . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA binding domain was finely located within the N terminal 134 amino acid residues covering a predicted helix loop helix ( HLH ) structure , by using a set of recombinant products with stepwise deletions from the C terminus . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results strongly suggest that each transgene copy possesses a complete set of specific nucleoprotein complexes and that , with or without HSS 2 , the DNA is in a potentially active configuration . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sequences for nine species of black flies were obtained for tRNA leucine ( CUN ) from DNA amplified with another primer set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of plasmid cloning vectors has been constructed , allowing the integration of any DNA fragment into the bacteriophage lambda attachment site attB of the Escherichia coli chromosome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
HS PCR consistently and reproducibly enhanced product yield and specificity over R PCR at all three loci in the entire set of DNA samples . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this sense the set of molecules is complete and serves as a model system for evaluating sequence dependent local stability of DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The preparation and characterization of DNA dumbbells that contain the 16 base pair duplex sequences 5 ' G C A T A G A T G A G A A T G C 3 ' ( set 1 ) and 5 ' G C A T C A T C G A T G A T G C 3 ' ( set 2 ) are reported . ^^^ C base pairs ( bps ) nucleating the T 2 end loops were intact was obtained from a comparison of the melting temperature of this molecule with that of a DNA dumbbell containing the 14 central bps of the set 1 duplex sequence linked instead by end loops comprised of the four base sequence , C T T C . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Macronuclear differentiation is accompanied by a developmentally programmed set of DNA rearrangements , including chromosome fragmentation , telomere addition , and amplification . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
While domains 1 3 and 8 10 are each encoded by a single exon ( 5 7 , 16 18 ) ; all other domains are contained in a set of two exons which are separated by introns interspersed at variable positions of the DNA segment coding for the conserved sequence motif . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A novel nested set strategy for the production of overlapping fragments for DNA sequencing was used to determine the complete nucleotide ( nt ) sequence of both strands of the ERp 60 clone . ^^^ This procedure possesses several advantages over other nested set techniques , since it does not require ( 1 ) the re cloning of the DNA insert into other vectors , ( 2 ) any prior knowledge of the restriction sites of the nt sequence , or ( 3 ) the transformation and analysis of bacterial subclones . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
AlgR binding sites within the algD promoter make up a set of inverted repeats separated by a large intervening segment of DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Primer set IA IB was used to amplify a 278 bp DNA fragment , and primer set IAN IBN was used to prepare a probe directed to a site within the PCR amplified target DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These same alterations in chromatin structure were induced by a truncated estrogen receptor with both TAF 1 and TAF 2 transactivation functions deleted , suggesting that DNA binding per se disrupts chromatin structure . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A study was made of the interaction between restriction endonucleases recognizing CCNGG ( SsoII and ScrFI ) or CCA / TGG ( MvaI and EcoRII ) DNA sequences and a set of synthetic substrates containing 1 , 3 propanediol , 1 , 2 dideoxy D ribofuranose or 9 [ 1 ' hydroxy 2 ' ( hydroxymethyl ) ethoxy ] methylguanine ( gIG ) residues replacing either one of the central nucleosides or dG residues in the recognition site . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of plasmid vectors which allow single step cloning and expression of PCR amplified DNA coding sequences has been constructed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The four sets of DNA sequencing fragments are separated in a single capillary and then distinguished by using a binary coding scheme where each fragment set is labeled with a characteristic ratio of two dye labeled primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Cell survival was nearly constant in the range 1 300 mM sucrose . ( d ) E . coli in the early and mid exponential growth phases was more susceptible to PEF for DNA transfection than it was in the stationary phase . ( e ) For a given set of electric parameters , TE was the highest at neutral pH and was greatly reduced at acidic and alkaline pH . ( f ) Increasing the temperature from 0 to 37 degrees C resulted in the reduction of TE by three orders of magnitude . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A comparative functional analysis of a systematic set of TFIIIA zinc finger combinations reveals that most , if not all , participate in both DNA and RNA binding . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of interspersed DNA segments was identified , which match various parts of the human prothymosin alpha molecule . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Each set of primers amplified 538 bp and 109 bp products , representing part of a gene encoding a possible major 58 kDa immunogenic protein , from whole genomic DNA extracted from R . tsutsugamushi strains Karp , Kato , Gilliam , Kuroki and Kawasaki . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The so called E proteins in a set with DNA penetrate through a cell membrane . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We furthermore studied the association of a set of DNA fragments covering the 13 kb human G gamma / A gamma globin gene domain , the 16 kb psi beta / delta globin gene domain and the 10 kb beta globin gene domain with the nuclear matrix of K 562 and Raji cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These include a set of auxotrophic strains with an essentially wild type genetic background , plasmids that act as Escherichia coli P . pastoris shuttle vectors , and genomic DNA libraries for isolation of P . pastoris genes by functional complementation of mutants or by nucleic acid hybridization . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The HsdS and HsdM polypeptides of the type IC restriction enzyme EcoR 124 have been purified independently and used in a set of gel retardation experiments to determine the minimum requirements for sequence specific recognition of DNA by this enzyme . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The assay used a single set of 20 base primers complementary to sequences located in the coding regions of the CAA replicative form ( RF ) DNA genome at positions 485 to 504 and 1048 to 1067 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The procedure gives sufficient DNA for one set of thermally cycled sequencing reactions when analysed on the Applied Biosystems 373A fluorescent DNA sequencer . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We present a method for the evaluation of primer performance in automated DNA sequencers and show its application to the search for a better set of primers for pBluescript vector . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The correct and complete strain distribution patterns for 56 genetic markers are reported for the remaining RI strain set , which consists of 31 living strains and 8 extinct strains for which DNA is available . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have used recombinant DNA technology to engineer a set of murine 3T3 cell lines that vary in the extent to which they express TIMP , tissue inhibitor of metalloproteinases , and we have found that both invasiveness and tumorigenic potential are conferred when TIMP production is impaired . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of activators ( class 1 transcription factors ) which make contact with this contact site 1 region on RNA polymerase alpha subunit bind in most cases to DNA upstream of the promoter 35 signal . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Low stringency amplification of meningococcal chromosomal DNA with this primer set resulted in the amplification of two products from each strain , whereas at higher stringencies only one product was amplified in most strains . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For man this set of 46 per cell stretches to a 6 foot strand of DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The structural organization of a set of highly repetitive DNA sequences ( HRS ) of barley ( Hordeum vulgare ) was studied by blot hybridization in the genomes of seven Hordeum L . species and several Hordeum 10 Secale hybrids . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These data suggest that in SLE patients a common antigenic stimulus may evoke anti DNA and anti cardiolipin autoantibodies and provide further evidence that a small set of developmentally restricted VH genes can give rise to disease associated autoantibodies through Ag selected somatic mutations . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Preliminary screening of amplified DNA with this set of ASOs indicated that 80 % of symptomatic HFI patients can be identified in the American population by this simple genetic test . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have found that region 3 does not consist of a contiguous set of flagellar genes , as was thought , but that in E . coli there is almost 7 kb of DNA between the filament cap gene , fliD , and the next known flagellar gene , fliE ; a similar situation occurs in S . typhimurium . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
There is extensive homology between the DNA from the different species , consistent with the suggestion that the different siderophore synthesis genes have evolved from the same ancestral set of genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The entire set of genes encoding the puromycin biosynthesis pathway was cloned by screening a gene library from S . alboniger , raised in the low copy number cosmid pKC 505 , with a DNA fragment containing pac and dmpM . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here we report the statistical analysis of this data set , investigating the relationships between AI , DNA aneuploidy and several clinico pathological parameters of tumor progression . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have isolated a set of ligand binding DNA sequences from a large pool of random sequence DNAs by selection and amplification in vitro , using similar methods to those described for the isolation of ligand binding RNAs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We present here an evaluation of the free energy of creating four arm branch points in duplex DNA , using a system of two complementary junctions and four DNA duplexes formed from different combinations of the same set of eight 16 mer strands . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Nonisotopic fluorescence in situ hybridization ( FISH ) with human DNA in a set of eight hybrids demonstrated the presence of from one to eight human fragments per cell independent of irradiation dose . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This information regarding sequence composition effects in triple helix formation establishes a set of guidelines for targeting sequences of double helical DNA by the pyrimidine triple helix motif . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Each cDNA hybridizes to a single species of brain mRNA and to a specific set of restriction fragments in human genomic DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An extended set of PCR primers has been utilised to identify 10 mitochondrial DNA deletions in a 69 year old female subject with no known mitochondrial disease . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the present study , the usual prognostic factors and a set of genetic alterations , i . e . , Ki ras mutations , DNA content , and allelic losses on chromosome 17p , 18q , 5q , and 1p , were investigated in 109 colorectal carcinomas . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sixty synthetic probes mimicking minisatellite structures have been used on Southern blots bearing a set of DNA samples from a panel of complex genomes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Based on recognition of the same DNA sequence by Max and c Myc Max complexes and differential expression of the two genes , we propose that Max homodimers and c Myc Max heterodimers may bind to a common set of cellular target genes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Electrophoresis of binding reactions with a bidirectional set of progressively shortened probes results in a stairway pattern of both uncomplexed DNA and specific protein / DNA complexes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The objectives of the study were : ( 1 ) to assess inter laboratory variation of PCR sensitivity , ( 2 ) to evaluate the DNA ' carryover ' problem and frequency of false negative results and ( 3 ) to examine the utility of the complete set of reagents and templates to act as reference preparations for HIV PCR . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a set of primers ( 20 mer each ) derived from the nucleotide sequence of EO 3 , we performed specific amplification of a 1 . 8 kbp DNA fragment within EO 3 by PCR . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The amplified DNA was subjected to a second round of amplification , which employed a set of 18 nested allele or group specific primer pairs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A clustered set of internal deletions was created in this region by exonuclease treatment of the dacB coding DNA , starting from two internal restriction sites . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The abundance of all tetra and pentanucleotide sequences is calculated for a set of DNA sequence data comprising 767 , 393 nucleotides of the E . coli K 12 genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA analysis of HLA DRB 1 sequences shows that a limited set of alleles are positively associated with the disease . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
TAF 1 , located in the N terminal region A / B , has been narrowed down to a 91 amino acid sequence , which is sufficient for transcription activation in chimeras with the GAL 4 DNA binding domain . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Concurrent studies using numerical taxonomy and DNA hybridization with the aerC probe on a larger set of strains led to the identification of a distinct cluster of 14 presumed atypical Aeromonas sobria strains . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The same two XMyb 1 proteins , which both contain the complete set of aminoterminal repeats , specifically bind to the c Myb specific DNA binding sequence as evidenced by electrophoretic mobility shift analysis in vitro . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In order to investigate the influences of the different counterions on the stability of the probe DNA complex , a set of static fluorimetric measurements were performed in a wide range of concentrations ( 1 mM to 2 M ) of different alkaline earth chlorides . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
QSAR analysis of a set of benzothiopyranoindazole anti cancer analogs based upon their DNA intercalation properties as determined by molecular dynamics simulation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The inheritance of a large set of antinuclear antibodies ( for example , DNA , Sm , RNP , Ro , La , histones ) and 16 / 6 idiotype seemed to be related to some unknown genetic factors but not related to HLA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using this technique , we have characterized a set of HeLaS 3 nuclear proteins of 26 . 5 , 28 , 90 , and 97 kDa that specifically bind to cisplatin DNA adducts . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This set was incorporated into the Salmonella specific bacteriophage P 22 based challenge phage selection and used to define the DNA sequence determinants for the binding of Hin to DNA in vivo . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We analyzed a set of MCM 1 deletion derivatives using in vivo reporter gene assays and in vitro DNA binding studies to determine which regions of MCM 1 are important for its various activities . ^^^ We also analyzed a set of LexA MCM 1 hybrids to examine the ability of different segments of MCM 1 to activate transcription independent of MCM 1 ' s DNA binding function . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Carboxylethylation interference analysis of a set of selected sites suggests that MCM 1 contacts DNA in its major groove throughout one helical turn . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The identity of the supernumerary isochromosome 12p was proven by LDH isozyme electrophoresis using cultured fibroblasts and by nonradioactive in situ hybridization using a biotinylated set of chromosome 12 specific DNA probes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A reduced set of coordinates for modeling DNA structures : ( 1 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using our model for predicting DNA superstructures from the sequence , the average distribution of the phases of curvature along the sequences of the set of the 177 nucleosomal DNAs investigated by Satchwell et al . ( J . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The polymerase chain reaction ( PCR ) was used to amplify herpes simplex virus DNA using a single set of primers that amplify both herpes simplex virus 1 ( HSVI ) and 2 ( HSVII ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The maximum speed of replication fork movement was 200 300 nucleotides / min , which was similar to the rate of SV 40 DNA replication with the same set of proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
As some HPV non specific DNA was also often amplified , another set of degenerate primers was designed which amplified a 335 bp sequence contained within the 441 bp sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In order to determine which chromosome ( s ) carries a tumor suppressor gene ( s ) for human ovarian cancer , we examined loss of heterozygosity in 37 tumors with a set of polymorphic DNA markers which cover each autosomal chromosome arm partially . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In response to DNA damage or the inhibition of normal DNA replication in Escherichia coli , a set of some 20 unlinked operons is induced through the RecA mediated cleavage of the LexA repressor . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To map the DNA binding domain of polyomavirus large T antigen , we constructed a set of plasmids coding for unidirectional carboxy or amino terminal deletion mutations in the large T antigen . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 4 nuclear proteins binds to a DNA sequence within the FOS promoter region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We conclude that in our study set , the PCR procedure detected EBV DNA but not cytomegalovirus DNA in a high percentage of cases of Hodgkin ' s disease , including two cases of AIDS related Hodgkin ' s disease . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This motif is described by the set of Eulerian angular values that define the axial path of DNA ( helical twist , deflection angle , direction ) and of the orthogonal components of wedge ( roll and tilt ) . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA extracted from scrapings of their warts showed they carried the same human papillomavirus types as the general population , and not the unique set found on patients with epidermodysplasia verruciformis ( who share with transplant recipients an increased incidence of warts and squamous cell carcinomas ) . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The approach makes use of amplification , by means of several polymerase chain reactions ( PCR ) , of a chosen set of DNA segments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set of experiments uses normal human foreskin fibroblasts , transfected at early passage with SV 40 DNA and subsequently infected with the K ras virus . ^^^ The second set of experiments demonstrate that normal human mammary epithelial cells can be immortalized by transfection with viral DNA from human papilloma virus 16 or 18 , although these viruses have not been associated with breast cancer . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the present study a DNA probe derived from cellular DNA sequences adjacent to the previously characterized HBV insert was used to analyze a set of 19 matched normal liver and HBV positive hepatoma samples obtained from the same region of China , near Shanghai . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genomic DNA and cDNA obtained by reverse transcription of the `` leaky ' ' mRNA found in peripheral lymphocytes were amplified by means of the polymerase chain reaction to yield a set of eight segments comprising the essential gene sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We studied 7 of such chromosome regions , including 3p , 5q , 11p , 13q , 17p , 18q and 22q , using a selected set of DNA markers in 44 Wilms ' tumors , 64 breast and 83 colon carcinomas . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The initial ( up to 30 min ) rate of DNA double strand break ( dsb ) rejoining was measured in irradiated plateau phase CHO cells , in a set of parallel experiments using the same cell suspension , by means of non unwinding filter elution , neutral sucrose gradient centrifugation , and two pulsed field gel electrophoresis assays : asymmetric field inversion gel electrophoresis ( AFIGE ) and clamped homogeneous electric field ( CHEF ) gel electrophoresis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The results are evidence that a specific set of DNA alterations occur in association with the induction of heritable changes in flax . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A third set of experiments showed that the rate of DNA synthesis in mitogenically stimulated human PBL is strongly influenced by variations of the extracellular cysteine level , even in cultures with relatively high and approximately physiological concentrations of cystine . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the method reported here , DNA is amplified with a set of group specific primers and then restricted with a number of endonucleases . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For each set of primers , PCR products amplified from human genomic DNA are specific for the centromere of the target chromosome ( s ) , as shown by somatic cell hybrid mapping and by fluorescence in situ hybridization . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These data imply that the malignant B cells of patients with either CD 5 positive B cell SL NHL or CLL express a restricted set of Ig 5 genes that have not substantially diversified from the germline DNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This program is based on a set of rules which define in generic terms both the sequence composition of the primers and the amplified region of DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A new set of cDNA clones spanning approximately 3 . 2 kb was isolated from a lambda ZAP goose liver cDNA library using the 5 ' most exon containing fragment of the 5 ' most genomic DNA clone . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The stability of the elongation complex is described by a `` free energy of formation ' ' function ( delta G zero f ) that is a sum of terms for forming ( 1 ) a locally denatured 17 base pair DNA `` bubble ' ' ; ( 2 ) a constant length hybrid between the 3 ' terminal 12 nucleotide residues of the RNA transcript and the corresponding region of the DNA template strand ; and ( 3 ) a set of binding interactions between the polymerase and certain DNA and RNA residues within and near the `` transcription bubble ' ' . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 21 polyheteroaromatic compounds substituted with flexible cationic groups and of similar molecular size has been analyzed for binding with DNA and for effects of the bleomycin mediated degradation of the DNA double helix . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The investigation of DNA samples for restriction fragment length polymorphisms from the same set of individuals revealed a correlation of the Msp 1 0 . 7 kb fragment with BF F , and confirmed the correlation of a Taq 1 6 . 6 kb fragment with BF FA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The phylogenetic analysis of this data set indicated P . modestum to represent a new separated line of descent within the radiation of eubacterial phyla moderately related to cyanobacteria and Gram positive bacteria with low DNA GC content . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In order to characterize novel human immunodeficiency virus type 1 ( HIV 1 ) continuous epitopes , we designed a simple method , based on recombinant DNA , providing a complete set of peptides derived from HIV 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This system has been expanded to include macrosimulation of DNA synthesis and the study of its regulation by terminal deoxynucleoside triphosphates ( dNTPs ) via a complex set of interactions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It was determined that selection for resistance to the DNA replication / repair inhibitor , 1 beta D arabinofuranosylcytosine ( ara C ) , would permit production of a set of 10 ray sensitive mutant cell lines that would be defective in the resynthesis step of excision or recombination repair . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In addition to predicting the most likely spacer length for a set of DNA fragments , the method identifies individual sites that differ in spacer size . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A large number of measurements of nucleosome repeat lengths are analyzed and are found to exhibit preferential quantization to a set of values related by integral multiples of the helical twist of DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analysis of a set of structurally related substrates showed that integrase could promote a range of DNA cleavage ligation reactions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Together , these regulatory proteins recognize a specific DNA operator , marking a set of genes for transcriptional repression . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Escherichia coli strains isolated before travel , during episodes of travellers ' diarrhoea , immediately after return and five weeks after return were serotyped and tested for the presence of virulence genes indicating diarrheogenic properties by hybridization with a set of four non radioactively labelled DNA probes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA duplexes containing either O 6 alkylguanine or O 4 alkylthymine were synthesized , and each duplex was ligated to form a set of DNAs of increasing length with the alkylated base out of phase ( 16 base pairs apart ) or in phase ( 21 base pairs apart ) with the helical repeat of the DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Human genomic regions were hybridized and characterized by a set of polymorphic restriction DNA fragments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Detection of variable DNA repeats in diverse eukaryotic microorganisms by a single set of polymerase chain reaction primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Retroviral DNA integration involves a coordinated set of DNA cutting and joining reactions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA extracted from apoptotic cells cultured with TNF alpha and IFN gamma was fragmented , and a set of bands of the ' 200 bp ladder ' , which is characteristic of the DNA of apoptotic cells , was observed in agarose gel electrophoresis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have microdissected divisions of the Anopheles gambiae polytene chromosomes , digested the DNAs with a restriction enzyme , and PCR amplified the DNA fragments to generate a set of pooled probes , each corresponding to approximately 2 % of the mosquito genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Human immunodeficiency virus type 1 ( HIV 1 ) DNA was amplified in the polymerase chain reaction with Taq polymerase and a set of primers for the pol gene , one of which contained T 7 RNA polymerase promoter sequences . ^^^ For detection of dilutions of HIV 1 with PCR , a set of primers ( outer set ) was used for amplification of HIV 1 DNA . ^^^ In a separate reaction a set of primers nested between the first set generated through PCR an amplified DNA fragment with the T 7 promoter . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Complementary strand MPE footprinting on a EcoRI / Hind 3 restriction fragment of pBR 322 DNA demonstrated that either E or Z forms of 3 give a single set of footprints very similar to that of the parent antibiotic with strongest protection at TAAG and TATTAT with moderately strong protection at ATTT and AAAA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The sensitivity increased approximately 1000 fold when the DNA was reamplified with a set of nested primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To ensure that the polymerase chain reaction ( PCR ) primers employed in these studies had amplified all of the tamarins ' expressed MHC class 1 genes , we used another set of primers to amplify only exons 2 and 3 from RNA and DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An efficient algorithm for generating DNA structures from a given set of distance constraints has been developed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have mapped a set of preferred topoisomerase 1 ( Topo 1 ) cleavage sites in the region of DR 1 on plus strand DNA and in the cohesive overlap near DR 2 and have tested whether Topo 1 is capable of mediating illegitimate recombination of woodchuck hepatitis virus ( WHV ) DNA with cellular DNA by developing an in vitro assay for Topo 1 mediated linking . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The major immediate early regulatory region of human cytomegalovirus ( HCMV ) has a complex set of DNA sites through which both cellular and viral factors coordinately regulate immediate early gene expression . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thus , the enzyme stalls or stops at the nucleotide immediately adjacent to the modified base , resulting in the accumulation of DNA strands at these sites and in diminished read through beyond these sites in a set of CPI treated DNA molecules . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The statistical correlation of nucleotides in a DNA sequence is described by a set of redundancies D 1 , D 2 , D 3 , . . . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Prospects for developing a set of DNA probes for rapid diagnosis of antibiotic resistance are discussed . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The structure of the knots generated by different mutant substrates strongly supports a model involving a unique configuration of DNA strands at synapsis and DNA strand exchange mediated by rotation of one set of Hin subunits after DNA cleavage . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A primer set specifying a 791 bp DNA fragment of the B . burgdorferi B 31 flagellin gene was used . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The ribosomal nucleic acids were visualized after hybridization with a set of biotinylated double stranded ribosomal DNA ( rDNA ) probes from different locations along the gene , followed by immunogold labelling of biotin . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To accurately delineate the DNA sequence elements involved in the transcriptional regulation of the murine MHC class 2 gene E alpha , we have constructed a set of `` linker scanning ' ' mutants of the E alpha promoter region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In addition to the set of curved DNA segments isolated previously from Escherichia coli , another set of curved DNA segments has now been isolated . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of viral DNA decamers enriched in transcription control signals . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The program was aimed at detecting unique or uncommon DNA regions present in crude sequence data and was able to automatically detect the signal peptide coding regions of a set of human insulin receptor gene data . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a simple one tube set of reactions , ss phagemid DNA is annealed to this oligo , cleaved by FokI at a unique site outside the vector multiple cloning site and then labelled at this unique site by Klenow polymerase and [ alpha 32P ] dCTP . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have constructed a set of torsionally tuned inverted repeated DNA molecules which require different superhelical densities for cruciform formation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analysis of the DNA upstream from tus and TerB indicates a set of sensor / regulator genes which are comparable to envZ / ompR . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analysis of double staining of Ki 67 antigen and DNA in the MCF 7 cell line by videomicrofluorometry allows the description of both the level and the pattern of Ki 67 staining in the form of a set of parameters defining each cell . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The carcinogenic action of a set of N nitroso compounds containing the 2 oxopropyl group was considered in relation to their metabolism and their activity as alkylating agents for DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Prominent features include : ( 1 ) very long perfect terminal inverted repeats of nucleotide sequences which are devoid of obvious genetic functions , but are unusually GC rich near both ends of the linear DNA ; ( 2 ) small imperfect palindromes that are situated at the termini of the plasmid and are cognate with the active sites for plasmid integration into mtDNA ; ( 3 ) two large , non overlapping open reading frames , ORF 1 and ORF 2 , which are located on opposite strands of the plasmid and potentially encode RNA and DNA polymerases , respectively , and ( 4 ) a set of imperfect palindromes that coincide with similar structures that have been detected at more or less identical locations in the nucleotide sequences of other linear mitochondrial plasmids . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Data came from a large set constructed , some years ago , from measurements made of regional DNA contents . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
If the quaternary information units of ( DNA or RNA ) nucleotide bases are assigned as 0 ( for A ) , 1 ( C ) , 2 ( U or T ) and 3 ( G ) , then a unique set of amino acid numbers can be obtained by comparing the properties of numbers and coding properties . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA fragments of the selected and unselected library were each heat denatured and again renatured , thereby generating a randomly distributed set of all possible mismatches within the mutagenesis window . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set of primers identifies a 442 bp DNA fragment in the OspA gene and a second pair of amplimers , a 176 bp DNA piece located in the OspB gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In contrast , beta thalassemia / Hb E is easily detected , in the first trimester , by direct visualization on electrophoresis or by dot blot analysis of enzymatically amplified DNA with a set of nonradioactively labeled oligonucleotide probes complementary to the most common mutations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of sense and anti sense oligomeric DNA primers , degenerate in the third `` wobble ' ' base position of codons so as to match all known dengue virus sequences , was evaluated as universal primers in a polymerase chain reaction ( PCR ) assay for the rapid diagnosis of dengue virus infections . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Comparative analysis of related DNA sequences has been simplified by the transformation of data in the standard A , G , C , T format into a set of geometric symbols that promote pattern recognition . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Cleavage of the 73 bp DNA with restriction enzymes produced a small set of defined bands , demonstrating positioning of the ( H 3 H4 ) 2 tetramer on DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
After PCR using one set of primers specific for HPV 16 and HPV52b , 7 out of 31 specimens were found to have HPV 16 DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The 5 erbA protein also bound at high affinity to a set of DNA fragments recognized by the rat thyroid hormone receptor , but the relative affinity of the 5 erbA protein for the different binding sites was distinct from that previously reported for the thyroid hormone receptors . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By means of a set of ordered polymorphic DNA markers from the pericentromeric region , multipoint as well as pairwise linkage analyses place the MEN2A locus at the middle of a small region ( approximately 11 cM ) bracketing the centromere with FNRB ( at 10p11 . 2 ) and RBP 3 ( at 10q11 . 2 ) on either side , providing further support for the centromeric location of the MEN2A locus . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have characterized and genetically mapped two new DNA markers ( DXS 311 and DXS 312 ) with respect to 10 existing loci in Xq 26 Xq 28 in a set of 15 families in which the fragile 10 [ fra ( 10 ) ] syndrome was segregating . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 12 oligo probes was hybridized on polymerase chain reaction amplified DNA , thus allowing the detection of 12 DQB 1 alleles , as demonstrated in homozygous as well as in heterozygous individuals . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The rate of recombinational replacement and the average size of the replacements are estimated in a set of closely related strains in which a clonal frame is dotted with occasional stretches of DNA belonging to other clones . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of ordered cross overs identified in this work is a valuable resource for rapidly and accurately localizing new DNA clones isolated from the pericentromeric region . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It is concluded that DNA RFLP patterns are a useful additional tool , but for epidemiological analysis a set of different methods should be used . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have used a set of polymorphic DNA markers from chromosome 11q to investigate this region for linkage to a susceptibility gene in 81 multiplex diabetic pedigrees . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Quantitative measurement of the relative gel mobility of a set of permuted fragments was used to extrapolate the approximate position of the bent DNA segment . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a set of seven oligonucleotide probes , restriction fragments containing the mitochondrial cytochrome b ( cyt b ) gene from C . reinhardtii were isolated from a mitochondrial DNA library . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The full set of 16 roll and tilt wedge angles is estimated and , together with the known 10 helical twists , these allow prediction of the general sequence dependent trajectory of the DNA axis . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results suggest that Myc family proteins undergo a restricted set of interactions in the cell and may belong to the more general class of eukaryotic DNA binding transcription factors . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The methods of gel electrophoresis and spectrophotometry were used to study DNA destruction in the chromatin ( a nucleosome set of 1 to 8 units ) irradiated with 60Co gamma quanta in water solutions at doses ranging from 1 to 40 kGy , depending on the chromatin concentration , the nature of gas that saturated the solution ( Ar , N2O ) , and the protein / DNA ratio in the chromatin samples . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Second , mutations in each of the four subregions in the 140 kb of upstream DNA cause a different set of phenotypes , suggesting that the regulatory region contains at least four separate units with different tissue specific functions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The polymerase chain reaction using only a single ' consensus ' tRNA gene primer , or a pair of primers facing outward from tRNA genes , amplifies a set of DNA fragments in bacterial , plant and animal genomic DNAs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Degenerate oligonucleotides designed on the basis of the amino acid sequence of tryptic peptides from the 55 kd subunit of the yeast CaM kinase were used to isolate its gene from a set of lambda gt 11 yeast genomic DNA phage clones initially selected by the ability to bind 125I labelled yeast CaM . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Infectious proviral HIV 1 DNA was co microinjected together with a fivefold molar excess of plasmids expressing antisense RNA complementary to a set of ten different HIV 1 target regions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A collaborative exercise was carried out in 1989 among 12 European forensic laboratories using the single locus VNTR probe pYNH 24 , the restriction enzyme HinfI , the same set of human genomic DNA samples , and a standardized DNA size marker . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Deoxyribonucleic acid ( DNA ) ploidy analysis was performed on formalin fixed , paraffin embedded samples of the primary tumor to yield 97 final tracings that were classified using set criteria for DNA ploidy status . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
They will also be useful in identifying a set of genes in proximity to NotI and EagI restriction sites , as well as conserved DNA sequences for comparative mapping studies . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Previous investigations on the human genome determined : ( 1 ) the base compositions ( GC levels ) and the relative amounts of its isochore families ; ( 2 ) the compositional correlations ( i . e . , the correlations between GC levels ) between third codon positions of a set of genes and the DNA fractions in which the genes were localized ; and ( 3 ) the compositional correlations between ( a ) third and first + second codon positions , as well as that between ( b ) introns and exons from the set of ' localized genes ' and from all the coding sequences and genes ( genomic sequences of exons + introns ) available in gene banks . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of of overlapping deletions of the 5 ' upstream DNA was fused to the CAT gene and transfected into mouse C 2 myocytes , chick primary myocytes , and chick primary liver cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The set intersection operation demonstrates its ability to perform pattern matching correctly on various DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
As shown by SDS electrophoresis the two nucleoproteins shared a set of proteins ( apparent Mr 11 , 000 to 15 , 000 ) , and differed in the DNA moiety ( approximately 150 bp in NP 1 , approximately 350 bp in NP 2 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We show here that the satellite DNA bands within PCR fingerprints originate by heteroduplex formation between heterologous DNAs co amplified by a common PCR primer set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Exons 5 9 of the p 53 gene , which contain the major mutational hot spots associated with most human cancers , were sequenced by the following steps : 1 ) two rounds of PCR amplification using DNA Taq polymerase and two sets of oligonucleotide primers , the second set being nested within the segment amplified by the first set and having attached T 7 and SP 6 phage promoter sequences , 2 ) transcription of the amplified DNA sequences with T 7 and SP 6 RNA polymerases , and 3 ) dideoxy sequencing of single stranded RNA transcripts with reverse transcriptase and with additional oligonucleotide primers to achieve specificity for this unique region of the genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Transformant cell lines transfected with the following , pSV2gpt alone , pSV2gpt and Rama 37 DNA , pSV2gpt and DNA from a metastasizing cell line Rama 800 ( CT set ) , pSV2neo and salmon sperm DNA , pSV2neo and Rama 800 DNA ( C set ) , all yield tumors when injected subcutaneously into syngeneic rats . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Treatments that damage DNA or inhibit DNA synthesis in E . coli induce the expression of a set of functions called SOS functions that are involved in DNA repair , mutagenesis , arrest of cell division and prophage induction . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For the purpose of applying DNA fingerprinting to parentage or other extended blood relationship testing , we have developed a general system for estimating blood relationship between a set of individuals . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An integrated set of methods for routine flow cytometric DNA analysis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We present modifications to polymerase chain reaction base DNA sequence analysis which avoid the need for M 13 cloning and allow one set of sequencing primers to be used for analysis of any desired DNA sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It appears sufficient by itself to account for most traits of synergism found experimentally , notably the widespread but poorly understood observation that synergism among sets of DNA motifs ( for instance enhancer and upstream promoter regions ) can occur over much larger distances than among individual motifs within a given set . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The mean values obtained using all the available data for B DNA crystals are not significantly different from those obtained when a limited data set is used , consisting only of structures with a data resolution of better than 2 . 4 A and without any bound drug molecule . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of four mini T vectors comprised of T DNA border sequences from nopaline type Ti plasmid pTiC 58 flanking a chimaeric hygromycin resistance gene for selection of transformants and up to eight unique restriction sites for cloning foreign DNA was constructed on a broad host replicon containing the oriV of plasmid pSa . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Remarkably , each set of zinc fingers binds to the same DNA sequence motif with similar affinities and methylation interference patterns . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results suggest that the complete set of sequence elements that mediate lambda gene activation during normal B cell differentiation are not all contained in the fragments of genomic DNA cloned so far , and thus , at least some of them must be located at a considerable distance from the promoter . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DDR 48 gene of Saccharomyces cerevisiae is a member of a set of genes that displays increased transcription in response to treatments that produce DNA lesions or to heat shock stress . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Activation of the c fos gene promoter in HeLa cells requires the DNA binding domain of the estrogen receptor , and can be achieved independently by the TAF 1 and the TAF 2 transcriptional activation functions of this molecule . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This DNA is then transferred into P . aeruginosa and forced into the chromosome via homologous recombination , producing in a single step a random set of insertional mutants along a desired region of the chromosome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The newly synthesized fluorescently labelled DNA is then chemically degraded using : ( a ) a set of four different cleavage reactions ; or ( b ) only one reaction comprising methylation of G residues followed by a partial cleavage with piperidine in the presence of sodium chloride . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Each set of primers also contained sequences near their 5 ' ends which facilitated cloning of the amplified DNA directly into a high level expression system based on bacteriophage T 7 genetic elements . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Neurospora crassa , encodes a sequence specific DNA binding protein . cys 3 , the positive acting master sulfur regulatory gene of Neurospora crassa , turns on the expression of an entire set of unlinked structural genes which encode sulfur catabolic enzymes . cys 3 encodes a protein of 236 amino acid residues and contains a potential bipartite DNA binding domain which consists of a leucine zipper and an adjacent highly basic region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of nine normal lymphoblastoid cell lines that span a 100 to 200 fold range in average EBV DNA content were studied , and the frequency with which these cells entered a lytic phase of viral growth correlated with their EBV DNA copy number ( as a population average ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By use of a set of primers encoding the E 6 region of the HPV genome , the presence of HPV DNA was demonstrated in the cervicovaginal cells of 43 ( 42 . 2 % ) of 102 normal individuals and in all 12 CIN patients . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a separate set of experiments , visceral sarcomas were also observed in about half of the line SC chickens that had been inoculated intravenously with 5 src DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We describe a method to determine the magnitude of protein induced DNA bends relative to a set of standard A tract bends using comparative gel electrophoresis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By using a multiple primer set that generates DNA segments with overlapping cohesive termini , visna virus DNA can be amplified , retained , and detected in infected cells with sensitivities that exceed those of existing methods by more than 2 orders of magnitude . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have used P element mediated transformation to introduce a DNA fragment containing a set of characterized restriction sites into the Drosophila germline . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Unlike other DNA tumor viruses the transformed cells did not consistently retain or express a given set of viral genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Employing a 257 base pair DNA fragment from the polyoma virus that contains the origin of replication and regulatory region of this virus , we have identified a set of DNA binding proteins that are induced in normal rat fibroblasts at 6 24 h after UV exposure . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Retroviral DNA integration involves a coordinated set of DNA cutting and joining reactions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Transient transfection assays of a set of plasmids containing various lengths of ADH 5 ' flanking DNA fused to cat were performed in the HepG 2 and Hep3B human hepatoma cell lines . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Digestion of DNA with HaeIII , which gave the clearest band pattern of the 20 enzymes tested , showed that each set of isolates from a single patient had a unique band pattern . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When only 100 ng of DNA were screened with the BMRF 1 set of primers , a specific amplification product was still identifiable . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Herpes simplex virus ( HSV ) induces DNA amplification within the host cell genome , which is mediated by a set of six of seven HSV replication genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A procedure for the quantitation of reactions between specific members of a set of DNA restriction fragments is presented . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Glucocorticoid hormones stimulate transcription of the mouse mammary tumor virus ( MMTV ) promoter by means of an interaction of the hormone receptor with a set of upstream DNA binding sites called the hormone responsive element ( HRE ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The recE 6 allele was then introduced into a set of DNA repair deficient strains of B . subtilis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Whilst analysing a set of flies containing these P lacZ inserts for sex specific expression in the adult , a preference was noticed for insertion into regions of DNA generating expression of beta galactosidase in the male gonad . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Each set of human strains from the four geographical locations was comprised of 5 to 8 DNA pattern types . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By using a set of 476 ordered DNA clones ( in lambda phage vector ) that covers the entire chromosome of Escherichia coli K 12 , we have made an exhaustive survey of tRNA genes in the E . coli genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Statistical methodology for the identification and characterization of protein binding sites in a set of unaligned DNA fragments is presented . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have developed a method for identifying consensus patterns in a set of unaligned DNA sequences known to bind a common protein or to have some other common biochemical function . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A first set of primers , PLp 1 and PLp 2 , identifies a specific 386 bp DNA fragment located in the gene coding for the 65 kDa antigen of M . leprae . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Highly basic polypeptide regions emerge from the zipper to form a linked set of DNA contact surfaces . ^^^ In the recently proposed a `` scissors grip ' ' model , the paired set of basic regions begin DNA contact at a central point and track in opposite directions along the major groove , forming a molecular clamp around DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of primers complementary to the DNA sequence of the CF gene around the delta F 508 deletion was used to amplify this particular segment of the gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The avian myeloblastosis virus integration protein ( IN ) was capable of removing a specific set of 3 ' OH terminal nucleotides from blunt ended long terminal repeat ( LTR ) substrates which resembled linear viral DNA in vivo . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA was analysed from a large set of hamster hprt gene mutants , some induced by ionising radiations and others occurring naturally , to identify those with large alterations in part of the gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA segment produced from the first PCR was also used as a template in a second PCR with a set of two 5 ' labeled primers , one with biotin and the other with 32P . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA obtained from the leukocytes of the peripheral blood was amplified by the polymerase chain reaction ( PCR ) using the proper amplification primer set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The gm ( gene modeler ) program automates the identification of candidate genes in anonymous , genomic DNA sequence data . gm accepts sequence data , organism specific consensus matrices and codon asymmetry tables , and a set of parameters as input ; it returns a set of models describing the structures of candidate genes in the sequence and a corresponding set of predicted amino acid sequences as output , gm is implemented in C , and has been tested on Sun , VAX , Sequent , MIPS and Cray computers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
From these clones , a set of polymorphic DNA markers that span the length of the long arm of chromosome 21 has been generated . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of lac DNA fragments deleted to 6 was constructed , having an A , C , G or T residue at +1 and heterologous DNA downstream . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Cytogenetic analysis of human solid tumors by in situ hybridization with a set of 12 chromosome specific DNA probes . ^^^ For this purpose , a set of 12 biotinylated chromosome specific , repetitive alpha satellite DNA probes ( for chromosomes 1 , 6 , 7 , 9 , 10 , 11 , 15 , 16 , 17 , 18 , 10 and Y ) were hybridized directly to isolated interphase nuclei . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Schizodeme analysis was also performed using a set of 330 bp fragments representing all the variable regions of the minicircle DNA molecules , which were obtained by PCR amplification of the kDNA using conserved region primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To quantitate mitochondrial DNA , 0 , 1 , 2 , and 3 nanograms of mouse mtDNA purified from a plasmid are added as internal standard DNA to four 1 . 0 microgram samples of purified total cell DNA containing an unknown amount of mitochondrial DNA ( a sample set ) . ^^^ For each sample set , the counts per minute is plotted against the amount of mitochondrial DNA added . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A complete set of dA and T analogues designed for the study of protein DNA interactions has been prepared . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of dA and T analogues suitable for the study of protein DNA interactions have been incorporated into the central d ( ATAT ) sequence within d ( GACGATATCGTC ) . ^^^ We have used the modified oligodeoxynucleotide set to study the recognition of DNA by the EcoRV restriction endonuclease [ recognition sequence d ( GATATC ) ] . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA damage induced by various reactive oxygen species can be characterized using a set of repair endonucleases with defined substrate specificities . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This paradox can be resolved if relative mobilities ( with respect to the smallest DNA molecule in the data set ) are used to construct the Ferguson plots , instead of absolute mobilities . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The clones were characterized with respect to their insert size , stability , and representation of a set of Xq 24 Xqter DNA probes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have isolated a set of complementary DNA ( cDNA ) clones that together encode the alkaline phosphatase of human colon cancer LS174T cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Now , in an attempt to construct a map of the mouse chromosome 17 , we have produced a set of DNA markers distributed along the chromosome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have derived a complete set of atomic charges for DNA from very high resolution , low temperature , single crystal 10 ray diffraction data , collected for a variety of nucleosides and nucleotides : cytidine ; deoxycytidine 5 ' monophosphate ; deoxythymidine ; guanosine 5 ' monophosphate ; deoxyadenosine ; adenosine . ^^^ This set of charges represents the first experimentally based parameterization of an important term in the energy function used in most modeling of DNA . ^^^ An averaged set of charges ( derived from the experimental results ) , which can be used in DNA modeling calculations , is presented . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the data set , 63 % of the chemicals were carcinogens , approx . 40 % of the carcinogens were non genotoxic , i . e . , they possessed neither `` structural alerts ' ' for DNA reactivity as defined by Ashby and Tennant , 1988 , nor were they mutagenic for Salmonella . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A well characterized set of proteins encoded by bacteriophage T 4 replicates DNA in vitro and generates replication forks that can pass nucleosomes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Circular Dichroism ( CD ) spectra were collected as a function of sodium perchlorate concentration [ NaClO 4 ] for the set of DNA hairpins formed from the oligomer sequences d [ ( CG ) 3X4 ( CG ) 3 ] where 10 = A , T , G or C . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This observation suggests that P , C and / or hR vary within the set of DNA molecules studied by those authors . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A statistical analysis of a data set composed of over 1600 scission events of DNA produced by the 2 : 1 1 , 10 phenanthroline copper complex ( OP Cu ) has demonstrated that the nucleotide 5 ' to the site of phosphodiester bond scission is a primary influence in the kinetics of cleavage at any sequence position . ^^^ When used to predict the scission pattern of a DNA sequence not part of the present data set , correlation coefficients of about 0 . 6 between predicted and observed patterns were obtained . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A survey of the data of genomic DNA made it possible to postulate for each of both strains a haploid set of chromosomes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
CGR raises a new set of questions about the structure of DNA sequences , and is a new tool for investigating gene structure . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have assigned the mouse rhodopsin gene , Rho , to chromosome 6 using DNA from a set of mouse hamster somatic hybrid cell lines and a partial cDNA clone for mouse opsin . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results mean that a unique set of relatively large chromatin domains are repaired in nondividing XP C cells , even though most of the DNA remains unrepaired . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By isolation of a second set of clones from a different cDNA library and by cloning a PCR amplified region of mouse genomic DNA it was confirmed that the insertion is not a cloning artifact . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This probe recognizes a weakly homologous set of hypervariable regions in the Giardia genome to provide a DNA fingerprint comparable to those seen in higher eukaryotes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Targeted cytogenetic analysis of gastric tumors by in situ hybridization with a set of chromosome specific DNA probes . ^^^ The authors applied a set of satellite DNA probes , specific for chromosomes 1 , 7 , 17 , 10 , and Y in order to detect numerical chromosome aberrations in freshly isolated tumor cell nuclei . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA from members of a three generation pedigree of Irish origin , displaying an autosomal dominant simplex form of epidermolysis bullosa of the epidermolytic , simplex , or Koebner variety ( EBS 2 ) , was analyzed for linkage with a set of markers derived from the long arm of chromosome 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The first group to the phosphodiesters probably spans the intercalation sites , whereas the tilting of the second set likely compensates for the unwinding of the DNA by the intercalator . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A method based on the polymerase chain reaction is described for constructing a clustered set of basepair changes , deletions , or insertions at any site on a DNA fragment . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Scaffold associated regions ( SARs ) were mapped by probing Southern transfers of total , scaffold associated and free DNA with a set of 70 recombinant phages overlapping the investigated genomic region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Multipoint analysis using LINKMAP and a set of four DNA markers ( DXYS 1 DXYS2 DXS 3 DXS94 ) gave a multipoint lod score of 3 . 58 for a location of the Allan Herndon syndrome near locus DXYS 1 ( pDP 34 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Recent evidence from somatic cell hybridization studies and DNA transfection experiments as well as the isolation of complementary DNA clones by subtractive hybridization and by differential screening predicts that an analogous ( but distinct ) set of metastasis suppressor genes may exist within tumor cells that can inhibit invasion and metastasis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The specific binding of AFP gene DNA was observed for a set of Morris hepatoma 7777 nuclear proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The question arises as to whether a set of rules for the three dimensional readout of the B DNA helix can be developed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The data indicated that under this set of variables , PG production by keratinocytes is not directly related to the rate of DNA synthesis of the cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set results from scission of the C 3 ' C 4 ' bond of deoxyribose , with concomitant cleavage of the DNA chain . ^^^ The other set of products consists of free bases and an alkali labile lesion , the latter of which leads to DNA chain cleavage on subsequent treatment with base . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The effect of 8 Br ATP and 8 oxy ATP on RNA synthesis on calf thymus DNA and on abortive synthesis of di and trinucleotides on promoter AI of phage T 7 delta DIII DNA in the case of an incomplete set of substrates was studied . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A DNA sequencing system based on the use of a novel set of four chain terminating dideoxynucleotides , each carrying a different chemically tuned succinylfluorescein dye distinguished by its fluorescent emission is described . ^^^ Avian myeloblastosis virus reverse transcriptase is used in a modified dideoxy DNA sequencing protocol to produce a complete set of fluorescence tagged fragments in one reaction mixture . ^^^ These DNA fragments are resolved by polyacrylamide gel electrophoresis in one sequencing lane and are identified by a fluorescence detection system specifically matched to the emission characteristics of this dye set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set , which is believed to derive from a C 4 ' hydroperoxy derivative of the DNA deoxyribose moiety , includes the four possible base propenals , as well as DNA oligomers having deoxynucleoside 3 ' ( phosphoro 2 ' ' O glycolates ) at their 3 ' termini . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of plasmids containing short DNA deletions in the N part of cro lacIZ coding zone as constructed using Bal 31 nuclease . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Such a map might consist of an ordered set of nonsequenced , overlapping DNA fragments 20 , 000 40 , 000 bases long , produced by digestion of a chromosome , using two restriction enzymes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This cloned DNA fragment was mapped by restriction analysis and was shown to contain one complete set of rRNA genes ( rRNA A ) . ^^^ The physical mapping of the second set of rRNA genes of M . smegmatis ( rRNA B ) was done by restriction analysis of total chromosomal DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A complementary DNA analysis of the protein has revealed extensive amino acid sequence homology to the products of a set of genes recently identified in organisms as diverse as Escherichia coli and man , which include the eukaryotic translation initiation factor elF 4A . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In another set of experiments , the DNA methylation levels have been analyzed during cytosine arabinoside induced differentiation of human K 562 erythroleukemia cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Recently it has been shown that the DNA strand opposite that which is transcribed to produce GnRH mRNA is transcribed in heart to produce a set of transcripts , SH RNAs , which share significant exonic sequences with the GnRH gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using Southern blotting to analyze DNA from a set of human rodent hybrids , we have mapped the CD 34 gene to chromosome 1q . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The hyperthermic mechanisms in D . discoideum are discussed , based on a diverse set of DNA lesions caused by chemicals and DNA repair mechanisms for them . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of shuttle phasmids , constructed from a temperate mycobacteriophage , retained their ability to lysogenize their mycobacterial hosts and could thus introduce foreign DNA stably into mycobacterial cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
According to the hypothesis proposed by Cairns , stem cells retain the older of the two parental DNA strands , whereas differentiating daughter cells receive the newly synthesized strand , so that a set of `` immortal strands ' ' persists in stem cells through successive cell divisions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA sequence analysis of these cloned DNAs establishes the existence of a set of four alternatively spliced mRNAs which are expressed in several tumor cell lines , in human fetal liver , and in L cell transfectants . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of Tn 5 insertions residing in the transducible region provided genetic markers for cloning cellular DNA packaged by Mx alpha . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We conclude that a set of DNA sequences common to the Y chromosomes of a closely related group of species in the subgenus Mus has evolved rapidly as reflected by sequence divergence and sequence amplification . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The viral DNA in these cell lines was analysed by Southern blot hybridization , using a set of cloned EBV DNA fragments from the EBV strain B 95 8 as probes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A transient expression assay of CAT activity in mouse NIH / 3T3 cells transfected with this recombinant plasmid or a set of its 5 ' deletion derivatives was carried out to identify a cis acting regulatory element ( s ) for DNA polymerase beta gene expression . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results are consistent with a model in which camptothecin reversibly traps an intermediate involved in DNA unwinding by topoisomerase 1 and thereby perturbs a set of equilibria , resulting in increased DNA cleavage . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A simple and rapid method of creating an overlapping set of deletions in cloned DNA in preparation for sequencing has been developed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
After mating , hypotrichous ciliated protozoa transform a set of their micronuclear chromosomes into thousands of short , linear DNA molecules that form the macronuclear genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The RadH putative helicase appears to belong to the set of proteins involved in the error prone repair mechanism , at least for UV induced lesions , and could act in coordination with the Rev 3 error prone DNA polymerase . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It is based on selective amplification of sets of segments in purified nascent DNA strands and subsequent determination of the lengths of these strands required to include each member of the set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The set of labeled fragments , characterized by both size and terminal sequence , constitutes a fingerprint that can be used to compare DNA segments for overlap or relatedness . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Under a set of specified conditions , we found that the substitution of a single amino acid in the recA protein ( recA 430 mutation ) depresses its activity for the homologous pairing to about 1 / 100 of that by the wild type protein when compared by the rate for the first 2 3 min of the reaction , but that the mutation only slightly , if at all , affects its ability to bind progressively to double stranded DNA to unwind the double helix ( `` processive unwinding ' ' ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Phenotypically distinct islet tumor cell lines may recapitulate certain of the developmental pathways of normal islet cell differentiation by expressing a combinatorial set of positively and negatively acting DNA binding proteins to allow for the programmed expression of genes encoding polypeptide hormones . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A 2 , 700 bp segment of human ribosomal DNA ( rDNA ) spacer upstream of the rRNA promoter contains a set of four Alu elements , two in the direction of rRNA transcription and two in the opposite orientation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This is the first time that such an association has been found between a person ' s immune response to a well defined antigen and a set of HLA class 2 DNA restriction fragments . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Recent molecular analyses have demonstrated that either DNA exchanges or gene duplications have probably occurred during the evolution of this set of genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Digestion of DNA from 15 unrelated individuals with a set of 10 restriction enzymes revealed 11 RFLPs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
He T DNA is a complex set of repeated DNA sequences with sharply defined locations in the polytene chromosomes of Drosophila melanogaster . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Examination of the DNA of the same set of samples revealed 6 of 61 samples ( 10 % ) with distinct gene amplification and 6 of 61 samples ( 10 % ) with possible gene amplification . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A DNA marker genetically linked to CF was identified through a collaborative effort by random screening with a collection of RFLP markers on a set of CF families . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A common two allele restriction fragment length polymorphism ( RFLP ) was identified with Kpn 1 , and linkage of this RFLP to other polymorphic DNA markers in this region of chromosome 17 provides a set of probes that will be useful for examining the role of this gene in the pathogenesis of diabetes mellitus . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Another type of DNA polymorphism was also revealed by the cDNA clone and it was visualized on the Southern blot analyses as the presence or absence of an extra band ( or a set of extra bands ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using labeled DNA coding for the alpha subunit as a hybridization probe , we identified a set of polycistronic mRNAs ( 2 . 6 , 4 , 7 , and 8 kilobases ) by Northern blotting ; the most prominent of these was the one 4 kilobases long . ^^^ Furthermore , the same set of mRNAs was synthesized in E . coli by a recombinant plasmid that contained a 12 kilobase pair length of 5 . harveyi DNA and expressed the genes for the luciferase subunits . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A probe for the rare maternal RNA set was isolated by hybridizing single copy DNA with total egg RNA to high RNA C0t . 65 67 % of this probe hybridized with whole cell RNA from eggs , blastulae , plutei and coelomocytes demonstrating that essentially all rare maternal RNAs are present , and presumably transcribed , in blastulae , plutei and coelomocytes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The patterns of protein DNA interaction determined by modification interference suggest a model in which the protein can bind either to the two T4G4 repeats at the 3 ' end or to two internal repeats ; in the latter case , it can make a different set of contacts with the terminal repeat to form the more stable complex . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set of cell hybrids was constructed by selecting for functional complementation of the DNA repair defect in mutant CHO UV 5 after fusion with human lymphocytes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Each primer set is conjugated to a different dye , and the fluorescence of each dye respective to its amplified DNA locus is scored on a fluorometer . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It is proposed that analysis using elastic strain models will provide a preliminary set of biochemical and chemical tools to explore the relation between DNA flexibility and the binding of other proteins . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We recently reported the complementation of the ts A1S9 cell defect with total human DNA and the isolation of independent temperature resistant transformants that retained a common set of human specific Alu containing fragments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Early infected cell extracts transcribed from endogenous viral DNA a set of RNAs similar in electrophoretic migration to that observed in intact infected cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The complete time evolution of the conformational and helicoidal parameters of a DNA double helix can then be depicted in a set of six composite figures . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These particles differ from total chromatin by a decreased content of histone H 1 , a specific set of minor acid soluble proteins and a low DNA methylation level . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Limiting ethidium concentrations exist below and above which 0 and 100 % of the DNA , respectively , is recovered as native material under a given set of incubation conditions regardless of the length of time of incubation before neutralization . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This set was subcloned from a cosmid library of M . leprae DNA into pUC 13 and was characterized by restriction analysis and hybridization with Escherichia coli rRNA genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This procedure has been applied to a set of DNA histograms relative to different doses of 0 . 4 MeV neutrons and to different time intervals after irradiation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The target DNA is first amplified by PCR , and then a second set of oligonucleotides , nested between the first two , is incorporated by three or more PCR cycles . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have used a set of seven temperature sensitive mutants in the DNA polymerase 1 gene of Saccharomyces cerevisiae to investigate the role of DNA polymerase 1 in various aspects of DNA synthesis in vivo . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have proposed a DNA sequencing method based on hybridization of a DNA fragment to be sequenced with the complete set of fixed length oligonucleotides ( e . g . , 4 ( 8 ) = 65 , 536 possible 8 mers ) immobilized individually as dots of a 2 D matrix [ ( 1989 ) Dokl . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA hybridization is a `` distance method ' ' for phylogenetic reconstruction and , as such , shares a set of assumptions , advantages , and problems with other techniques that do not directly employ character data . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We found evidence for a common set of interactions between the photolyases and specific phosphates in the backbones of both strands as well as for interactions with bases in both the major and minor grooves of dimer containing DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Northern blot hybridization using a DNA fragment covering part of the set of cloned actinorhodin biosynthetic gene cluster ( act ) as the probe showed lack of the act transcripts in an afsB negative mutant of S . coelicolor A 3 ( 2 ) ; the transcripts were restored on introduction of a cloned afsB gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Following the sexual cycle , hypotrichous ciliated protozoans fragment a set of their micronuclear chromosomes to generate the thousands of short , linear DNA molecules present in the transcriptionally active macronucleus . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Lilley ( 1986 ) Cell 47 , 817 827 ] a set of sequences , called C type inducing sequences , which cause cruciform extrusion by adjacent inverted repeats to occur by an abnormal kinetic pathway involving a large denatured region of DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Pericentromeric localization of the DNA subsets studied was found in practically all chromosomes of the set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The present study is the first attempt to characterize the geometrical parameters as part of a complex set of geometrical , dynamical and excited state parameters governing the overall DNA psoralen photoreaction . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have identified a novel activity in Tetrahymena cell free extracts that efficiently catalyzes a specific set of intramolecular DNA deletion ligation reactions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To determine if the influence of the extra autosomal set in triploids was attributable to a specific autosomal gene , we examined the pattern of DNA replication in females trisomic for 18 of the possible 22 autosomal trisomies . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This set of DNA adducts closely matched patterns generated in vitro by reaction of diethylstilbestrol 4 ' , 4 ' ' quinone with DNA or 2 ' deoxyguanosine 3 ' monophosphate . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA binding studies demonstrated that this IL 2R alpha kappa B control element is specifically bound by a set of TNF alpha inducible T cell nuclear proteins of relative Mr 80 to 90 , 50 to 55 , and 38 to 42 kDa . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results from DNA fingerprinting were essentially identical when compared with results from outer membrane protein subtyping performed on the same set of strains . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of three overlapping genomic DNA clones was isolated and a 10 kilobase DNA segment was sequenced containing the rat IL 6 gene plus 2 . 9 kilobases of 5 ' flanking and 1 . 3 kilobases of 3 ' flanking sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA sequence analysis and mutagenesis studies implicate a small set of key residues within the DQ3 . 2 molecule as critical polymorphic residues likely contributing to disease associated immune mechanisms . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Screening of prospective parents is carried out by dot blot analysis on enzymatically amplified DNA with a set of oligonucleotide probes complementary to the most common mutations in this population . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An oligonucleotide probe to assay lysis and DNA hybridization of a diverse set of bacteria . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The product has been identified as a Holliday structure in which one set of the DNA strands of the recombining partners has been exchanged . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sequences within the hrp cluster of pVir 2 have homology with the genomic DNA of Xanthomonas campestris strains representing eight different pathovars , suggesting that a set of common pathogenicity functions could be shared by P . solanacearum and 10 . campestris . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A different set of hybridisation signals was produced when E . coli DNA , which had been digested with a variety of restriction endonucleases was probed with 2Kb Pst 1 fragment or the ada gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of gamma delta insertions positioned about 200 bp apart over the entire cloned DNA allowed us to determine the sequence of both strands in a single parental plasmid without subcloning . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
With the use of such a primer set , the beta globin gene region is amplified by denaturation , annealing and DNA synthesis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We propose that the seven genes essential for plasmid replication comprise a set of genes whose products are directly involved in viral DNA synthesis . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our conclusions about protein directed bends in DNA are based on the study of the electrophoretic mobility of a set of permuted DNA fragments in the presence or absence of IHF and / or Int . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of DNA clones comprising 48 independent HindIII fragments ( 215 kilobases of sequence ) was derived from the N myc amplification unit of the neuroblastoma cell line NGP . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The LexA repressor of Escherichia coli represses a set of genes that are expressed in the response to DNA damage . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To evaluate the substrate specificity of methyl directed mismatch repair in Escherichia coli extracts , we have constructed a set of DNA heteroduplexes , each of which contains one of the eight possible single base pair mismatches and a single hemimethylated d ( GATC ) site . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA sequence of a clustered set of genes which are conserved in orthopoxviruses has been determined for the avipoxvirus , fowlpox virus . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A novel set of reaction conditions for mung bean nuclease has been described in which Plasmodium genes were specifically excised as intact fragments from purified DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 6 DNA probes was tested to evaluate the incidence of various Escherichia coli pathotypes among 540 strains isolated in France from diarrhoeal stools of infants , children and adults . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of DNA probes has been developed to study the genes for Shiga like toxins ( SLT ) and the bacteriophage from which these toxin genes were isolated . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set , derived from the viral large internal repeat , is newly positioned upstream of BZLF 1 ; the second set is downstream of BZLF 1 in het DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A mapped set of DNA markers for human chromosome 17 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Furthermore , the procedure is applicable to other aspects of the study of genome organization : for example , the exon and intron areas of a segment of cloned genomic DNA can be identified by cross hybridizing a set of radioactive restriction fragments from the genomic clone against immobilized RNA from a cell type of interest . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By using Southern hybridization analysis and restriction endonuclease mapping , it was demonstrated that the cosmid clones carried a nested set of overlapping , cloned , genomic DNA fragments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In genomic Southern blot analysis , the VH probes for each family hybridize to a distinct set of multiple DNA fragments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A genomic DNA clone named CRI S 232 reveals an array of highly polymorphic restriction fragments on the 10 chromosome as well as a set of non polymorphic fragments on the Y chromosome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This set of DNA samples has been used to map the molecular marker D17RP17 just distal of quaking ( lethal 1 ) . ^^^ With the nested set of crossover DNA samples and appropriate cloning techniques , this tightly linked marker can be used to clone the quaking locus . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a separate set of experiments the acetylated chromatin obtained from these cells was irradiated and the change of molecular weight of the DNA was evaluated by alkaline sucrose density centrifugation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Bacteriophage T 4 tails contain a set of extended protein molecules in the central channel of the tail tube through which the DNA must exit during infection . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Fifteen bacteriophages representative of the serological and lytic groups of the International Typing Set for Staphylococcus aureus were examined for genomic homology by DNA hybridization and by analysis of high resolution thermal denaturation profiles . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Induction of cellular DNA synthesis by adenovirus type 12 in a set of temperature sensitive mutants of rat 3Y1 fibroblasts blocked in G 1 phase . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Chromosomal translocations involving chromosome 21 sequences were also detected with these probes , and the intranuclear location of 21q22 . 3 DNA sequences in `` normal ' ' human brain neurons was established with the plasmid DNA probe set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In addition , mRNA from VZV infected cells was hybrid selected by a set of VZV DNA recombinant plasmids and translated in vitro , and polypeptide products were immunoprecipitated by convalescent zoster serum or by monoclonal antibodies to gC . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
However , the number of sites per nuclei was small compared to tadpole ; expressed as pmol / mg DNA , the maximum binding capacity of the high affinity set of sites ( MBC 1 ) was 2 . 2 + / 0 . 31 versus 12 . 9 + / 1 . 80 and MBC 2 was 24 . 9 + / 4 . 5 versus 42 . 2 + / 54 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A SmaI map of class 1 defective DNA of herpes simplex virus type 1 ( HSV 1 ) was constructed using a set of deletion hybrid phages . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The 4 kilobase intron of this transcript encodes a nested set of transcripts on the opposite DNA strand . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In order to keep the influence of flanking sequences and of nonspecific binding identical for all substrates we have carried out all experiments with the same plasmid DNA which had been digested previously with a variety of different restriction enzymes to give a set of substrates of different lengths . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of nine mutants containing point mutations , and small deletions or insertions , were constructed in the early promoter region of simian virus 40 ( SV 40 ) to determine the role of the DNA sequences between the TATA box and the six upstream G + C rich clusters in early transcription . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of deletions with varying lengths of DNA between the lac P 2 10 region and a `` 35 region ' ' contributed by the vector DNA were constructed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The divergent region of the Leishmania tarentolae kinetoplast maxicircle DNA contains a diverse set of repetitive sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The entire human kininogen gene has been isolated as a set of overlapping genomic DNA fragments , and the 11 exons encompassing approximately 27 kilobase pairs have been mapped by restriction enzyme analysis and nucleotide sequence determination . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the bacterium Escherichia coli DNA damaging treatments such as ultraviolet or ionizing radiation induce a set of functions called collectively the SOS response , reviewed here . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A polymorphic DNA marker has been found genetically linked , in a set of 39 human families , to an autosomal recessive gene that causes cystic fibrosis ( CF ) , a disease affecting one in 2000 Caucasian children . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Digestion of a mixture of linear and circular forms of unintegrated DNA with HindIII produced a set of restriction fragments 2 . 3 3 kbp in length . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have constructed a set of expression vectors which contain synthetic DNA sequences comprising a computer generated model ribosomal binding site located downstream from the tightly regulated phage lambda pL . promoter . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In mouse , a panel of cytotoxic T lymphocyte clones exhibit the same rearrangement pattern with a gamma chain gene probe and a set of three gamma chain variable ( 5 ) genes have been identified in the DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This paper describes a new set of programs for analyzing DNA sequences using the Apple Macintosh computer , a computer ideally suited for this kind of analysis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of DNA duplexes with repeated EcoRII , EcoRI and AluI restriction endonuclease recognition sites in which EcoRII scissile phosphodiester bonds were replaced by phosphoramide or uncleavable pyrophosphate bonds have been synthesized . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The set of complementary DNA clones used was prepared by the method of Okayama and Berg from polyadenylylated viral genome RNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genomic DNA from a panel of non H 2 H mutant strains on the C57BL / 6 and BALB / c backgrounds was digested with a set of restriction enzymes with varying numbers of sites within endogenous xenotropic related sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A second set of experiments showed that DB 129 bound to single stranded DNA in vitro and was eluted by a NaCl gradient in two peaks , one at about 0 . 2 M and the second at about 0 . 6 M . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have defined a set of conditions that allows the production of a series of nine topoisomers covering a range from relaxed to highly negatively supercoiled DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Under one set of conditions , CRP stimulated by eightfold the rate of RNA polymerase open complex formation on supercoiled DNA template containing the normal wild type araBAD regulatory region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
First the method is tested by applying an idealized set of distance restraints taken from classical B DNA to a simulation starting off from A DNA and vice versa . ^^^ Second , a set of restrained molecular dynamics calculations is carried out starting from both A and B DNA with the experimental interproton distances for 5 ' d ( C G T A C G ) 2 as restraints . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The insertion of DNA fragments within the lac sequence of a MudI ( Ap , lac ) prophage resulted in the formation of a set of maxi Mu genomes which were 39 . 8 , 59 , 85 . 6 , and 88 . 2 kb long , respectively . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of plasmid genes outside the T DNA , the vir genes , are thought to mediate the transfer process . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
As shown by a nitrocellulose filter binding assay , in the absence of Mg2+ EcoRII restriction endonuclease binds specifically to a set of synthetic concatemer DNA duplexes of varying chain length , containing natural and modified recognition sites of this enzyme . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The same set of 10 tumors were analyzed for the presence of sequences complementary to human papillomavirus 16 ( HPV 16 ) DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thirty three independent mutant cell lines were selected in single steps for resistance to low concentrations of N ( phosphonacetyl ) L aspartate and the structure of their amplified DNA was probed , using a set of recombinant phage and cosmids containing a total of 380 kb of amplified DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For this purpose , probes from an overlapping set of cosmids that span 210 kb of DNA in this region were used . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Two types of hybrid plasmids generated in vivo and in vitro appeared to compensate for the mutations and had DNA regions containing multiple ARS ( autonomously replicating sequence ) or a set of 2 microns inverted repeat sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This clone has a chromosomally integrated set of the original recombinant DNA and produces a 3 . 5 kilobase transcript corresponding to the pregenome RNA as well as HBV DNAs in an extrachromosomal form . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of nine polymorphic loci defined by DNA probes was studied for linkage with the disease locus in ten families with a history of Duchenne muscular dystrophy ( DMD ) , and three families with a history of Becker muscular dystrophy ( BMD ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA helicase activity of isolated T antigen is equally well inhibited by the same set of monoclonal antibodies that affect minichromosome replication in vitro . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Hybridization of the human cDNA against blots of total human DNA detected the same set of fragments contained in both genomic clones and failed to detect more than one distinct gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The generation of a map for rare cutter sites along a human chromosome , or a chromosome region , should be simplified using this approach , which will enable the identification of a set of `` milestones ' ' at intervals of several hundred kilobases ( kb ) along the DNA sequence . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A cluster of six linked genes arranged 5 ' zeta 1 alpha 1 theta 1 zeta 2 zeta 3 theta 2 3 ' has been isolated as a set of overlapping clones from a library of rabbit genomic DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Identification of prophage host DNA junction fragments indicated the presence of a unique attB site on the bacterial chromosome ; the set of junction fragments in the strain B . licheniformis ATCC 10716 was identical to that of ATCC 11946 , but different from ATCC 8187 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Kidney DNA of hamsters treated with the four 17 alpha ethinyl estrogens , when analyzed by 32P postlabeling assay , contained the same set of covalently modified nucleotides the formation of which had previously been found to precede estrogen induced renal carcinogenesis in vivo . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of dispersed sequences distantly related to avian leukosis virus genome was found in DNA of these chickens by means of hybridization in non stringent conditions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The final products of the streptococcal plasmid DNAs replicated in the E . coli in vitro system were monomeric supercoiled DNA forms that had completed at least one round of replication , although a set of putative replicative intermediates could also be found . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
With the use of synthetic DNA fragments , a set of new plasmid vectors has been obtained . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
From the same set of cells , DNA was isolated and analyzed for RFLP . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We report the application of the combined procedure on the lac repressor DNA binding domain ( headpiece ) using a set of 169 NOE and 17 `` hydrogen bond ' ' distance constraints . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In bacteria , the complex nucleoid structure is folded and maintained by negative superhelical tension and a set of type 2 DNA binding proteins , also called histonelike proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Primary characterizations of a set of bent DNA segments randomly cloned from S . cerevisiae are presented . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Neoplastic disease and neurological degeneration together with immune defects are frequent clinical features linking this set of diseases , suggesting that effective DNA repair may be important in many aspects of human health . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A genomic clone bank of Paracoccus denitrificans DNA has been constructed in the expression vector set pEX 1 , pEX 2 , and pEX 3 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The VH fragments hybridized to an identical set of restriction fragments on Southern blots of human placenta DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of broad host range vectors allowing direct selection of recombinant DNA molecules to facilitate subcloning and expression analyses of Pseudomonas genes was constructed using Bg / II lacZ alpha cassette . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Screening of genomic DNA libraries with hybridization probes derived from a Drosophila melanogaster c abl proto oncogene homologue resulted in the isolation of a set of related sequences from the dipteran Calliphora erythrocephala . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Estimation of hominoid phylogeny from a DNA hybridization data set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA hybridization evidence of hominoid phylogeny : results from an expanded data set . ^^^ In the present paper we report on an expanded data set totaling 514 DNA hybrids , which supports the branching order given above . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results are generally in good agreement with our previous data showing that only a small number of tRNAs are coded for by the mitochondrial DNA , while the others are a selected set of imported cytoplasmic tRNAs . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We quantitated the induction of the Bacillus subtilis Rec protein ( the analog of Escherichia coli RecA protein ) and the B . subtilis din 22 operon ( representative of a set of DNA damage inducible operons in B . subtilis ) following DNA damage in Rec+ and DNA repair deficient strains . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An isogenic set of `` prophage free , ' ' DNA repair proficient and deficient strains of Bacillus subtilis were characterized phenotypically . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Southern blots of kidney DNA show that the variable region sequences of eight cDNA clones reveal the same set of bands corresponding to approximately 30 cross hybridizing VH genes of one subgroup . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This report is an investigation of the specific sequence changes in the DNA of Salmonella hisD 3052 revertants induced by a set of specific frameshift mutagens found in our diet . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The affinities of oligothymidylates and of some analogs for the template site , of a set of oligodeoxyribo and oligoribonucleotides for the primer site , and of dNTPs and some analogs for the substrate sites of DNA polymerase 1 Klenow fragment and of human placenta DNA polymerase alpha were measured using them either as competitors of affinity modification or as substrates . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Aggregating brain cell cultures were exposed at different developmental stages to model drugs ( i . e . , antimitotic , neurotoxic , and teratogenic agents ) and assayed for their responsiveness by measuring a set of biochemical parameters ( i . e . , total protein and DNA content , cell type specific enzyme activities ) which permit a monitoring of cellular growth and maturation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results suggest that a specific set of non covalent interactions is involved in phi X 174 DNA ejection . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Pericentromeric localization of the DNA fraction studied was found in practically all chromosomes of the set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This communication describes a set of algorithms for the automatic updating of single sites and double domain boundaries in linear and circular models for computer simulation of recombinant DNA procedures . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The repressors of temperate bacteriophages such as 434 and lambda control transcription by binding to a set of DNA operator sites . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This hypothesis implies that DNA synthesis in a given set is triggered by some event coupled to progression of replication in the immediately preceding set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The viral protein p 6 , which stimulates the initiation of replication , binds to a set of specific signals present at both phi 29 DNA ends . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
With the use of this primer set , the beta globin gene region is amplified by denaturing , annealing , and DNA synthesis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A mapped set of DNA markers for human chromosome 15 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The frequency of base pair occurrence in a set of recognition sequences for a particular DNA binding protein is strongly related to the contributions to the binding free energy from the individual base pairs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In contrast to the corresponding angular parameters ( tg , theta T , theta R ) and coordinate systems introduced by Dickerson and co workers and currently in use , our angular parameters and coordinate systems , together with a set of three displacement parameters , dx , dy , dz , provide a mathematically correct and general description of DNA conformations at the basepairs and / or base level . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To monitor successful engraftment after bone marrow transplantation , we performed Southern hybridization analysis or dot blot analysis of DNA in a set of sex mismatched cases using a Y chromosome specific DNA probe ( pHY 10 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This was studied quantitatively by using a set of DNA fragments with four identical A 1 promoters ( 1 4 ) equidistant from each other , but with different lengths of flanking sequences upstream from promoter 1 and downstream from promoter 4 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Kinetics of inhibition by 8 oxy ATP of the dinucleotide pppApU synthesis catalyzed by Escherichia coli RNA polymerase on the promoter A 1 of phage T 7 delta D 111 DNA during coupled synthesis of di and trinucleotides and a limited set of substrates ] . ^^^ A kinetic analysis of inhibition of synthesis of dinucleotide pppApU catalyzed by Escherichia coli RNA polymerase on A 1 promoter of the DNA from T 7 delta DIII phage mutant by 8 oxy ATP under the conditions of the coupled synthesis of pppApU and pppApUpC and in the presence of an incomplete set of substrates , namely ATP , UTP , CTP , has been performed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using an assay for pac cleavage that does not depend on DNA packaging , we have identified a set of five amber mutations that are mapped adjacent to pac , and that define a gene ( gene 9 ) essential for pac cleavage . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The primary characterization of a set of bent DNA segments randomly cloned from E . coli was presented . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Ultraviolet light ( UV ) inhibits DNA replication in Eschericia coli and induces the SOS response , a set of survival enhancing phenotypes due to derepression of DNA damage inducible genes , including recA and umuDC . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of DNA probes for detection of mycoplasmas infecting cell cultures by dot hybridization has been constructed . ^^^ This set consists of specific DNA probes and universal DNA probe . ^^^ The set of DNA probes allows not only to detect infection of cell cultures by mycoplasmas but also to identify the species of mycoplasmas and to evaluate the multiplicity of mycoplasma infection . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of plasmid expression vectors for cloning of DNA fragments containing open reading frames has been obtained . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Results from our studies of the c myc oncogene and its product in human solid tumours , using DNA and RNA hybridization and a set of monoclonal antibodies ( MCAs ) raised against synthetic peptides , are presented . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Insert DNA is sufficiently large that most genes will be present in the set of plasmid banks at a frequency of about 0 . 1 % . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Definitive determination of the HLA linked gene or genes for susceptibility to RA will be achieved ( 1 ) by the accumulation of an adequate body of data on the haplotype frequencies in a random set of RA patients and controls and ( 2 ) by further study of other loci in the DR region , involving the use of DNA probes as well as conventional techniques . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An algorithm has been developed for the identification of unknown patterns which are distinctive for a set of short DNA sequences believed to be functionally equivalent . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For its incorporation in synthetic DNA fragments , a new set of amino protecting groups has been developed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In order to separate the sequence information at the end of the processing , the DNA molecules of interest are ligated to a set of oligonucleotide `` tags ' ' at the beginning . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Statistical analysis indicated that SD NA was a better predictor of metastasis than DNA determination in this data set . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For this we have constructed two series of palindromic DNA sequences : one set with differing center and one set with differing center and arm sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of rules is presented showing the tendency of certain base pairs to direct the DNA conformation into the A , B , or Z genus in saturated salt solutions and in crystals . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of contacts with DNA backbone , notably involving hydrogen bonds between peptide NH groups and DNA phosphates , position the repressor and fix the DNA configuration . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a gel retardation assay , we found a liver nuclear protein , or set of proteins , which binds specifically to DNA of a liver specific hypersensitive site that maps 3 . 5 kb upstream , between the promoter and enhancer . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of full length DNA copies of both M and B RNA of cowpea mosaic virus ( CPMV ) was cloned downstream of a phage T 7 promoter . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It was shown that a specific set of the inverted repeats was included in fragments of DNA comparising the origin of replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The resulting transformants retained a common set of human specific Alu repetitive DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Factor D , a DNA binding protein that enhances the activities of diverse DNA polymerases with a common restricted set of templates , was initially characterized in mouse liver but has resisted extensive purification . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The set of expansion segments of a 26S / 28S gene is coevolving as a unit in each species , at the same time as the family of 28S rRNA genes , as a whole , is undergoing continual homogenization , making all sets of expansion segments from all ribosomal DNA ( rDNA ) arrays in a species similar in sequence . ^^^ Analysis of DNA simplicity of 26S / 28S rRNA genes shows a direct correlation between significantly high relative simplicity factors ( RSFs ) and sequence similarity among a set of expansion segments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In another set of experiments , dominant mutant DNA was co transfected along with the selectable plasmid pSV2ecogpt into parental Hepa 1 cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The experiments indicated that the assembly of functionally active RNA polymerase 2 containing transcription preinitiation complexes requires a complete set of transcription factors , and that both specific protein DNA and protein protein interactions are involved . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By hybridization with luxC DNA probes , a set of mRNAs coding for this gene was detected ; part of this set of mRNAs extended downstream and complemented the set of mRNAs previously detected for the other lux structural genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We describe a computer program which will rapidly analyze a set of DNA histograms without further operator intervention after the initial input . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The nonadult region of the complex , in contrast , contains the same set of genes apparently distributed over the same amount of DNA as in the Mus beta globin complex . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results agree with previous reports of accelerated DNA evolution in muroid rodents and extend the DNA DNA hybridization data set of Brownell . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The set of chromatin fragments liberated from the Triton 10 100 pretreated nuclei differs considerably from that of chromatin sites devoid of histone H 1 ( the de novo replicating chromatin and the chromatin formed on the undermethylated DNA ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For the transformation of the yeast Hansenula polymorpha we have constructed a set of hybrid plasmids carrying the LEU 2 gene of Saccharomyces cerevisiae as a selective marker and fragments of mitochondrial DNA of Candida utilis and H . polymorpha or chromosomal DNA fragments of H . polymorpha as replicator sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of four computer programs that search DNA sequence data files for transfer RNA genes have been written in IBM ( Microsoft ) BASIC for the IBM personal computer . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Electrophoretic analysis of the nuclease resistant DNA showed that there is a set of DNA fragments of 100 150 base pairs that are protected from digestion . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our experiments indicate that Z DNA forms are present in a specific set of sites on the native chromosomes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The resultant set of novel methodologies , termed recombinant DNA technology , or genetic engineering , has revolutionized the study of almost all branches of biology and has presented radical new methods of producing proteins otherwise available only in very small quantities . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By transfecting high molecular weight DNA from a Kaposi sarcoma lesion into murine NIH 3T3 cells , we have identified and molecularly cloned a set of human DNA sequences capable of inducing focus formation , growth in agar , and tumorigenicity in these cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have reciprocally transplanted the anticodon arm sequences of a set of amber suppressor tRNA genes , using recombinant DNA techniques . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The biochemical consequences of PDGF receptor activation include increased tyrosine kinase activity , enhanced expression of a set of genes associated with cell proliferation , the dramatic alteration in cellular cytoskeleton , a rapid turnover of membrane phospholipids and the commitment of the cell to proceed through a series of responses culminating in the replication of DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The fluorescent primer is used to generate a nested set of fluorescent DNA fragments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA content of transformants can be varied reproducibly , yielding cells with just one or two copies of the new gene under one set of conditions , while under a different set of conditions 25 to 50 copies are acquired . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Chem . 257 , 8386 8390 ) in nondenaturing conditions selected the complete set of 10 polypeptides , whereas treatment in denaturing conditions selected the 200 kilodalton catalytic DNA polymerase active polypeptide . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We present a statistical mechanical selection theory for the sequence analysis of a set of specific DNA regulatory sites that makes it possible to predict the relationship between individual base pair choices in the site and specific activity ( affinity ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These observations support previous studies which indicated that the formation of an HSR is a more complex process than uniform amplification of a single DNA segment to form an n fold set of perfect tandem repeats . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This theory postulates control DNA , a set of genetic elements activated in a specific sequence , one at a time . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Follicles in stages 5 to 8 ( preantral follicles with 5 or more layers of granulosa cells to small antral follicles ) , from which the next set of ovulatory follicles will be selected , did not show a significant peak in incorporation per microgram DNA until Day 1 at 09 : 00 and 15 : 00 h when the second increase in FSH is in progress . ^^^ These results suggest that periovulatory changes in FSH and LH , directly or indirectly , are not only responsible for ovulation and the recruitment of the next set of follicles destined to ovulate but also stimulate DNA replication in smaller follicles which develop over the course of several cycles before they ovulate or become atretic . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Under a standard set of conditions , the RBE coefficient of carbon ions decreased from 3 . 09 to 1 . 78 in the presence of DNA synthesis inhibitors . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This was done by preparing a set of clones of repetitive maize sequences that differ in function , molecular arrangement and multiplicity and then using these as probes for quantitative hybridization to DNA from various maize genotypes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These data structures are manipulated by a set of software tools to simulate the construction of mosaic recombinant DNA molecules . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here we describe the scanning of autoradiographs of DNA sequencing gels and a set of programs for reading the base sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The program is written in HP BASIC and is designed principally as a tool for the laboratory investigator manipulating a defined set of vectors and recombinant DNA constructs . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Complete equilibration between two sets of complexes occurred with a t1 / 2 of 3 7 min under a set of conditions previously found to be optimal for recA protein promoted DNA strand exchange . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In cases where two individuals inherit the same trait through two different lines of descent from a common ancestor , the set of inheritance units in each of the two genomes includes an inheritance unit that is identical in both individuals for a substantial distance on both sides of the DNA sequence which confers the trait . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Raising the Ca2+ concentration in the Ca2+ deficient medium from 0 . 02 mM to 0 . 5 mM or adding 80 nM TPA ( 12 O tetradecanoyl phorbol 13 acetate ) , a protein kinase C activator , stimulated the phosphorylation of a certain set of surface proteins within 5 min and the initiation of DNA replication within the next 2 hr . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Independently transfected colonies contained a small set of common human DNA fragments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We describe here a set of reaction conditions which dramatically shorten the reaction time and give reproducible 40 to 60 % ligation of DNA fragments of up to 40 bases in length . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Stern Volmer plots with iodide and silver ions as quenchers suggest that at least one set of binding sites for the formation of a physical intercalation complex between the benzo [ a ] pyrene derivative and DNA is at guanine sites in the biopolymer . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Under a defined set of conditions , it was possible to show that each oligonucleotide probe hybridized exclusively to its cognate repeat type without hybridization to other repeat types in cloned DNA templates . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A complex set of early chorion DNA sequences from Bombyx mori . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sensitivity to the induction of sister chromatid exchange and the hypersensitivity to the lethal effects of a set of DNA damaging agents are correlated , implying that the basic defect influences both end points in a similar manner . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of conserved mtDNA sequences which we term `` core ' ' DNA is present in all cucurbit genomes examined . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
All pairs of a large set of known vertebrate DNA sequences were searched by computer for most similar segments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of four individual DNA adenine methylases differing in pI ( isoelectric point ) values ( MMbu4 . 2 , MMbu6 . 4 , MMbu7 . 3 , and MMbu8 . 7 ) , and a sole methylating enzyme with the same base specificity ( MSso9 . 5 ) are present in M . smegmatis ( butyricum ) and Sh . sonnei 47 cells , respectively . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Crystallization conditions were tested with a set of DNA fragments , ranging in length from 17 to 23 base pairs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Synthetic oligonucleotides also provide the basis of a set of techniques for site directed mutagenesis of DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
At different set times after the graft , recipient mice were given a single injection of a radioactive precursor of DNA ( 125IUdR ) and killed one hour later . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Four sequences have been identified , three of which share sequence homology and hybridize to the same set of genomic DNA fragments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sites of transcriptional activity in the whole set of Drosophila melanogaster polytene chromosomes have been localized by means of fluorescent antibodies against DNA : RNA hybrid molecules and compared with results on 3H uridine incorporation obtained earlier . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A cloned alpha amylase cDNA sequence from the mouse is homologous to a small set of DNA sequences from Drosophila melanogaster under appropriate conditions of hybridization . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of chemotaxis mutants of Bacillus subtilis was complemented by using SP beta c 2 transducing bacteriophage either containing cloned segments of DNA or derived from abnormal excision of SP beta c 2 dl2 : : Tn 917 inserted into the chemotaxis region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This method takes into account effectively the information contained in a set of DNA sequence data . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Even though bisulfite does not induce detectable DNA damage or early post treatment changes in polypeptide expression , a consistent set of qualitative and quantitative changes were observed after transformation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 11 overlapping cosmid clones of wild type ( wt ) vaccinia virus DNA was constructed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Comparison of the various cloned T DNA sequences with Ti plasmid sequence indicated that while there is an association with a 25 base pair direct repeat , there is no specific set of base pairs in the T DNA at which divergence from Ti plasmid sequences occurred . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Furthermore , the TB DNA region alone conferred tumorigenicity onto strains with an intact set of vir genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A different set of WHV specific mRNAs was observed in a woodchuck hepatocellular carcinoma when only integrated forms of WHV DNA could be detected . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have studied the DNA sequence specificity of nuclear factor 1 binding using cloned terminal fragments of the Ad 2 genome and a set of deletion mutants . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The human genome contains a set of minisatellites , each of which consists of tandem repeats of a DNA segment containing the ' core ' sequence , a putative recombination signal in human DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The data consist of the genotypic characterizations obtained at more than 20 DNA marker loci from a set of 38 selected families . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Bacteriophage DNA synthesis in abortive infections with a set of conditional lethal mutants . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Asynchronous replication of DNA in a heterochromatic set of chromosomes in Pseudococcus obscurus . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The viral DNA in these cell lines was analyzed by Southern blot hybridization , using a set of cloned EBV DNA fragments as probes that recognize polymorphic regions in the viral genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Specifically , cotransfection of cells with helper virus DNA and cloned amplicons ( 8 to 10 kilobases [ kb ] ) containing bacterial plasmid DNA sequences linked to a set of herpes simplex virus cis acting propagation signals ( a replication origin and a cleavage packaging signal ) resulted in the generation of virus stocks containing packaged defective genomes that consisted of uniform head to tail reiterations of the chimeric seed amplicon sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We constructed a set of polyomavirus mutants with alterations in the DNA sequences encoding large T antigen . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of lambda phages containing overlapping fragments of Epstein Barr virus ( EBV ) defective DNA has been cloned from P3HR 1 superinfected Raji cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Calf thymus DNA topoisomerase 1 , which belongs to the eukaryotic type 1 topoisomerases , is in a typical preparation purified as a set of five major polypeptides with Mr between 70000 and 100000 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a second set of experiments BPV 1 DNA fragments cloned in pBR 322 were tested for transient episomal replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
As part of our efforts to create multifunctional vectors for the transduction of animal cells , a set of simian virus 40 recombinants were constructed which contain an inverted duplication of the region including the origin of viral DNA replication ( ori ) and the early region promoter . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Considering the length of the mitochondrial DNA of Schizosaccharomyces pombe ( about 19 . 4 kbp ) and the expected length of the localized genes and intron sequences there is enough space left for encoding the expected set of tRNAs and the small rRNA gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA molecules created by fusing a 365 base pair segment of yeast DNA encoding the galactose regulated upstream promoter element ( gal ) to a set of derivatives that systematically delete sequences upstream from the his 3 gene are introduced in single copy back into the yeast genome precisely at the his 3 locus and then assayed for transcription . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The human genome makes possible the brain and the social and tool using abilities which enable people to `` transcend the limits apparently set by that very genome . ' ' Accordingly , techniques such as in vitro fertilization , gene therapy , and sperm banks will have a marginal effect on human evolution since DNA is subject to an almost infinitely varying set of environments . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have further analyzed the metabolism of specific messenger ribonucleic acid ( mRNA ) sequences within the cytoplasmic and nuclear RNA of Chinese hamster ovary ( CHO ) cells by using a set of previously constructed complementary deoxyribonucleic acid ( DNA ) clones ( Harpold et al . , Cell 17 : 1025 1035 , 1979 ) as specific molecular probes in a variety of RNA : DNA hybridization experiments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The genes encoding human embryonic ( epsilon ) , fetal ( G gamma , A gamma ) and adult ( delta , beta ) beta like globin polypeptides were isolated as a set of overlapping cloned DNA fragments from bacteriophage lambda libraries of high molecular weight ( 15 20 kb ) chromosomal DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The liver mitochondrial RNAs have equal ability to competition with N specific complementary RNA for hybridization on mitochondrial DNA and its fragments cloned in the composition of bacterial plasmids and characterized by a definite set of genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To test the possible linkage of alpha fetoprotein and albumin , five somatic cell hybrids containing various combinations of mouse chromosomes , together with a constant set of hamster chromosomes , were tested for the presence of both genes using DNA restriction mapping techniques . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Total RNA , DNA and protein content were increased in the pancreas of group 2 and group 3 set of animals , suggesting an active proliferation of acinar cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set of overlapping clones spans about 20 kilobases and contains regions of DNA sequence homology to the gag p 30 , gag p 15 , and polymerase genes of Moloney murine leukemia virus . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Under a second set of conditions in which binding was measured with single stranded DNA , antibodies were bound to DNA which contained only thymine thymine dimers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of parameters , devised for the prediction of 1H NMR chemical shifts of heterobase and anomeric protons in the high temperature ( greater than 70 degrees C ) spectra of RNA oligomers has been found to be applicable to the corresponding DNA oligomers . ^^^ The RNA parameter set is a practical means of assigning heterobase and anomeric protons in DNA oligomers . ^^^ A programme using the RNA parameter set has been written which enables the sequence of short DNA oligomers to be predicted from their 1H NMR spectra . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The stability of the many different sample preparations was tested by comparing averaged DNA histograms obtained on the day of sample preparation to averaged DNA histograms of the same set of samples after storage at 4 degrees C , with or without fixation in 10 % phosphate buffered formalin , for days to weeks . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of overlapping promoters in ColE 1 DNA is identified using DNA and RNA sequencing methods . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Some of the basic features of rabbit Ig genes are already clear from these studies , and DNA fragments that might encode latent allotypes have been identified with the first set of probes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The qualitative and quantitative characteristics of the synthesis of the short oligonucleotides by Escherichia coli RNA polymerase on A 1 promoter of the bacteriophage T 7 deletion mutant delta D 111 DNA in the presence of the incomplete set of nucleoside triphosphates were studied . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For determining the chromosomal location of this gene a 1 . 5 kb fragment of the gene was hybridized to EcoR 1 digested DNA samples from a set of mouse hamster somatic cell hybrids . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The same set of RNAs was identified by hybrid selection of pulse labeled RNA with cloned U 4 DNA , confirming that these are U 4 RNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We previously characterized a set of lambda dilv phages by genetic , restriction enzyme , and heteroduplex analyses and tentatively correlated isoleucine valine gene products with specific ilv DNA segments by using cloned ilv segments in maxicells and lambda dilv phage infection of UV irradiated cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have used a set of overlapping cloned segments defining a 315 kb ( 10 10 ( 3 ) base pairs ) region of Drosophila melanogaster chromosomal DNA to map the sequences associated with the polytene band interbands ( chromomeric units ) and with the lethal complementation groups contained within this region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Nuclei were digested with either DNase 1 or micrococcal nuclease , and the purified DNA was hybridized to a set of cloned genomic DNA fragments covering the beta globin gene region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To determine myocardial cell DNA synthesis postpartum , another set of rats were injected at various time periods with 4 hourly doses of tritiated thymidine , and hearts were fixed by perfusion 1 hour later . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Experiments in cultures with a single set of stimulator cells and 1 region compatible responder cells indicated that AC and Cspl or CNWT also have a markedly stronger capacity than NWT to induce IL 2 dependent DNA synthesis . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An ordered set of deletion clones was made by first cutting replicative form ( RF ) DNA with two restriction enzymes in the polylinker region of the vector between the Drosophila DNA and the sequencing primer binding site . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It has previously been shown that a set of other prokaryotic DNA binding proteins have primary structural homology with the two lambda proteins . ^^^ Homologies detected between the histones H 4 and H2b and members of this set suggest that these histones also contain the putative DNA binding fold . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The results provide the first demonstration of the relationship between single copy and repetitive DNA sequences in a large segment of chromosomal DNA containing a well characterized set of developmentally regulated genes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The linear viral DNA had a unique restriction map indicating that it is not a set of random circular permutations of the RNA genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Restriction endonucleases which cleave DNA at specific nucleotide sequences can be used to produce a set of DNA fragments of a viral genome which , when separated by gel electrophoresis , gives a characteristic `` fingerprint ' ' for that virus genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Further evidence for this structure came from the demonstration that DNA fragments generated by endonuclease AvaI can be ligated to form a discrete set of larger molecules and from nearest neighbor analysis which showed that cytosine residues occurred at the 3 ' side of cleavage points . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of overlapping inserts of Dm DNA cloned in a lambdoid vector and extending in both directions from the Drosophila tRNA gene bearing fragment of plasmid pCIT 12 has been isolated by the procedure of `` chromosomal walking . ' ' The isolated region has a total length of 94 kb of which a central 46 kb region contains eight tRNAAsn genes , four tRNA2Arg genes , five tRNA2Lys genes and one tRNAIle gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A unique set of bands is produced from the electrophoresis of randomly fragmented DNA ; this would be expected if there were a limited number of melting centers occupying discrete genetic loci . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The pattern of chromosome and mtDNA segregation observed in these hybrids and the cybrid support the hypothesis that a complete set of human chromosomes must be retained if a human mouse hybrid is to retain human mitochondrial DNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our results have shown that within the limits of sensitivity of our mapping approach , these three related cell lines contain the same set of viral DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It is concluded that cyt DNA of myeloblasts represents a set of distinctive cellular sequences some of which are liberated into the extracellular environment and are found in the AMV preparations . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the 3 members of the family one single set os saturable T 3 nuclear binding sites with affinity constants similar to those in the controls ( mean Ka = 3 . 2 10 10 ( 9 ) l / mol ; mean Cap = 17 . 4 10 10 ( 15 ) mol / 100 microgram DNA ) were found . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thus , defective HSV 1 ( Justin ) genomes contain , within their limited DNA sequences , a sufficient set of recognition sites required for HSV DNA replication and packaging . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The entire set of six closely related Drosophila actin genes was isolated using recombinant DNA methodology , and the structures of the respective coding regions were characterized by gene mapping techniques and by nucleotide sequencing of selected portions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The entire bovine corticotropin / beta lipotropin precursor gene has been isolated as a set of overlapping genomic DNA fragments which extend over a length of approximately 17000 base pairs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The linear viral DNA had a unique restriction map , indicating that it is not a set of random circular permutations of the RNA genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The genes for the heavy chain constant regions of the four gamma subclass immunoglobulins were identified in a set of overlapping mouse DNA fragments representing about 100 kilobase pairs ( kb ) of the mouse genome that was cloned from bacteriophage lambda libraries of BALB / c mouse embryo DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using this system to study in vivo gene expression , we measured the capacity of enzymatically produced DNA deletions to form the normal set of RNAs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analysis of 49 clonal populations of line 100 fibroblasts containing between one and five copies of exogenous ILV E sequences demonstrated that each clone was characterized by a unique set of viral DNA insertions within the cell genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Data obtained with the DNA of the latter recombinants allowed to show the correctness of the map established earlier which did not contain a full set of overlapping sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In order to provide a set of overlapping sequences , all the 29 internal Bam HI fragments of B 95 8 virion DNA were cloned in pBR 322 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of characteristic DNA restriction fragments is found in common among secondary foci derived from each tumor cell line DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A cloned EcoRI fragment containing human 18 S rRNA gene sequences was used to screen a gene library to obtain a set of 8 overlapping cloned DNA segments extending into the non transcribed spacer region of the human ribosomal RNA gene cluster . 19 . 4 kb of the approx . 43 kb rDNA repeat was obtained in cloned form and mapped with restriction endonucleases . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
After digestion of genomic DNA from resistant cells with restriction enzymes , a unique set of highly repetitive restriction fragments can be visualized on agarose gels by ethidium bromide staining . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The program can handle RNA and DNA for an arbitrary sequence of a set of 4 out of the 6 base types A , U , G , C , 1 and T . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of programs is presented for the reconstruction of a DNA sequence from data generated by the M 13 shotgun sequencing technique . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have isolated a set of overlapping cloned segments that define approximately 50 kb of DNA at the 68C puff locus . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Subcloning with these vectors utilizes a partial digestion with Sau3A to generate a quasi random set of DNA fragments from the original plasmid . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of synthetic oligodeoxyribonucleotide primers for DNA sequencing in the plasmid vector pBR 322 . ^^^ This set of universal primers is useful for rapid sequence determination of DNA cloned into pBR 322 or M13bla6 . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A complete gene library was established in a set of clones containing the viral DNA in long overlapping segments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The rep gene of Escherichia coli was mapped between ilvC and rho by three factor P 1 transductional crosses and also by complementation with a set of lambda transducing phages that contain known amounts of bacterial DNA linked to ilvC . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Direct DNA sequencing of two such SV 40 hybridizing segments indicated that this was not a highly conserved family of sequences , but rather a set of DNA fragments that contained repetitive regions of high guanine plus cytosine content . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have constructed a set of hybrid plasmids containing the bacterial vector pBR 325 , the LEU 2 gene of yeast encoding beta isopropylmalatedehydrogenase and various EcoRI restriction fragments of the 3mu DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The 180 , 000 base pair ( bp ) , covalently closed , linear duplex DNA genome of vaccinia virus contains a 10 , 000 bp inverted terminal repetition within which are one set of 13 and one set of 18 tandem 70 bp repeating units . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The SV 40 early region promoter , previously localized to the DNA segment bounded by the HpaII and HindIII restriction sites ( nucleotides 346 and 5171 ) , was further defined by construction of an extensive set of deletions within this region and measurement of their effects on ( a ) viral DNA replication , ( b ) virus multiplication and the ability to complement early and late mutations , ( c ) transformation of rat cells , ( d ) large T antigen formation , and ( e ) the location of the 5 ' ends of early mRNAs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set includes fragments containing both Py and cell DNA sequences ; the second set consists of fragments which contain no virus DNA sequences , and are identical to the fragments observed in the corresponding normal rat DNA digests . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The boundaries of the origin of polyoma DNA replication have been analyzed using a set of deletion mutants . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In strain Bristol and 10 other strains analyzed , there are 20 + / 5 copies of Tc 1 , and these are located at a nearly constant set of sites in the DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In contrast , both Pol 2 and Pol 2 H generated an identical set of transcripts from an adenovirus 2 early region DNA fragment . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In addition , a set of sequences present in JCV and BKV DNAs ( 33 nucleotides in JCV and 22 nucleotides in BKV ) and located near a 17 base pair palindrome shared by all three viruses is missing in SV 40 DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
No set of viral genes seems to be consistently retained or expressed in the transformed cells or in human cervical tumours , suggesting that viral DNA is not needed to maintain the transformed phenotype . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have isolated and characterized a new set of cis dominant constitutive mutations of the gal operon and determined their locations by DNA sequencing . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We had found that yeasts had intracellular endodeoxyribonucleases that cut phage DNA into a set of double stranded fragments with discrete chain lengths . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have analyzed T antigens produced by a set of simian virus 40 ( SV 40 ) A gene deletion mutants for ATPase activity and for binding to the SV 40 origin of DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The states of a system of adjacent sites can be revealed experimentally by cleaving a person ' s DNA into a set of fragments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Marker rescue was effected by mobilization of vectors bearing fragments of R . capsulata DNA from Escherichia coli to a set of R . capsulata mutants . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In addition , a set of sequences present in JCV and BKV DNA ( 33 nucleotides in JCV , 22 nucleotides in BKV ) , and located near a 17 base pair palindrome shared by all three viruses , is missing in SV 40 DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have examined the state of viral DNA in a set of SV 40 transformed mouse cell lines . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A cluster of four different leghemoglobin ( Lb ) genes was isolated from AluI HaeIII and EcoRI genomic libraries of soybean in a set of overlapping clones which together include 45 kilobases ( kb ) of contiguous DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This model is tested using data from the hybridization of a series of arbitrary single copy DNA probes screened with a set of restriction enzymes . ^^^ We apply the model to the problem of how much DNA is scanned by a set of enzymes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In an attempt to analyse the cause effect relationship between anchorage independent growth ( a property which correlates best with in vivo tumorigenicity ) and a set of other common transformation related properties , the effect of retinoic acid ( RA ) treatment on six unrelated transformed cell lines ( including DNA tumor virus , retrovirus , and spontaneously transformed cells ) were studied . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RNA blotting demonstrated two major RNA species of 2 . 3 and 1 . 5 kb . 5 ' and 3 ' mapping with 32P end labeled DNA fragments indicated that these RNAs are a nested set , each having its own promoter and 3 ' terminus . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Each set consists of one H 3 gene and one H 4 gene arranged as a divergently transcribed pair separated by an intergene spacer DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The analysis with a set of MspI and HpaII , which discriminates the methylated DNA sequence CC * GG , showed that 10 40 % of the sites of viral DNA are methylated in papillomas , 30 80 % in primary carcinomas , and more than 90 % in the transplantable carcinomas . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
From this sequence , the tentative corresponding DNA sequence was deduced , and a set of 11 nucleotide long DNA probes was chemically synthesized . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
From this set , nine fragments revealing polymorphic loci ( RFLP ) in Msp 1 or Taq 1 digested DNA have been identified , of which three are polymorphic with both enzymes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Interaction of EcoRII restriction endonuclease with a set of synthetic concatemer DNA duplexes with natural and modified sites for this enzyme has been studied . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
All experimental data can be fitted by the relation delta G tau = K ( alpha alpha ) 2 , where alpha is a constant for a given DNA at a given set of conditions and K is a DNA length dependent proportionality constant . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA homology experiments indicate that the various plasmids are related and suggest that there may be a common set of sequences present in all of the plasmids examined . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our physical characterization of the structures of cointegrates between an F factor ( pOX 38 ) and a set of pBR 322 : : Tn 9 related plasmids indicate that the relative mobilities of the two IS 1 elements of Tn 9 are inversely correlated with the strength of promoters upstream in the vector DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The polymorphisms in the region of the DC alpha and related DX alpha genes were studied with Southern blots of DNA from a set of mostly homozygous HLA D typing cell lines . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This methylated compartment , which comprises a small fraction ( 1 11 % ) of the total DNA , contains at least a specific set of repetitive sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The rabbit rRNA was specifically cleaved with T 1 ribonuclease , as well as with E . coli RNase H using a Pst 1 DNA linker to generate a specific set of overlapping fragments spanning the entire length of the molecule . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Scattering curves determined under a variety of experimental conditions were used to derive a set of parameters characterizing the shape , size , and weight of the whole phage particle and of its DNA and protein components . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Yeast mitochondrial DNA codes for a complete set of tRNAs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Moreover , the Diarrheal Diseases Control Programme , WHO , organized a multi laboratory study to evaluate the accuracy and reproducibility of the Biken test , in which 5 investigators tested an identical set of 100 unknown strains of E . coli , using the Biken test and at least one other assay method , which includes CHO cell assay , Y 1 adrenal cell assay , GM 1 ganglioside ELISA , DNA probe test and passive immune hemolysis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An isogenic set of DNA repair proficient and deficient strains of B . subtilis , cured of all prophages , were constructed and analyzed for their sensitivities to selected mutagens . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The resulting transformants exhibit normal resistance to DNA damaging agents and independent transformants demonstrate a common set of human DNA sequences associated with a human DNA repair gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This and earlier studies with a small set of well known mutagens indicate that the test detects monofunctional and polyfunctional alkylating agents ( ethyl methanesulfonate , diepoxybutane , mitomycin C , Trenimon ) , mutagens forming large adducts ( aflatoxin B 1 ) , DNA breaking agents ( bleomycin ) , intercalating agents ( 5 aminoacridine , ICR 170 ) , spindle poisons ( vinblastine ) , and antimetabolites ( methotrexate ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The recA and lexA proteins of EScherichia coli are involved in a complex regulatory circuit that allows the expression of a diverse set of functions after DNA damage or inhibition of DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Equilibrium centrifugation , spectral analysis of thermal denaturation and direct chemical determinations showed staphylococcal phage Sb 1 DNA to be characterized by a standard set of nitric bases ( 28 . 5 mol . 2 . / % G C ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA of the cells was substituted with 5 bromodeoxyuridine ( BrdUrd ) for 1 cell cycle in one set of experiments . ^^^ In a second set , cells with nonsubstituted DNA were microirradiated and grown for 2 additional cycles , the first in the presence , the second in the absence of BrdUrd ( protocol B ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The generation of `` signal search data ' ' represents a general method of describing the common properties of a set of DNA sequences presumed to be functionally analogous . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have developed , for the IBM PC microcomputer , a menu driven , interactive set of programs which provide the functions routinely used for DNA sequence data analyses . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of monomeric and oligomeric potato spindle tuber viroid ( PSTV ) specific DNA forms representing complete DNA copies of the circular PSTV RNA genome were constructed and cloned in plasmid pBR 322 and bacteriophage M 13 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set was used as a probe to screen cDNA containing bacterial clones and both were used as probes in hybridization against purified plasmid DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The seven probes , isolated from human genomic libraries , lacked repetitive sequences and were hybridized to DNA isolated from a set of human rodent somatic cell hybrids segregating human chromosomes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A distinct set of these proteins was either absent or only present in greatly decreased amounts in association with the leukemic lymphocyte nuclear DNA exposed to 2 . 0 M NaCl . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The structure of the messenger RNA ( mRNA ) encoding the precursor to mouse submaxillary epidermal growth factor ( EGF ) was determined from the sequence of a set of overlapping complementary DNA ' s ( cDNA ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A third class of mRNAs are transcribed from a set of repetitive DNA segments and are expressed predominantly during differentiation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of complexes of calf thymus DNA and n butylamine , covalently cross linked to the DNA bases with CH2O , has been examined by 10 ray diffraction . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These values are consistent with a number of independent absolute and relative DNA content determinations reported for animals , and therefore define a coherent set of animal and plant reference values for genome size determinations . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analysis of their genome by hybridization with human DNA revealed a shared set of human restriction fragments in all three cell lines . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An experiment with a set of 168 fragments yields a DNA sequence of about 5800 bases almost automatically . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The upstream set , designated incC , consists of direct repeats that are spaced about two turns of the DNA helix apart ; the downstream set , designated incA , consists of nine repeats arranged three in one orientation and six in the other . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The nucleotide specificity of exonuclease 3 leads to a transient appearance of a series of discrete DNA fragments intermediate in digestion and a stable set of fragments in limit digests , i . e . at the point when all DNA has become single stranded . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For Escherichia coli a large set of ColE 1 derivatives have been developed and have been used for cloning of DNA fragments from many biological systems . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It can be resolved on agarose gels into a continuum of sizes upon which is imposed a set of characteristic DNA bands . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of closely related germ line VH genes was then cloned from a partial Eco RI library of C57Bl / 6 DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
After purification of the mutations causing a reduction in the entry of DNA , a set of isogenic entry deficient strains was obtained . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Treatment of Escherichia coli with DNA damaging agents results in the increased expression of a set of din ( damage inducible ) genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here we report the occurrence of another set of minor E1A mRNAs which were observed exclusively after the initiation of viral DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Forty Campylobacter jejuni and 17 Campylobacter coli strains that constitute the set of reference strains for our serotyping scheme were each examined for the presence of plasmid DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The T 4 bound to a single set of binding sites in the patient ' s lymphocyte nuclei with a Ka which was depressed as compared with that of normals ( Ka = 2 . 8 10 10 ( 10 ) 1 / mol ) and a maximum specific binding capacity ( MSBC = 1 . 9 fmol T4 / 10 micrograms DNA ) which was increased as compared with normals ( msbc = 1 10 10 ( 16 ) mol / 1 T4 / 10 micrograms DNA ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thus DNA chromosome replication sequences are not dependent on the presence of a complete set of chromosomes of the parent cells and do not therefore seem to be a result of interaction between chromosomes not segregated in the hybrid genome . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In one set of experiments we used a cloned DNA probe prepared from the oncogene ( 5 mos ) of Moloney murine sarcoma virus ( Mo MSV ) to examine the state of integration , methylation , and transcription of the homologous cellular oncogene ( c mos ) in normal murine cells and in murine cells transformed by radiation or chemical carcinogens . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set of cultures was immediately released and assayed for the number of residues covalently bound to DNA , percent survival of colony forming ability , and frequency of induced mutations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this way , analysis of the DNA sequence proceeds from one end of the total insert to the other in a nonrandom fashion due to generation of a controlled overlapping set of deletion mutants . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Interaction of gene 5 protein of bacteriophage f 1 with a set of oligodeoxyribonucleotides ( including those with 1 , N 6 ethenoadenine ) , which simulate a site of attachment of protein on DNA has been studied . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Damage can be mended by excision repair , which is a set of enzymatic pathways by which damaged sites are removed and normal DNA structure restored . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This report concerns a set of sea urchin egg and embryo transcripts complementary to a single copy region of a cloned DNA fragment ( Sp 88 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These monoclonal antibodies comprise a set of powerful and specific reagents that should facilitate the development and application of novel approaches to the complex biochemical mechanisms of mammalian DNA replication . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A complicated set of genes on the Ti plasmid control the various steps involved in the tumorous transformation and are thus responsible for the transfer of the oncogenic T DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Up to 25 % of DNA released from lymphocytes during growth similarly resists denaturation , and released DNA and IR DNA are both enriched in the same set of repetitive sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To the surprise of some observers , the National Institutes of Health recently issued a second set of sanctions against Martin Cline for violating its regulations governing recombinant DNA research and human experimentation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Direct structural identification of the carcinogen DNA adduct will ( 1 ) immediately confirm that the chemical is acting as a potential carcinogen under a given set of circumstances ; and ( 2 ) directly identify those critical metabolic pathways which are involved in the metabolism of the chemical to a carcinogenic form rather than an inactive detoxification product . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA replication could be scored separately in mouse and hamster chromosome sets , initially termination was highly asynchronous , but during growth asynchrony was progressively reduced as DNA synthesis in the hamster set was prolonged . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA packed arrangement coefficient , determined as a ratio of DNA length , equal to 85 + / 5 mm in a haploid set , to the length of 520 + / 40 microns of a set of polytene chromosomes was found to be 164 + / 22 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This DNA consists of repeated sequences arranged in a multimeric set of circular molecules . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The vast majority of hepatocytes in a liver population of such rats are mononuclear 3H TdR non marked cells with a 2C DNA content , which corresponds to the diploid chromosome set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This research represents oen of the first instances in which a defined segment of nonreiterated DNA coding for a known set of genes has been localized to a specific region on a vertebrate chromosome by in situ hybridization . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This paper describes a new way of storing DNA gel reading data and an accompanying set of computer programs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this paper , we describe the accomplishments of the initial phase of the Human Genome Project , with particular attention to the progress made toward achieving the defined goals for constructing genetic and physical maps of the human genome and determining the sequence of human DNA , identifying the complete set of human genes , and analyzing the need for adequate policies for using the information about human genetics in ways that maximize the benefits for individuals and society . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Early biochemical experiments established that the set of dinucleotide odds ratios or ' general design ' is a remarkably stable property of the DNA of an organism , which is essentially the same in protein coding DNA , bulk genomic DNA , and in different renaturation rate and density gradient fractions of genomic DNA in many organisms . ^^^ From this perspective , the set of dinucleotide odds ratio ( relative abundance ) values constitute a signature of each DNA genome , which can discriminate between sequences from different organisms . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Subcloning in these vectors of a DNA fragment generates a ' transfer vector ' which is compatible with the second set of E . coli yeast shuttle vectors . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The complete DNA sequence of cosmid clone p 59 comprising 37 , 549 bp derived from chromosome 10 was determined from an ordered set of subclones . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
While shotgun sequencing infers a DNA sequence given the sequences of overlapping fragments , a recent and complementary method , called sequencing by hybridization ( SBH ) , infers a DNA sequence given the set of oligomers that represents all subwords of some fixed length , k . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Electrophoretic mobility shift patterns were obtained by numerical solution of a set of simultaneous transport reaction equations , in which the chemical kinetic term is formulated in terms of dissociation of the different DNA : HU complexes in gel cages . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA analysis took place in sets of 10 with a calibration of the CE being performed between each set of samples . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These autocorrelation indices for DNA analysis , or AIDAs , can be applied to RFLP and sequence data ; the resulting set of autocorrelation coefficients , or correlogram , measures whether , and to what extent , individual DNA sequences or haplotypes resemble the haplotypes sampled at arbitrarily chosen spatial distances . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of double stranded oligonucleotides , each with an unique DNA configuration , were designed , synthesized and substituted into an area of naturally occurring right handed superhelical curvature immediately upstream of the beta lactamase promoter in plasmid pUC 19 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When region B was hybridized to HindIII digested genomic DNA isolated from C . difficile strains , a set of variable length restriction fragments ( Group 2 ) hybridized predominantly . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a first set of experiments , mutational analysis of three phylogenetically conserved tyrosine residues in the DNA terminal ( TP ) domain indicated that of these , only tyrosine 96 was essential for both viral DNA synthesis in transfected cells and priming of DNA synthesis in a cell free system . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A single and common set of primers was designed and used to detect products of the hGH / hCS genes as well as distinguish processed RNA from any contaminating DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
PCR was performed using a set of primers on the same exon , and genomic DNA was coamplified with cDNA by these primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To detect resistance of HIV 1 to reverse transcriptase ( RT ) inhibitors , we developed a set of two overlapping nested PCR primer sets and additional sequencing primers to amplify and sequence the total RNA or DNA RT gene using a direct cycle sequencing approach of the amplified fragment . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set was used to amplify an 882 bp DNA fragment from the full length type , and a 798 bp DNA fragment from the spliced type . ^^^ Another set was used to amplify a 375 bp DNA fragment from the full length type only . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The mutational specificities of various chemical mutagens were compared in isogenic E . coli strains with different DNA repair capabilities ( wild type , uvrA , umuC , and uvrA umuC ) in a reversion assay employing a set of mutant lacZ genes that can detect two types of transitions , four types of transversions , and five kinds of specific frameshift events . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA genome of caulimoviruses contains a set of essential genes : 1 ( movement gene ) , 4 ( major capsid protein gene ) , 5 ( reverse transcriptase gene ) , and 6 ( gene coding for a post transcriptional activator of the expression of other virus genes ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Depending on the primer probe set used , either 78 or 67 % of the human fecal extracts tested had high levels of target DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To this end a defined alfoid repetitive DNA probe set was used , specific for the centromeres of chromosomes 1 , 7 , 8 , 10 , 15 , and Y . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The gene for human PSGL 1 , which has been designated SELPLG by the Human Gene Nomenclature Committee , was mapped to chromosome 12q24 using Southern blot analysis of DNA from a set of human mouse cell hybrids , and fluorescent in situ hybridization on metaphase chromosome spreads . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
After anionic resin removal of proteins , PCR amplification of TP 53 gene exons 5 / 6 and SSCP analysis , an abnormal SSCP band shift was observed in suspected tumour cells , compared with microdissected stromal cells used as an internal control , while ( 1 ) a crude preparation of tissue DNA carrying the tumour did not show any abnormality and ( 2 ) immunostaining by a set of monoclonal antibodies against TP 53 protein remained negative . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For the Eurasian African orthopoxviruses , a confirmatory step that used a set of higher sequence homology primers was developed to provide sensitivity to discern individual virus HA DNAs from cross contaminated orthopoxvirus DNA samples ; TaqI and HhaI digestions of the individual amplified HA DNAs confirmed virus identity . ^^^ Finally , a set of primers and modified PCR conditions were developed on the basis of base sequence differences within the HA genes of the 10 species , which enabled production of a single DNA fragment of a particular size that indicated the specific species . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To address the issue of DNA binding by OmpR , we selected a set of OmpR mutants , each of which has a single amino acid substitution in the C terminal half of OmpR . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This set of primers , X 222 and X 224 , was able to discriminate between the pathogen and other mycobacterial species as well as non mycobacterial strains ; it detected down to 3 fg of M . xenopi DNA , i . e . about one genome equivalent . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A novel set of primers for polymerase chain reaction ( PCR ) which amplified the portion of US 6 sequence coding for the main type common neutralizing epitope of glycoprotein D ( gD ) was used for detection of herpes simplex virus ( HSV ) DNA in 44 cerebrospinal fluid ( CSF ) samples from 29 patients with clinical symptoms of viral meningitis or meningoencephalitis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Though it has been possible in the past to learn to predict DNA hydration patterns from crystallographic data , there is ambiguity in the choice of training data ( both in terms of the relevant set of cases and the features needed to represent them ) , which limits the usefulness of standard learning techniques . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The algorithm described in this paper discovers one or more motifs in a collection of DNA or protein sequences by using the technique of expectation maximization to fit a two component finite mixture model to the set of sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Assembly of genomic sequences and maps relies on a primary set of experimental data ( e . g . , the sequences of individual DNA fragments , or hybridization fingerprints of individual clone inserts ) , but almost always also relies on several streams of related but distinct kinds of data for completeness and accuracy of the final construction . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this study we investigated a set of psoralen coupled oligonucleotides introducing multiple lesions into the target DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of procedures , based on DNA analysis , has been developed to detect deletions and point mutations causing Beta thalassemia in the Pakistani population . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We then used a set of experimentally derived criteria to predict which of the total IRs and MRs are most likely to form cruciforms or H DNA in supercoiled DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A conventional PCR ( with Dig dUTP ) was performed using a set of oligonucleotide primers ( 5 ' AAGTGGTCAGCGTGTCCATA 3 ' and 5 ' TTTCTCCTGTATCCTCCTGC 3 ' ) for 236 bp fragment of porcine male specific DNA sequence and 1 . 25 10 10 ( 4 ) template white blood cells obtained from a boar . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This study compares the specificity of the two types of probes by parallel analysis of a set of DNA samples , including a subset of relatively small alleles , at the loci D1S7 , D2S44 , D4S139 , D10S28 , and D17S26 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
With a set of two alpha satellite DNA probes specific for the centromeric regions of chromosomes 7 and 12 , used either separately ( single target fluorescence in situ hybridization ) or simultaneously ( double target fluorescence in situ hybridization ) , we detected polysomies of chromosome 7 in 35 . 7 % of the thyroid follicular adenomas and in 10 . 7 % of the goiters . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
SsoII , respectively ) with a set of synthetic DNA duplexes , containing a M . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The earliest detectable changes in lens cell biology are observed in the epithelial cell redox set point and at the DNA level in terms of DNA integrity and 3H thymidine incorporation followed by decreased membrane transport and changes in gene expression . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The interaction of DNA topoisomerase 1 ( topo 1 ) with a set of single and double stranded oligonucleotides containing 5 27 mononucleotides was investigated . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The main features of this method are , first , cDNA amplification including VH through the constant region ( CH 2 domain ) of each IgG subclass with a set of consensus PCR primers ( VH1BACK and 32P labeled C gamma 32 ) , and secondly , cleavage of the amplified DNA fragments with BamHI and XhoI endonucleases which act at distinct cleavage sites in the constant region of each IgG subclass . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Furthermore , E2F appears to directly regulate the transcription of a diverse set of genes implicated in DNA replication and cell growth control . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Three FLP monomers bound to specific FLP recognition sequences are required to efficiently carry out one set of reciprocal DNA cleavage and strand exchange events on a Holliday junction substrate . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To study reproducibility and discriminatory abilities , AP PCR was carried out in seven laboratories with a standardized amplification protocol , template DNA isolated in a single institution , and a common set of three primers with different resolving powers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Single amino acid substitutions were made at several positions within the DNA binding domain of p 53 , and this set of p 53 point mutants were tested with DNA site variants for DNA binding . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Since the oncogene E1a confers susceptibility to DNA damaging agents and stabilizes p 53 protein , we investigate whether the sensitivity to anticancer drugs of E1a expressing cells was mediated by binding to a specific set of cellular proteins ( p 60 , p 105 , p 107 and p 300 ) and related to the induction of apoptosis and the level of p 53 protein . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In order to make DNA based diagnosis possible for the remaining 20 % of patients we have set up PCR / solid phase based semi automated sequencing of all 12 exons of the MCAD gene . ^^^ We find that our diagnostic set up , consisting of an initial testing by the G 985 assay , followed by semi automated sequencing of DNA from those patients who were indicated to be compound heterozygous , is an important improvement to the diagnosis of MCAD deficiency . ( ABSTRACT TRUNCATED AT 400 WORDS ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA topoisomerases and DNA site specific recombinases are biologically important enzymes involved in a diverse set of cellular processes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA extracted from tonsillar cells or parenchyma were subjected to polymerase chain reaction analysis , using either a single set of oligonucleotide primers or nested primers from the PRV gII glycoprotein gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To investigate any possible roles for Mg2+ in promoting specific DNA binding , a set of hydrolysis resistant oligonucleotide substrates were synthesized that contained either phosphate ( phosphorothioate , 3 ' S phosphorothiolate ) , sugar ( 4 ' thiothymidine ) , or base ( 7 deaza 2 ' deoxyadenosine ) modifications . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An HPV type specific set of primers was localized on the E 6 gene for HPV 16 / 18 DNA . ^^^ The second and third set of primers were specific for HPV 6 / 11 DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Given the success of the cDNA selection method for finding a large number of genes in YACs from other chromosomal regions , these results suggest that the 6 Mb of DNA in the dark band 21q21 contains few single copy sequences expressed in this tissue set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A genetic analysis of a set of Trypanosoma cruzi and Trypanosoma rangeli stocks was performed by two combined approaches , namely multilocus enzyme electrophoresis ( MLEE ) and labeling by DNA probes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Because of the striking association between 8p deletion and AVCD , a search for an AVCD gene was carried out in two pedigrees of individuals with autosomal dominant AVCD using a set of DNA markers of the 8pter > q 12 region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have developed a set of cell lines to help distinguish the sequelae of specific lesions in DNA after UV irradiation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Although most of the available evidence does not suggest that electric and / or magnetic fields cause DNA damage , the existence of some positive findings and limitations in the set of studies carried out suggest a need for additional work . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Multiple string ( sequence ) alignment is a difficult and important problem in computational biology , where it is central in two related tasks : finding highly conserved subregions or embedded patterns of a set of biological sequences ( strings of DNA , RNA or amino acids ) , and inferring the evolutionary history of a set of taxa from their associated biological sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set of experiments was performed with spheroplasts derived from Escherichia coli AB 1157 , which has normal DNA repair systems . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We demonstrate that RPA PCR can be used to prepare a nested set of evenly spaced deletions suitable for DNA sequencing . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Owing to this additional growth , weight of muscle tissue may be increased from 30 % to twice , depending on the myocyte ploidy of a given myocardium which varies from 4 to 10c on average under normal circumstances and to 30c in some cases of hypertrophy ( where c is the haploid DNA content , and , accordingly , a haploid chromosome set ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A series of evolutionary trees with concordant topology has been derived based on the combined data set of all of the mitochondrial DNA sequences , which may have resolved the evolutionary relationships of all bear species : the ancestor of the spectacled bear diverged first , followed by the sloth bear ; the brown bear and polar bear are sister taxa relative to the Asiatic black bear ; the closest relative of the American black bear is the sun bear . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Localization of 11 clones was determined using PCR and clone specific primer pairs on a hybrid mapping panel DNA set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Simple repeats composed of tandemly repeated units 1 6 nucleotides ( nt ) long have been extracted from a selected set of primate genomic DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of oligonucleotide primers derived from the non repetitive region of the toxin A gene was developed to amplify a 634 bp DNA fragment . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
On a test set of 137 human and mouse DNA sequences consisting of 954 true exons , GAP 3 constructed 137 gene models using 892 exons , among which 859 ( 859 / 954 = 90 % ) are true exons and 33 ( 33 / 892 = 3 % ) are false positive . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The epsilon sequences contain a set of nested inverted repeats which form a stable stem loop structure shown to play a role in RNA packaging and recently implicated as the site of initiation of minus strand DNA synthesis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Advantage was taken of this behavior to systematically mutagenize a 291 bp long DNA fragment and to define the rules relating the frequencies of each possible bp substitution to the set of the dNTP concentrations in the PCR experiment . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
All three members of the myb protein family , however , display a high degree of homology within their DNA binding domain , suggesting that they may regulate transcription of a similar set of target genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of universal primers for amplification of polymorphic non coding regions of mitochondrial and chloroplast DNA in plants . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Restriction and sequence analyses of deletion clones demonstrated that an ordered set of clones with nested deletions , ranging from less than 1 kb to 25 kb , was created from either the end of the DNA segment . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The Ad core functioned as template for DNA replication in the cell free system consisting of viral replication proteins , uninfected HeLa nuclear extracts , and a novel factor , template activating factor 1 ( TAF 1 ) that we have isolated from uninfected HeLa cytoplasmic fractions . ^^^ These observations suggest that , in addition to factors essential for transcription on naked DNA template , the factor such as TAF 1 needed for replication of the Ad core is also required for transcription from the Ad genome in a chromatin like structure . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We observe that the constraint set does indeed define a unique structure for the DNA segment . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
From the set , 19 phages had double stranded DNA and 3 were single stranded DNA phages . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of lac operon fusions to various DNA segments from the nuo promoter region was also constructed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the methicillin resistant strains of Staphylococcus aureus ( MRSA ) typed by the International Set phages the host specificity of the restriction modification of the phage 85 DNA was determined , the finger printing of the cell DNA was carried out with using two probes and the lytic spectrum of the phages induced in them was studied . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of Belgian and African HIV 1 seropositive and seronegative patient samples , collected in Belgium , and the British Medical Research Council ( MRC ) HIV 1 PCR reference reagent kit , containing plasmid HIV 1 DNA at several dilutions in human carrier DNA with appropriate negative controls , were tested by the laboratories . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The biological significance of the novel set of DNA interactions by which RecA protein effects homologous recognition is indicated by the importance of this protein in recombination , and the widespread distribution of homologous proteins in prokaryotes and eukaryotes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The chicken lysozyme locus is regulated in oviduct and macrophages by a complex set of well characterized cis regulatory DNA elements . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A nested set of DNA fragments from the IL 10 gene 5 ' flanking region was placed upstream of the luciferase gene and assayed for their ability to direct luciferase expression in Burkitt ' s lymphoma cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A specific primer probe set ( JM 201 and JM 202 primers with JM 204 probe ) designed from the penicillin binding protein 2B gene was demonstrated to reproducibly detect between 10 and 100 fg of input purified S . pneumoniae DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Two different repetitive DNA probes of Apis mellifera and ribosomal DNA from Drosophila melanogaster were used to characterize the chromosomal set of the honeybee ( n = 16 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This method reveals weak DNA signals on an unaligned set of DNA fragments known to be functionally related and assumes no prior information on the sequences ' alignment . ^^^ The DNA sequences of nucleosome cores from chicken erythrocyte and a set of the other known nucleosomal sequences show existence of symmetrical features in nucleosome binding DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA replication of the adenovirus genome complexed with viral core proteins is dependent on the host factor designated template activating factor 1 ( TAF 1 ) in addition to factors required for replication of the naked genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a set of Monte Carlo simulation models , track structures of 125I Auger electrons generated in liquid water are superimposed on a nucleosome DNA model able to precisely localize energy deposition events on sub molecular units of the DNA strands . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The technique involves hybridization of the DNA of unknown sequence with an enormous set of short oligonucleotides ; identification and analysis of the overlapping set of oligomers that form perfect duplexes with the DNA of interest permits reconstruction of the target DNA sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The accumulated data set will provide the means to direct large scale sequencing of the DNA , or might even make the sequence analysis of large genomic regions a redundant undertaking due to the already collected information . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Elongation of RNA in vitro , followed by hybridization with a nested set of DNA fragments extending progressively farther into the stalling region , allowed localization of the 3 ' end of the nascent RNA to a position 5 to 10 nucleotides upstream of binding site A . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Each member of the RNA family is defined by a set of DNA probes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For developing a complete YAC based STS content map of human chromosome 7 , we wished to utilize a limited set of YAC clones that were highly enriched for chromosome 7 DNA . ^^^ Toward that end , we have assembled a human chromosome 7 YAC resource that consists of three major components : ( 1 ) a newly constructed library derived from a human hamster hybrid cell line containing chromosome 7 as its only human DNA ; ( 2 ) a chromosome 7 enriched sublibrary derived from the CEPH mega YAC collection by Alu polymerase chain reaction ( Alu PCR ) based hybridization ; and ( 3 ) a set of YACs isolated from several total genomic libraries by screening for > 125 chromosome 7 STSs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A viral isolate obtained from peripheral blood lymphocytes of an infant with a nonspecific febrile syndrome was identified as human herpesvirus 7 ( HHV 7 ) on the basis of PCR analysis of its DNA with one set of primers specific for HHV 7 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A reliable method for extracting DNA from teeth was developed and successfully applied to a set of 12 skeletons recovered from two 10 year old Guatemalan mass graves . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The enzyme , broccoli DNA strand transferase , has a native molecular mass of at least 200 kD and an apparent subunit molecular mass of 95 kD and is isolated as a set of isoforms differing only in charge . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In vitro , Th 1 protein recognizes a set of DNA sites that are more degenerate than has been determined for other bHLH factors , indicating a reduced binding specificity . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Different DNA probes hybridize under different conditions . 1 examine the constraints of the design of oligonucleotide probes that are meant to hybridize to different unique sites in human genomic DNA under a single set of hybridization conditions as a parallel array . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By using a nested set of gII specific primers viral DNA was found in 92 % of the 135 samples . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An extensive set of chromosome 15 DNA polymorphisms and densitometric analysis with four markers mapping to the Prader Willi chromosome region ( PWCR ) of chromosome 15 have been used to characterize a cohort of 30 subjects with classical Prader Willi syndrome ( PWS ) . ^^^ Molecular analysis enabled the classification of the PWS subjects into four groups : ( A ) 18 subjects ( 60 % ) had deletions of paternal 15q11 13 involving a common set of DNA markers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Members of the MEF 2 family of DNA binding proteins interact with a set of AT rich sequences commonly found in the promoters and enhancers of muscle specific genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using this set of plasmids , we have assigned a role for each of the 18 genes required for optimal late gene expression with respect to its involvement at the levels of transcription , translation , and / or DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
At least two examples of each set of mismatches were studied for cleavage in the complementary pairs of heteroduplexes formed between normal and mutant DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
From gel shifts with a permuted set of DNA fragments , the degree of DNA bending by EcoRV at its recognition site was estimated to be 53 degrees + / 4 degrees . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The reduced operator affinity of the PL 8 dimer appears to arise because the mutant can not make the new interstrand hydrogen bonds and simultaneously make the wild type set of contacts with operator DNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Following the recent developments in diagnostic polymerase chain reaction ( PCR ) technology , we have assessed a set of HIV 1 DNA reference standards using the first commercial diagnostic test kit for the detection of HIV 1 ( Amplicor , Roche ) in an international collaborative study . ^^^ Nineteen laboratories in 11 countries analysed a set of ten ( re coded ) HIV 1 DNA reference standards , whose performance had been validated in a previous collaborative study ( Bootman and Kitchin , 1992 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Incubation of pUC 19 DNA with the wild type OV or 10 enzyme yielded an indistinguishable set of DNA cleavage fragments , although the relative abundance of the fragments differed for the two enzymes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RSV , and a larger set of HIV 1 , IN deletion mutants were then tested for their ability to perform an intramolecular , concerted cleavage ligation reaction using an oligodeoxynucleotide substrate that mimics the intermediate viral host DNA junction found prior to the final step of covalent closure . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A single primer set ( RAP 1007 and DB 337 ) is used to specifically amplify a 990 bp fragment containing the HLA A locus exons 1 , 2 , and 3 from genomic DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
CONCLUSIONS : The major advantage of the unstable DNA hypothesis over the multifactorial polygenic theory lies in the possibility of falsifying the unstable DNA hypothesis by two independent laboratory strategies : a classical linkage analysis and a set of novel methods for the direct detection of unstable DNA sites . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Two sets of primers were designed ; one set ( MC323 / MC358 ) to amplify a approximately 1 . 5 kbp DNA fragment from all the members of the M . mycoides ' Cluster ' and the other set ( MM450 / MM451 ) specifically amplified a 574 bp DNA fragment from M . mycoides subspecies . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Midgut homogenates of 22 ticks ( including 13 ticks positive by culture and 12 microscopically positive ticks ) were found to contain Borrelia ( B . ) burgdorferi specific DNA by PCR using a primer set based on sequences of the flagellin gene of B . burgdorferi . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA was isolated from in vitro grown mycelia , digested with HinfI or RsaI , and hybridized to a set of synthetic oligonucleotides complementary to simple repetitive sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : A set of satellite DNA probes specific for chromosome 3 , 7 , 9 , 11 , and 17 was hybridized directly to paraffin embedded tissue section of 30 non small cell lung cancers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Overlapping YAC clones covering human chromosome 21q may be systematically used to detect a set of band specific DNA probes for molecular cytogenetic application . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It was concluded that the DNA isolated from the enriched mouse spindle fiber attachments contains a complete set of the centromeric DNAs of all autosomes , 10 and Y chromosomes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Cluster analysis of the rep PCR DNA fingerprints revealed two major groups of the strains ; one set consisted of strains from patients with duodenal ulcer disease and the second cluster consisted largely of strains from individuals with asymptomatic gastritis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
However , this limited set of DNA ' s was unable to support replication of a second origin containing plasmid derived from a different region of the OpMNPV genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have studied the parental origin of the extra haploid set of chromosomes in nine triploid fetuses using analysis of DNA polymorphisms at a variety of loci . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the Appendix the experimental data obtained with the Antp ( C39S ) homeodomain DNA complex and the techniques used for the structure calculation are evaluated using a simulated input data set derived from the 10 ray crystal structure of a DNA complex with a homologous homeodomain . ^^^ This study indicates that a nearly complete set of NOE upper distance constraints for the Antp ( C39S ) homeodomain and the protein DNA interface was presently obtained . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The distinct expression pattern and divergent DNA binding characteristics indicate that mPOU may regulate a distinct set of genes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A new set of loci involved in pilus biogenesis and twitching motility was identified based on the ability of DNA sequences downstream of the pilG gene to complement the non piliated ( pil ) strain , PAO 6609 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To examine the effects of base composition and DNA conformation on electron migration , a set of oligonucleotides containing 5 bromouracil at selected positions with three base ( guanine , cytosine , thymine or adenine ) spacers ( e . g . [ BrU ( GGG ) 3 ] 3 ) were irradiated in their single or double stranded form following annealing with appropriate complementary sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using this primer set and probe , we were able to detect Pseudomonas sp . strain B 13 DNA sequences in DNA extracted from aquifer samples 14 . 5 months after Pseudomonas sp . strain B 13 had been injected into a sand and gravel aquifer . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The induction of interferon ( IFN ) genes by viruses or double stranded RNA ( dsRNA ) requires the assembly of a complex set of transcription factors on responsive DNA elements of IFN gene promoters . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We analyzed a set of meningioma DNA specimens by Southern blot hybridization with chromosome 22 specific probes and by PCR using oligomer primers and probes specific to the leukemia inhibitory factor ( LIF ) gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These findings suggest that homeodomain structure and DNA docking constrain in the versatility of the domain in that only a limited set of amino acid determinants can endow the domain with specific , high affinity DNA binding . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Automation greatly increased the speed of DNA histogram analysis , allowing evaluation of the same set of histograms with different methods . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 103 epidemiologically well defined Acinetobacter baumannii isolates obtained from nine hospital outbreaks and 21 unrelated strains were characterized by pulsed field gel electrophoresis ( PFGE ) of total genomic DNA digested with ApaI . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The haptenized CRE ds oligo DNA reacted by Southwestern analysis with a distinct set of proteins , previously identified as CRE binding proteins , ranging from 40 90 KD . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Isolation of IgG antibody Fv DNA from various mouse and rat hybridoma cell lines using the polymerase chain reaction with a simple set of primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Coincidence cloning is a technique that permits the isolation of sequences common to two independent sources of complex DNA , and this method has been used to isolate a set of probes from a region of porcine Chromosome ( Chr ) 6 containing the loci for glucosephosphate isomerase ( GPI ) and the skeletal muscle calcium release channel ( CRC ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The method was first tested using the set of DNA sequences produced by Markov chain generators . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Escherichia coli contains a set of genes homologous to those involved in protein secretion , DNA uptake and the assembly of type 4 fimbriae in other bacteria . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We propose that the surface loop consisting of residues 152 to 166 makes identical molecular interactions in transcription activation at all class 1 CAP dependent promoters , irrespective of distance between the DNA site for CAP and the transcription start point , but makes a different set of molecular interactions in transcription activation at class 2 CAP dependent promoters . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Certain mutant integrases that were otherwise inactive with the crossbones substrate could complement one another , indicating that no single protomer in the integrase multimer requires a complete set of functional domains either for catalytic activity or for juxtaposition of the two viral DNA ends by the active multimer . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In contrast to previous findings , which indicated that p105NF kappa B 1 does not bind DNA , all of the NF kappa B 1 precursors were found to specifically bind with low affinity to a highly restricted set of NF kappa B sites in vitro , thereby raising the possibility that certain of the NF kappa B 1 precursor isoforms may directly modulate gene expression . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Comparing the amino acid sequences of fingers which specify a particular base in a triplet , we infer that in most instances , sequence specific binding of zinc fingers to DNA can be achieved by using a small set of amino acid nucleotide base contacts amenable to a code . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The parameters of the HMM are estimated using approximately one million nucleotides of annotated DNA in EcoSeq 6 and the model tested on a disjoint set of contigs containing about 325 , 000 nucleotides . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Therefore , we determined both p 53 protein overexpression ( by immunostaining ) and p 53 and ras gene mutations ( by single strand conformation polymorphism and DNA sequencing ) in this set of resected tumor specimens . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have explored these effects by constructing a set of lacZ reporter plasmids with Op99a , b and varying parts of the upstream DNA region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genomic DNA gel blot analysis indicated that probes corresponding to LHA 1 through LHA 7 hybridized to a common set of seven to nine restriction fragments at moderate stringency and to single , distinct fragments at high stringency . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
On a set of 198 bacterial strains out of 19 different species we have tested the ability of oligonucleotide ( GTG ) 5 to provide definitive DNA fingerprints . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Poisson random field ( PRF ) theory was used to derive the expected distribution of frequencies of nucleotides differing from the ancestral state at aligned sites in a set of DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This set of sequence differences has allowed a comparison of mutations in unselected DNA to those mutations that produce a phenotypic signal . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These combined maps and the YAC clones provide a set of extended DNA loci ordered at high odds that can be used to isolate additional polymorphic loci and genes , and to serve as a framework for obtaining a higher resolution physical map of the chromosome . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this approach , a relatively large DNA fragment is amplified with an outer set of primers , and a `` nested ' ' internal sequence of the PCR product subsequently reamplified with an inner set of primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
That these contacts are involved with DNA binding is supported by recurrent features of a newly compiled set of homology groups of 13 variable regions of heavy chains ( VH ) and 11 variable regions of light chains ( VL ) , characteristic pattern of somatic mutations , and the results of site directed mutagenesis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A genus specific primer probe set was derived from the 16S ribosomal DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 25 mer primers was selected from the 5 kb DNA probe for the amplification of a 317 bp region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
C base pair on DNA stability was investigated for a related set of 14 mers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By using primer set GYD2P1F and GYD2P1R , a 600 bp DNA fragment was amplified only when DNAs from GYU , CPhB , and CPhC infected plants were used as templates . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The solution to the 48 parameters ( three per drug site , 16 sites ) , which fully described the echinomycin DNA transcription data set , can readily be accomplished without manual intervention within an hour on a MS DOS , 486D based microcomputer , compared to several months for a similar solution by Monte Carlo simulation ( requiring repeated intervention ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA polymerases ( pol ) alpha , delta and epsilon of a mouse cell line FM3A and its temperature sensitive derivative tsFT 20 , which is defective in DNA replication at a non permissive temperature , were purified by chromatographic procedures monitored by a set of relatively specific assays for the respective DNA polymerase activities . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Comparing DNA conformations in this way revealed that an otherwise unrelated set of protein DNA complexes have interesting structural similarities , including an enlarged major groove . ^^^ Since related features occur in such a diverse set of protein DNA complexes , we suggest that this conformation may have a significant role in protein DNA recognition . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A systematic analysis of DNA polymerase of human herpes simplex type 1 virus , cytomegalovirus , and human type 2 adenovirus with the help of a broad set of modified substrates of these enzymes has been carried out . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We describe a set of plasmid vectors that are very useful for cloning , expressing , mutagenizing , deleting , and sequencing DNA fragments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The construction in bacteriophage lambda of a set of long DNA palindromes with paired changes in the central sequence is described . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To identify DNA sequences required for HutC titration , we constructed and characterized a set of 40 left entering and 28 right entering deletions within a 250 bp DNA sequence containing the hut ( P ) region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of p 53 tumor suppressor gene primers , exhibiting low and high extremes of background amplification , were tested for sensitivity in the presence and absence of added genomic DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Experimental and theoretical investigations on the mobility behavior of a set of permuted fragments with a K DNA insert is reported . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Each set contained the same strand primer , but the +strand primers differed at their 3 ' end , thus being complementary only to the wild type or to the mutant DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The mitochondrial DNA of Podospora anserina is complex , consisting of a characteristic set of genes with a large number of introns and a substantial amount of sequence of unknown function and origin . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA binding was a function of the MT a 1 HMG box domain ( a DNA binding motif found in high mobility group proteins and a diverse set of regulatory proteins ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The complete DNA sequence of cosmid clone pUKG 148 comprising 28 , 600 base pairs was determined from an ordered set of subclones . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The complete DNA sequence of cosmid clone pEKG 080 comprising 20 , 723 base pairs was determined from an ordered set of subclones . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A different set of electrophoretic conditions resolves DNA between 1 . 5 and 6 megabases in 23 h , with a detection limit of about 5 Gy . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sixty five patients with untreated ANLL and 15 patients with solid tumors and normal bone marrow ( BM ) received 250 mg / m2 of bromodeoxyuridine ( BUdR ) ; bivariate flow cytometric ( FCM ) analysis then was used to measure cell BUdR incorporation and DNA content to obtain a complete set of kinetic parameters ( i . e . , BM BUdR labeling index , DNA synthesis time , potential doubling time [ Tpot ] , and cell production rate ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These markers were placed on the CEPH genetic linkage map by screening the CEPH reference DNA panel with each primer set , combining these data with those of other markers previously placed on the map , and analyzing the combined data set using CRI MAP and LINKAGE . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A total of 33 STSs were used to assemble the 31 YACs into a single contiguous set of overlapping DNA fragments spanning at least 2 . 3 megabases of the pseudoautosomal region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Brucella abortus DNA was not amplified by the primer set used . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
All studied strains were found to have the identical profiles of migrating fragments in restrictograms got by using a set of endonucleases ( EcoRI , PstI , PvuII , Bg1I , XbaI , HindIII , MspI ) and similar zones of hybridization with a DNA probe derived from Rickettsia prowazekii DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of four micro and minisatellite core probes resulted in a total number of approximately 70 bands per patient using one dimensional analysis of RsaI digested DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Forensic applications of DNA typing data require the estimation of the frequencies of all observed alleles , which is currently done by a fixed set of groupings ( binning ) of alleles in a database . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of mapping markers have been designed for Arabidopsis thaliana that correspond to DNA fragments amplified by the polymerase chain reaction ( PCR ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The 17 kb PAO 1 DNA insert of pPV 4 contained at least two genetic determinants involved in pyoverdin synthesis , i . e . , pvdA and pvdC 4 , as shown by complementation analysis of a set of mutants blocked in different steps of the pyoverdin biosynthetic pathway . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We report a complete set of average configuration dependent parameters , ranging from scalars ( i . e . , persistence lengths ) to first and second order tensor parameters ( i . e . , average second moments of inertia ) , as well as approximations of the associated spatial distributions of the DNA and their angular correlations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results were confirmed with anchored PCR and by DNA sequencing to characterize at the molecular level the set of T cell receptor ( TCR ) delta mRNAs expressed in the peripheral blood of two patients with high levels of gamma delta T cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Purified , recombinant MZF 1 proteins containing either the first set of zinc fingers or the second set were prepared and used to affinity select DNA sequences from a library of degenerate oligonucleotides by using successive rounds of gel shift followed by PCR amplification . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This observation was especially striking in 32D cells because , upon signal stimulation , they mobilized a substantial set of IL 2 DNA binding activities , as measured by in vitro assays using nuclear extracts . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We constructed a set of four analogous shuttle vectors with these four markers , using DNA segments flanking the Leishmania major H region hmtxr gene to provide information required for expression . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Conversely , the PKC stimulation in the late G 1 phase completely inhibits DNA synthesis , the activation of cyclin dependent kinases , and the mRNA expression of the same set of molecules except cyclin D 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By using DNA sequence data from IS 901 and M . avium DNA , a set of polymerase chain reactions were developed for the specific detection and differentiation of these subtypes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In particular , given a set of hybridizing probes , and the empirically derived rates of false positive and false negative hybridization , we can estimate the most likely DNA fragment to have produced the set of probes , and then estimate the probability that it generated the hybridization data . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A suitable set of criteria is also derived that offer an objective approach to the determination of a match from two DNA samples . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Family studies showed that all MHC class 2 beta chain genes detectable in the genome of Xenopus laevis segregate with serologically defined MHC haplotypes , suggesting that the second , inactivated set of MHC class 2 beta chain genes was either deleted or that their sequences diverged too far to be detected by DNA hybridization . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In any single tumour sample only one repeat in the set examined was abnormal , the remainder showing identical patterns in normal and tumour DNA or evidence of allele loss . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA extracted from 126 pure mycobacterial cultures isolated from clinical specimens was amplified by nested PCR with use of a novel set of oligonucleotide primers specific for the 65 kDa antigen gene of mycobacteria . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of carboxy terminal deletion mutants of Saccharomyces cerevisiae DNA topoisomerase 2 were constructed for studying the functions of the carboxyl domain in vitro and in vivo . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The ss DNA must be complementary to the set of mutation specific oligonucleotides . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sequencing of a 5 . 4 kb segment of the cloned DNA revealed a set of five gris open reading frames ( ORFs ) , corresponding to the act PKS genes , in the following order : ORF 1 for a ketosynthase , ORF 2 for a chain length determining factor , ORF 3 for an acyl carrier protein , ORF 5 for a ketoreductase , and ORF 4 for a cyclase dehydrase . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results establish a functional analogy between the POUS and prokaryotic helix turn helix elements and suggest that their DNA specificities may be governed by a shared set of rules . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here , we used overlapping complementary DNA ( cDNA ) clones for reconstruction to express full length recombinant NSE , and also to express a set of cloned subfragments through the prokaryotic expression vectors pUEX and pUBEX . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genetic diagnosis of 13 alleles of HLA DQB 1 ( 0501 , 0502 , 5031 , 5032 , 0601 , 0602 , 0604 , 0201 , 0301 , 0302 , 3032 , 0401 and 0402 ) from 65 human DNA samples was achieved by applying single strand conformation polymorphism ( SSCP ) analysis to DNA fragments amplified by the polymerase chain reaction ( PCR ) using a convenient primer set for DQB 1 ( recommendation of the International Histocompatibility Workshop , 1991 ) . ^^^ This primer set amplifies not only DNA fragments belonging to DQB 1 , but also to DQB 2 , and classification of 3 phenotypes ( 1 . 1 , 1 . 2 and 1 . 1 / 1 . 2 ) in the presence of two alleles at the latter locus was suggested . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
MF PCR SSCP is superior to the current PCR SSCP in several ways : it does not involve radioactivity , migration patterns are standardized to internal standard DNA markers , there is a strict temperature controlling system and the higher percentage of the gel enables better separation with resultant 100 % detection of mutations most likely under one set of electrophoresis conditions . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The results obtained may be useful for DNA sequencing by hybridization with a set of oligonucleotides . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A significant issue in the analysis of any genomic DNA segment is the generation of a unique set of short single copy sequences that are representative of that region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We report here the construction of a genetic linkage map and an overlapping set of clones containing DNA markers linked to the causative locus for facioscapulohumeral muscular dystrophy ( FSHD ) on 4q35 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We used a set of disintegration substrates to study the catalytic mechanism of HIV 1 integrase and the interaction between the protein and the viral and target DNA sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The similarities in traits of EBNA 1 that are required for support of DNA replication and retention of plasmid DNA indicate that both may be mediated by interactions with an overlapping set of cellular proteins . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a set of primers specific for the amplification of a 435 bp region of the IE 1 gene , we detected CMV DNA in blood leucocytes of a kidney transplanted patient who received the transplant from a CMV seropositive donor , 45 days after the operation , while the antibody titre showed no evidence of active CMV infection . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Between 4 and 8 person days were required to obtain results from each set of 5000 samples by DNA hybridization , whereas microscopic examination required 150 person days . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have inserted d ( C ) 10 in a set of DNA fragments with bent segments on both ends , which are rotated with respect to each other by base pair wise increasing insertions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Mitochondrial diseases are uniquely interesting from a genetic point of view because mitochondria contain their own DNA ( mtDNA ) and are capable of synthesizing a small but vital set of proteins , all of which are components of respiratory chain complexes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The fingerprints generated by hybridizing tomato minisatellites to genomic DNA of a set of cultivars were , in two cases , more variable than those obtained with 33 . 6 or 33 . 15 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Gene regulation by steroid hormones is mediated by binding of the hormone ligand to the corresponding receptor that triggers a complex set of interactions of the hormone receptors with each other , with DNA in chromatin , and with a variety of other proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For this purpose , we constructed a recombinant DNA molecule which could be amplified by the same set of primers used for HCMV DNA amplification . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Characterization of a set of integration host factor mutants deficient for DNA binding . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This set includes all of the virus genes essential to initiate and perform DNA synthesis together with the virus genes required to express these replication functions from their native promoters . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The polymerase chain reaction ( PCR ) procedure using a primer set derived from a repetitive deoxyribonucleic acid ( DNA ) sequence specific to Plasmodium falciparum was used to detect parasite DNA in mosquitoes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Another component of the program is to analyze the DNA of a set of nonhuman model organisms to provide comparative information that is essential for understanding how the human genome functions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In contrast to previously described mammalian POU domain proteins , Brn 3 . 0 binds relatively ineffectively to known octamer DNA motifs , but instead binds with high affinity to a distinct set of DNA elements , functioning as a transcriptional activator . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA extracted from biopsies , however , yielded positive polymerase chain reaction ( PCR ) products in all cases with one primer set of the protein kinase 66 ( PK 66 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A 3 . 9 kb DNA region of Xanthomonas campestris pv . campestris that is necessary for lipopolysaccharide production encodes a set of enzymes involved in the synthesis of dTDP rhamnose . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Southern blots of S . putrefaciens DNA with use of etrA as a probe revealed the expected etrA bands and a second set of hybridization signals whose genetic and functional properties remain to be determined . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A nested set of DNA fragments from the LIF gene 5 ' flanking region was placed upstream of the chloramphenicol acetyltransferase ( CAT ) gene and assayed for their ability to direct chloramphenicol acetyltransferase ( CAT ) expression in STO fibroblasts . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The PCR assay was optimized and , after 40 cycles of amplification with primer set 2 , demonstrated a sensitivity of 10 ( 17 ) g of DNA , which corresponds to the detection of one copy of the plasmid . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using millipore filters , primers and nucleotides are removed and this purified PCR product can then be subjected to a second set of fluorescent primers in the generation of nucleotides in the auto cycle reactions for automated DNA sequencing . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This study demonstrates that microsatellites provide a powerful set of DNA markers for loss of heterozygosity on archival specimens . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Tissue sections were prepared , and then DNA was extracted and subjected to 40 cycles of amplification using Thermus aquaticus DNA polymerase and a set of degenerate primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Each tumour was screened for numerical aberrations with a defined alphoid repetitive DNA probe set containing DNA probes specific for chromosomes 1 , 7 , 15 , and Y . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sf 9 cells , which are permissive for AcNPV , were first cotransfected with genomic AcNPV DNA and a complete or incomplete set of BmNPV restriction fragments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of sense and antisense oligomeric DNA primers were constructed from nucleotide sequences of the conserved region of the genome of several different flaviviruses . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The allele specificity of each set of primers was first tested separately using DNA samples from 15 individuals previously typed for the DRB 1 , DQB 1 , and DQA 1 loci using the sequence specific oligonucleotide ( SSO ) technique . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Distantly located VH segments flanked by a cluster of DNA fragments hybridized by the same set of probes were highly homologous to each other , providing evidence for recent frequent duplication and translocation throughout the locus . ^^^ DNA fragments detected by the same set of probes were orientated with the same 5 ' to 3 ' order within the cluster , suggesting little involvement of inversion upon recombination in the locus . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In addition , a completely separate set of binding centers recognizing and enzymatically converting DNA of superhelical density below 0 . 04 can be titrated . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This study describes the use of a newly constructed set of primers that amplifies an 85 base pair ( bp ) segment of Borrelia burgdorferi chromosomal DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results show that it will now be possible to define the set of AcMNPV genes necessary and sufficient for DNA replication . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA samples obtained from 252 unrelated individuals were screened by PCR using Taq DNA polymerase and a DRB 1 group specific PCR primer set that amplifies the polymorphic second exon of DR 3 , DR 11 , and DR 6 DRB1 alleles . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Human 293S cells were transfected with a set of human chromosomal DNA fragments of 8 15 kilobase pairs that were cloned on an Escherichia coli plasmid vector . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The intact Ca 3 probe and the three largest EcoRI fragments , A , B , and C , were individually used to probe Southern blots of EcoRI digested DNA of a set of test strains , transverse alternating field electrophoresis separated chromosomes of strain 3153A , and Northern ( RNA ) blots of test strain 3153A . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
PAH DNA adduct levels have also been determined by competitive ELISA in the second set of DNA samples . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The p 53 protein can bind to a set of specific DNA sequences , and this may activate the transcription of genes adjacent to these DNA elements . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 13 rules is proposed aimed at facilitating the classification of a DNA sequence as a matrix attachment region . ( ABSTRACT TRUNCATED AT 250 WORDS ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Recently , we demonstrated that a nested set of DNA fragments can be obtained by using one specific primer and one semirandom primer in a polymerase chain reaction ( PCR ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A common set of conserved motifs in a vast variety of putative nucleic acid dependent ATPases including MCM proteins involved in the initiation of eukaryotic DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A combination of calorimetric and spectroscopic techniques was used to evaluate the thermodynamic behavior of a set of DNA hairpins with the sequence d ( GCGCTnGCGC ) , where n = 3 , 5 and 7 , and the interaction of each hairpin with ethidium . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of primers corresponding to mapped RAPDs distributed throughout the genome and in coupling phase with respect to the wild type parent is then used to amplify DNA from wild type and mutant pools of F 2 individuals . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An isogenic set of gonococcal lipooligosaccharide ( LOS ) mutants derived from pyocin treatment of Neisseria gonorrhoeae 1291 was used to identify cloned gonococcal DNA fragments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A nested set of degenerate PCR primers designed from regions conserved among yeast , Xenopus , and human PABP sequences was used to amplify genomic DNA fragments from Arabidopsis thaliana . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A single set of polymerase chain reaction primers was used to amplify sequence from both AT1A and AT1B from rat genomic DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have identified a minimal set of functional integrase domains that are sufficient for 3 ' processing and DNA strand transfer and find that some domains are contributed in trans by separate monomers within the functional complex . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of primer sequences within a Bordetella pertussis specific repetitive element was used to amplify proteinase K extracts of B . pertussis DNA recovered from 279 submitted slides inoculated at the point of collection with nasopharyngeal material obtained from pernasal swabs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results suggest that DNA aneuploidy can arise by two different mechanisms : 1 ) loss or gain of chromosomes leading to hypodiploid or hyperdiploid tumors with no apparent increase in DNA content instability , and 2 ) doubling of the chromosome set followed by random loss of chromosomes as suggested by the DNA indices ranging from tetraploid to triploid region found in three tumors . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To investigate the interaction of the VirD 1 , D 2 endonuclease with a right T DNA border , a set of plasmids containing both the border and virD sequences on the same high copy number replicon has been constructed and introduced into Escherichia coli . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We developed a polymerase chain reaction ( PCR ) , using very small amounts of parasite DNA and an oligonucleotide set according to parts of the DNA sequence of a beta tubulin gene from Haemonchus contortus , that can discriminate H . contortus DNA and Trichostrongylus colubriformis DNA from each other and from several other sheep nematode parasites . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The sensitivity of the test varied for different allelic markers as evaluated by amplification of DNA from each set of a mixture of lymphocytes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A first set of primers , corresponding to conserved nucleotide sequences between mouse and human DNAs , allowed us to amplify by polymerase chain reaction ( PCR ) intron 1 / exon 2 fragments from genomic DNA of the hamster , cat , lion , dog , horse , sheep , dolphin , and pig . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We isolated a large number of cosmids by screening a chromosome 4 specific cosmid library with labeled DNA from a minimal overlapping set of YAC clones . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A structural interpretation of this set of new footprinting data in view of previous results and data is presented and discussed in terms of a refined model in which the protein DNA interaction between the ICR and the three N terminal fingers corresponds closely to that observed in the homologous three finger zif 268 : DNA complex , whereas the basic mode of protein DNA interaction , in which the pair of fingers 4 and 5 is engaged in forming the TFIIIA : ICR complex is of an entirely different , albeit not yet understood nature . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In another set of experiments , comparison of complete or partial DNA sequences of the envelope genes from six recombinant proviruses confirmed that the origins of the sequences that encode an amino terminal region of the TM envelope protein , p15E , distinguish type 1 envelope genes from type 2 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The nucleotide sequence of two subclones designated HS and G 19 , contiguous within Eco RI fragment G , was determined for each strand by obtaining a nested set of deletion clones of these double stranded DNA plasmids . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To study the helper mechanism at the molecular level , we established a complete cosmid library of HVT DNA in a set of seven overlapping clones and transiently cotransfected secondary chicken embryo fibroblast ( CEF ) cells with AAAV DNA and recombinant cosmids ( cBL ) ( individual as well as in different combinations ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A homologous set of plasmids expressing tet , lacY , and melB , genes encoding integral cytoplasmic membrane proteins , and tolC and ampC , genes encoding proteins for export through the cytoplasmic membrane , was constructed for studying the effects of transcription and translation of such genes on the hypernegative supercoiling of plasmids in Escherichia coli cells deficient in DNA topoisomerase 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Even greater amplification ( approximately 10 ( 12 ) fold ) with enhanced specificity can be obtained by a second set of amplification cycles using a further pair of ' nested ' primers sited within the DNA sequence defined by the original primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It has been reported that such chromatin domains are formed by loops of the 30 nm fibers anchored to the nuclear matrix by a complex set of proteins , including DNA topoisomerase 2 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The PMS 1 transcript showed the same cell cycle periodicity as those of a set of DNA replication genes that includes POL 3 , suggesting PMS 1 is co regulated with these genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thus , it will now be possible to define the set of HCMV genes necessary and sufficient for initiating and performing lytic phase DNA synthesis as well as to identify those virus genes needed for their expression in human fibroblasts . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The integrase protein of human immunodeficiency virus type 1 carries out a set of polynucleotidyl transfer reactions that result in the covalent attachment of the retroviral cDNA to host DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An Exo gap method for producing a nested set of unidirectional deletions in a piece of cloned DNA is described . ^^^ After size fractionation by agarose gel electrophoresis , the DNA from the melted gel slices is ligated and transfected into host cells to produce a set of plasmids that contain a unidirectional nested set of deletions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 17 pentanucleotide sequences derived from those sites observed to be broken in the viral DNA extracted from SV 40 infected cells define an in vivo consensus sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Polymerase chain reaction ( PCR ) was carried out for 35 cycles with a set of primers that bracketed a 92 base pair segment unique to the HSV DNA polymerase gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To demonstrate the applicability of RS PCR in retrieving unknown sequences around a known sequence , we have used a set of four RSOs and three specific primers representing the known sequence and have successfully obtained hitherto unknown factor 9 sequences ( 12 of 12 times ) from three species starting from genomic DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These data provide a mechanism for selective receptor recognition of a restricted set of target sequences in DR DNA and explains the structural basis for physiological specificity . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The usefulness of the Y linked tetranucleotide repeat locus Y 27H39 in deficiency cases was evaluated in a set of 41 families that had a deceased alleged father and that had been tested at GENE / MG with multilocal and unilocal DNA fingerprinting probes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This is similar to and characteristic of spherical proteins , contrasting with the concave plot typical for linear and bent DNA . ( 3 ) The effective size of the nucleosome , evaluated in terms of an `` equivalent sphere ' ' ( i . e . a hypothetical spherical particle with a radius , Res , having the same electrophoretic mobility as DNA for a particular set of experimental conditions ) , remains invariant across the gel concentration range of 3 9 % T . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set contained DNA sequences that complemented only an entD mutation . ^^^ The second set contained DNA sequences that complemented various combinations of entB , entE , entC , and entA mutations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Directional mutation theory predicts that when the mutational bias between A / T and G / C nucleotide pairs is equilibrated with the base composition of a neutral set of DNA nucleotides , the mutation frequency per gene will be much lower than the frequency immediately after the mutator mutation takes place . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Previous work has shown that nucleosome repeat lengths , and hence linker DNA lengths , are preferentially quantized to a set of values differing by integral multiples of the helical twist of DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An attempt was made to assign mouse lifespan associated interstrain differences in DNA repair to a specific chromosomal region using a set of congenic mice . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In an attempt to further localize the point in the cell cycle where arrest occurred , a set of key regulatory events leading to the G1 / S boundary were examined , including p110Rb phosphorylation , which occurred at least 6 hr prior to DNA synthesis , p34cdc2 synthesis , and cyclin A synthesis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Most NMR studies of DNA oligomers have focused on rigid structures that show a strong preference for one or a small set of ground state conformations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DAF uses single , short , oligonucleotide primers of arbitrary sequence to direct amplification of a characteristic set of DNA products by a thermostable DNA polymerase in a thermocycling reaction . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We report here on the first set of ten such families , eight of which were identified through a proband with sarcoma . p 53 exons 5 to 8 have been sequenced following polymerase chain reaction amplification performed on DNA isolated from total blood . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA flow cytometry histograms and clinical follow up information from 796 breast cancer patients were used to train a Neural Network to predict the clinical outcome of patients in a separate independent set of 794 patients . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sixty nine Staphylococcus aureus isolates from two epidemiologically unrelated sources were typed by pulsed field gel electrophoresis after SmaI digestion of chromosomal DNA ( genome typing ) , and the results were compared with those obtained by other typing methods : phage typing with the international set of phages , capsular serotyping with monoclonal antibodies against capsular polysaccharides type 5 and 8 , and zymotyping by polyacrylamide agarose electrophoresis for esterase polymorphism . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We used the polymerase chain reaction and a primer / probe set specific for a region in the gene for the 65 kd antigen of M . tuberculosis to search for M . tuberculosis complex DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To further understand the relationship between the structure of UL 42 and the role that it plays during virus replication , we analyzed an extensive set of mutant UL 42 proteins for the ability to perform the three major biochemical functions ascribed to the protein : binding to DNA , stably associating with the virus DNA polymerase ( Pol ) , and acting to increase the length of DNA chains synthesized by Pol . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Identification of the entire set of transferred chloroplast DNA sequences in the mitochondrial genome of rice . ^^^ The entire set of transferred chloroplast DNA sequences in the mitochondrial genome of rice ( Oryza sativa cv . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using polymerase chain reaction and a set of primers that detects complete or nearly complete proviral DNA , HIV 1 provirus could be found as early as 5 hr after infection in CEM 174 cells and peripheral blood lymphocytes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our results provide evidence that both the male specific and female specific doublesex proteins share and depend upon the same DNA binding domain for function in vivo , suggesting that both proteins bind to , but differentially regulate , a common set of genes in both sexes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A large group of patients with node positive breast cancer was divided into a training set ( n = 851 ) and a validation set ( n = 432 ) to demonstrate techniques for integrating steroid hormone receptor status , DNA flow cytometric findings , and other prognostic factors to predict patient survival . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have engineered yeast genomic DNA to construct a set of strains producing various relative amounts of yeast NADPH P 450 reductase ( Yred ) and human cytochrome b 5 ( Hb 5 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
PCR amplified DNAs from four individuals were subjected to a single base specific sequencing reaction and the products were applied to a set of four lanes of an automated DNA sequencer . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Family studies showed that all MHC class 2 beta chain genes detectable in the genome of 10 . laevis segregate with serologically defined MHC haplotypes , suggesting that the second , inactivated set of MHC class 2 beta chain genes was either deleted or that their sequences diverged too far to be detected by DNA hybridization . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Primer set 821U / 821D1 amplified a 200 bp DNA fragment , and primer set 821U / 821D2 amplified a 1 . 2 kb DNA fragment in all t ( 8 ; 21 ) positive AML tested . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Identification of three residues in the basic regions of the bZIP proteins GCN 4 , C / EBP and TAF 1 that are involved in specific DNA binding . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of energetic parameters of DNA secondary structures has been chosen for calculation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The HMG box is defined by a set of highly conserved residues ( most distinctively aromatic and basic ) and appears to define a novel DNA binding structural motif . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An experimentally derived data set constructed for testing large scale DNA sequence assembly algorithms . ^^^ A data set consisting of DNA sequences from a large scale shotgun DNA cloning and sequencing project has been collected and posted for public release . ^^^ The purpose is to propose a standard genomic DNA sequencing data set by which various algorithms and implementations can be tested . ^^^ This set of data is divided into two subsets , one containing raw DNA sequence data ( 1023 clones ) and the other consisting of the corresponding partially refined or edited DNA sequence data ( 820 clones ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Evidence for the somatic stability of this locus was obtained from a set of experiments where we compared DNA profiles from corresponding blood , semen and saliva samples . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of four calibration DNA fragments was constructed that contained zero , two , four , or six phased A tracts in their centers and an EcoRV site at the 5 ' end to account for the electrophoretic influence of the bound protein . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This study reports the detection and localization of a discrete set of DNA fragments in the ADA amplicon which label soon after release of synchronized B 1 / 50 cells into S phase . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By sequencing a cosmid DNA clone of L . tarentolae genomic DNA , we have identified a 1 . 5 kb subclone encoding a duplicate set of the closely linked tRNA ( Tyr ) ( GTA ) and tRNA ( Thr ) ( AGT ) genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Acyclic analogs of 2 ' , 3 ' dideoxy 2 ' , 3 ' didehydronucleoside 5 ' triphosphates terminators of DNA synthesis , catalyzed by a broad set of DNA polymerases ] . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
That application of the extended program yields the following results : ( 1 ) The size of migrating DNA can be compared with an equivalent sphere having the same free mobility for a particular set of experimental conditions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have developed a set of tools , genfrag , to fragment and optionally mutate a DNA sequence to generate benchmark data sets for testing DNA sequence assembly algorithms . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 25 temperature sensitive strains , which had been localized to regions of the coat gene ( Casjens , S . , Eppler , K . , Sampson , L . , Parr , R . , and Wyckoff , E . ( 1991 ) Genetics 127 , 637 647 ) , define 17 sites of single amino acid substitutions by DNA sequencing . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The factor stimulating Ad core DNA replication , designated as template activating factor 1 ( TAF 1 ) , was purified by successive steps of ammonium sulfate precipitation , column chromatographies on phosphocellulose and Q Sepharose , and glycerol density gradient centrifugation . ^^^ TAF 1 stimulated both initiation and elongation in Ad core DNA replication . ^^^ These findings suggest that TAF 1 stimulates Ad core DNA replication by interaction with viral basic core proteins . . ^^^ Template activating factor 1 , a novel host factor required to stimulate the adenovirus core DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Primer specificity was corroborated by examining 2 DNA data banks , testing against DNA from other organisms , and confirming results with a second set of nested primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA topology and a minimal set of basal factors for transcription by RNA polymerase 2 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Running a nested polymerase chain reaction ( PCR ) with a primer set specific for the flagellin gene of B . burgdorferi enabled us to demonstrate the presence of Borrelia DNA in skin biopsies of patients with morphea ( nine of nine ) of LSA ( six of six ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of transgenic yeast strains containing appropriately spaced 1 Sce 1 sites within the YAC insert defines a series of nested physical intervals against which new genes , clones or DNA fragments can be mapped by simple hybridisation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A nested set of L . lactis chromosomal fragments cloned onto pG+host5 were used to show that the single crossover integration frequency was logarithmically proportional to the length of homology for DNA fragments between 0 . 35 and 2 . 5 kb . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sequences in the cDNAs undergo homologous recombination with the corresponding exons in the genomic DNA yielding a set of truncated YACs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The prognostic value of a set of clinicopathologic factors and DNA ploidy were examined in 74 patients with surgically resected squamous cell carcinoma of the lower and middle third of the esophagus . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The set of cDNAs obtained extends the range of DNA probes that are available for identifying VSMCs and characterizing their phenotype in vivo by in situ hybridization . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analysis of the binding of Lrp to a set of circularly permuted DNA fragments from this region indicates that Lrp induces DNA bending . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The solution structure of a specific DNA complex of the minimum DNA binding domain of the mouse c Myb protein was determined by distance geometry calculations using a set of 1732 nuclear Overhauser enhancement ( NOE ) distance restraints . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To provide additional tools for molecular genetic analysis , we have developed a set of vectors for DNA transformation in Tg based on selection with the antibiotic phleomycin ( Ph ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Among these is a set of six interactions connecting proteins that function in DNA replication and DNA packaging . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An enzyme with bound DNA can admit a second DNA duplex through one set of jaws , transport it through the cleaved first duplex , and expel it through the other set of jaws . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The oligonucleotide primer set , designed from the p33 / 34 genes , was specific for these Theileria species , since no amplification was detected with DNA from Babesia ovata , B . bovis , Anaplasma marginale , A . centrale , Eperythrozoon wenyoni , bovine white blood cells , and uninfected tick salivary glands . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These studies provide further evidence that the immune system responds to CpG motifs in bacterial DNA by activating a coordinated set of humoral and cellular responses . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The first set of experiments included typical validation studies that had previously been conducted on forensic DNA markers , such as : chemical contaminant effects on DNA from blood and semen and the effect of typing DNA extracted from body fluid samples deposited on various substrates . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of PCR primers was designed based on the DNA sequence of a D . immitis surface antigen gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Workshop participants agreed that the risk category of a patient may be modified by prognostic factors in addition to age and WBC count criteria , and that a common set of prognostic factors should be uniformly obtained , including DNA index ( DI ) , cytogenetics , early response to treatment ( eg , day 14 bone marrow ) , immunophenotype , and CNS status . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a parallel set of experiments , we have determined the in vitro effects of these pesticides on the DNA SSB and enhanced lactate dehydrogenase leakage ( LDH ) from neuroactive PC 12 cells in culture . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This set of primers selectively amplifies a 780 base pair DNA fragment within the 16S rRNA gene of MG , MS , and MI but does not amplify other avian mycoplasmas or other bacteria . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This p 16 dependent regulation affects a set of enzymes necessary for the activation of all four DNA precursors ; it is paralleled by the interconversion of transcriptionally active free E2F and transcriptionally inactive higher molecular complexes of E2F and is dependent on the existence of endogenous pRb . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using endonucleases BcoKI and Bli 7361 recognizing sequences CTCTTC and GGTCTC and producing three and four nucleotide 5 ' termini , respectively , it has been shown that amplification of a set of fragments occurs only when the adapters are attached to DNA fragments with DNA ligase . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When yeast cells reach a critical size in late G 1 they simultaneously start budding , initiate DNA synthesis , and activate transcription of a set of genes that includes G 1 cyclins CLN 1 , CLN 2 , and many DNA synthesis genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a set of general primers derived from the E 1 open reading frame , which anneal to a large variety of human papilloma virus DNA , we can classify samples into positive or negative for the presence of HPV sequences in a single step . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A unique restriction site in the DNA encoding the flexible linker between the third lipoyl domain and the binding domain combined with timed digestion with exonuclease Bal 31 was used to create a set of deletion mutants in the N terminal region of the binding catalytic didomain , fused to six N terminal amino acids from beta galactosidase . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 21 characteristics are deduced or proposed for MAR / ORI sequences including their enrichment in inverted repeats , AT tracts , DNA unwinding elements , replication initiator protein sites , homooligonucleotide repeats ( i . e . , AAA , TTT , CCC ) , curved DNA , DNase 1 hypersensitive sites , nucleosome free stretches , polypurine stretches , and motifs with a potential for left handed and triplex structures . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this study , a PCR primer set specific for these newly identified rodent parvoviruses was designed on the basis of DNA sequence comparisons of these isolates with other autonomous parvoviruses . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The central component of the database stores information about yeast artificial chromosomes ( YACs ) , each containing a segment of human DNA from chromosome 12 to which genome markers have been mapped , such that an overlapping set of YACs ( called a `` contig ' ' ) can be identified , along with an ordering of the markers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Blackberry seedlings , obtained by pollinating various species as well as interspecific hybrids with pollen from yet other species , were successfully evaluated with DNA fingerprinting to determine the relative proportions of the apomictic and sexual seed set . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Second , the presence of developmentally excisable DNA segments , i . e . , of rearrangement sites , was examined in the same set of species at a number of unique loci . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A 0 . 5 kb fragment of chicken DNA methyltransferase cDNA was PCR amplified using a set of degenerate primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The set of resultant DNA cleavage products involves two main types of DNA fragments sized about 50 100 kb and 300 500 kb , being of the same type in various eukaryotic representatives . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here , we provide sequences for a set of PCR primers sufficient to screen the entire coding sequence of BRCA 2 using genomic DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The target DNA fragment is cloned in the multiple cloning site of a cloning vector , pUC or its derivatives , and amplified by PCR using a set of primers , one of which is 5 ' biotinylated . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In nine benign and malignant melanocytic skin tumors , the method provided a set of reproducible DNA fingerprints . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When the mutation was transferred into a set of recombination deficient and repair deficient strains , the DNA repair and recombination ability of the double or triple mutant strains was drastically reduced . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We now report the sequence of the gene which is 2100 bp long and the development of a set of primers to amplify and sequence the gene from patients ' DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results suggest that the chromosome sets in somatic cell hybrids may be randomly contaminated with small DNA segments derived from either set of chromosomes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The first set of derivatives gives rise to UV induced cross linking which may be revealed by alkali / heat treatment ; the second leads to direct DNA cleavage in the proximity of the derivatized amino acid . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA polymerase gene appeared to be interchangeable in this assay ; both the AcMNPV and OpMNPV DNA polymerase supported high levels of replication of an origin containing reporter plasmid when substituted for their homologue and cotransfected with a set of heterologous essential and stimulatory replication genes into uninfected insect cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These three probes complete the set required for distinguishing all known members of the An . punctulatus complex by DNA hybridization . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Similar DNA binding specificities of Escargot and Snail suggest that they control the same set of genes required for wing development . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
CELO virus encodes two fiber proteins and a different set of the DNA packaging core proteins , which may be important in condensing the longer CELO virus genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A second set of simulations was based on this structure as well , except that the DNA segment was altered to the consensus glucocorticoid response element ( GRE ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Molecular analysis of the father ' s DNA confirmed an intact set of alpha genes ( alpha alpha / alpha alpha ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Detection of beta thalassemia mutations was performed by dot blot hybridization of the amplified DNA with a set of HRP labeled ASO probes specific for the common mutations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Recent biochemical and crystallographic results suggest that a type 2 DNA topoisomerase acts as an ATP modulated clamp with two sets of jaws at opposite ends : a DNA bound enzyme can admit a second DNA through one set of jaws ; upon binding ATP , this DNA is passed through an enzyme mediated opening in the first DNA and expelled from the enzyme through the other set of jaws . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA sequence of several functional mutants was determined for each set of random mutants . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One primer of each primer set has a 3 ' nucleotide complementary to the DNA sequence coding for one allele . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In mammalian cells , the tumour suppressor protein p 53 plays a central role in a DNA damage induced cell cycle checkpoint pathway by induction of transcription of a set of gene products that have a direct role in a DNA damage induced cell cycle growth arrest . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thus , mismatch repair deficiency is rare in breast cancer , is most likely caused by somatic mutations , and possibly in a set of DNA repair genes different from that involved in the HNPCC syndrome . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The small amount of DNA extract ( up to 5 % ) required for specification is promising for the successful application of a set of short tandem repeat ( STR ) systems for individualization in humans . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This set of plasmids , whose integration efficiencies are as good as those obtained with the prototype plasmid pBRINT , constitutes a collection of tools that allow rapid and easy integration of cloned DNA , at the chromosomal level . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Previous studies in our laboratory used a papillation assay to identify a set of mutations in the E . coli dnaE gene that confer increased accuracy of DNA replication ( antimutators ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This approach involves a series of enzymatic steps for capturing a set of short dispersed sequence markers scattered throughout a high molecular weight DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This finding indicated that a similar set of ZRE sites is involved in DNA replication and transcriptional activation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To facilitate an understanding of the forces that govern 5S rDNA evolution , copy number estimation and DNA sequencing were conducted for a phylogenetically well characterized set of 16 diploid species of cotton ( Gossypium ) and 4 species representing allopolyploid derivatives of the diploids . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Intramolecular recombination of a mitochondrial minicircular plasmid like DNA of date palm mediated by a set of short direct repeat sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the present study we have constructed a set of deletion promoter constructs to more closely define the DNA elements that are responsible for m 4 gene expression . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA fragments consisting of highly repetitive genomic sequences were detected as a set of bands corresponding to fragments between 30 and 500 bp in length . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This set of clones , contigs , and associated STSs will provide the material for the production of a continuous overlapping set of YACs as well for high resolution physical mapping based upon sampled and complete DNA sequencing . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Boron modified nucleic acids comprise a new set of DNA mimics that have potential biological and therapeutic applications . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
However , only 6 of 13 high affinity antibodies to DNA are derived from this set of low affinity VHs , indicating that DNA is unlikely to be the driving antigen . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thus , although the Ruminantia / Suiformes grouping is indeed least likely from Graur and Higgins ' data set of mitochondrial DNA , this traditional tree can not be rejected with statistical significance under the new analysis , and more data are needed to settle the issue . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The map positions of a set of eight T DNA insertions in the Arabidopsis genome have been determined by using closely linked visible markers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We tested this procedure using a set of 32 different 3 hexamer primer strings , each known to be functional to some degree in radioisotopic sequencing , on single stranded M13mp18 template and ABI 373 DNA sequencers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The Large Fragment Study was efficiently accomplished through the use of a designed set of DNA samples , requiring but one gel in each of 20 participating laboratories . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Cervical cytology by means of fluorescence in situ hybridization with a set of chromosome specific DNA probes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genetic control of mutagenesis by the base analog 6 N hydroxylaminopurine ( HAP ) was studied in a set of isogenic yeast strains carrying null or point mutations in DNA repair and replication genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The results illustrate how zinc fingers may be evolving to recognize an unusually diverse set of DNA sequences . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
However , the lack of a species DNA probe or PCR primer set , their relatively poor availability , and unknown comparative sensitivity and specificity have precluded their routine and widespread use as identification tools in many laboratories . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Inasmuch as only a 1 % DNA base sequence change is expected in 10 million years under the standard spontaneous mutation rate , 1 propose that all those diverse animals of the early Cambrian period , some 550 million years ago , were endowed with nearly identical genomes , with differential usage of the same set of genes accounting for the extreme diversities of body forms . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
From analysis of this database and study of variations in twist parameter ( Tw ) values , as an indicator of sequence dependent variations in B DNA helix , a method is developed to fix the codon among the set of synonymous codons . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A phylogenetic analysis of a select set of Azteca ants , including six Cecropia inhabitants and two non Cecropia inhabitants , plus an outgroup taxon , is presented on the basis of mitochondrial DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
However , the development of clinically useful microbial DNA / RNA probes requires nucleotide sequence information and a set of well defined reference organisms for test validation in comparison with the current gold standard . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using the theoretical model for DNA curvature , we analyzed a set of fragments with a curved insert located in circular permutation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This set of YACs and markers will serve as DNA sources for the identification of the Lc gene . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Although the results are somewhat higher with Fr2A , this technique needs well preserved DNA and it can be an important set back when we deal with formaldehyde fixed , paraffin embedded tissues . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
S 1 proteins A D constitute a nuclear protein family that are liberated rapidly in a set from chromatin by mild digestion with a DNA or RNA hydrolyzing enzyme . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thus , the peripheries of ND 10 represent preferred sites where early steps of transcription and replication of at least three DNA virus families take place , suggesting a new set of functional properties for this large nuclear domain . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We synthesized a set of four biotinylated dideoxynucleoside triphosphates ( biotin 9 ddNTPs ) and optimized the reaction conditions for non radioactive cycle sequencing using modified Tth DNA polymerase ( delta Tth ) and a chemiluminescent detection system . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Initiation of hepatocyte DNA synthesis is preceded by the activation of the set of early growth response genes mediated by enhanced nuclear factor kappa B binding to DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set of primers based on the IS 6110 sequence of M . tuberculosis was used to amplify a 457 bp fragment of DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
All three elements are GC rich , redundant sites for a complex set of DNA binding proteins that includes SP 1 , other proteins that bind to an SP 1 consensus site and proteins that bind to a Krox consensus site . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In search of microdeletions , we have screened the DNA of 30 unrelated patients with XLRP by employing a representative set of YAC derived DNA fragments that were generated by restriction enzyme digestion and PCR amplification . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When a C . orbicularis specific 16S rDNA ( DNA encoding rRNA ) primer is used with a bacterium specific 16S rDNA reverse primer in amplifications by PCR , the primer set was unsuccessful in amplifying symbiont DNA targets from ovaries , eggs , veligers , and metamorphosed juveniles ( 600 microns to 1 mm in shell length ) cultivated in sterile sand , whereas successful amplifications were obtained from gill tissue of adult specimens and from metamorphosed juveniles ( 600 microns to 1 mm in shell length ) cultivated in unsterilized sea grass bed sand . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The results of the phenotypic characterization analysis , G+C content analysis , and phylogenetic analysis of the 16S ribosomal DNA sequence set strain B 316 ( T ) apart from all of the members of cluster XIVa . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A hierarchical set of five 16S rRNA targeted oligonucleotide DNA probes for phylogenetically defined groups of autotrophic ammonia and nitrite oxidizing bacteria was developed for environmental and determinative studies . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of primers was selected from the base sequence of the Pst 1 fragment of T 9210 chromosomal DNA and used for PCR detection of T 9210 . ^^^ PCR using a Pst 1 1 primer set made it possible to detect 100 fg of T 9210 DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a set of reduced coordinates and a least squares fitting procedure , we have developed a method to predict structures for B DNA duplexes based on coordinates of the phosphorus atoms . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA sequences that are involved in the control of gene expression in eukaryotes have been collected in conjunction with the proteins binding to and acting through them ( TRANSFAC data set ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To develop a helper virus free packaging system for these vectors , the DNA cleavage / packaging signals were deleted from a set of cosmids that represents the HSV 1 genome . ^^^ Following cotransfection into cells , this modified cosmid set supported replication and packaging of vector DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Local bending propensity and curvature of DNA can be characterized using a vector description of DNA bendability , based on a set of parameters derived from deoxyribonuclease 1 ( DNase 1 ) cleavage experiments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of PCR primers was designed to amplify a 199 bp salmonella specific DNA fragment derived from a repetitive DNA of Salmonella Weltevreden . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The program discovers regions of similarity amongst any set of DNA sequences and then draws a graphic that summarizes the length , location and relative orientations of any repeated sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Autoantibodies to Ku ( p70 / p80 heterodimer ) , ' stabilizing ' antibodies , and antibodies to DNA PKcs comprise a linked autoantibody set , since antibodies recognizing purified DNA PKcs were strongly associated with stabilizing antibodies , whereas stabilizing antibodies were strongly associated with anti Ku . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Quantitative detection of male DNA by polymerase chain reaction using a single primer set : application to sex determination and counting of rare fetal cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A modified set of oligonucleotide probes for the branched DNA assay was developed to enhance the efficiency of binding to genotypic variants of HCV . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Most of the proteins encoded by the genes from the minimal set have eukaryotic or archaeal homologs but seven key proteins of DNA replication do not . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In another set of controls , we subjected cells to transfection procedures without DNA ( mock transfection ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We assume that the dynamics of large segments of DNA is almost deterministic and can be described by a set of simple mechanical equations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These `` selected conditions ' ' were applied in the SSCP analysis of an arbitrarily chosen set of mutant DNA fragments with single base exchanges , and all but one of seven mutants were detected in the gel system containing glycerol . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In that DNA binding by each HhH motif is facilitated by a metal ion , we set out to determine the identity of the metal ion that most likely binds to the HhH motif in vivo . ^^^ Crystal soaking experiments were performed on human pol beta DNA cocrystals with Mg2+ , Ca2+ , Na+ , and K+ , the four most prevalent metal ions in the cell , and in each case a data set was collected and the resulting structure was refined . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of double stranded oligonucleotides , each with an unique DNA configuration , were synthesized and substituted into an upstream region of the promoter . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Accordingly , the combination of an obligatory ( LBD ) and an optional ( DBD ) dimerization domain imparts a dynamic DNA binding potential to the heterodimerizing receptors that both increases the diversity of the hormonal response as well as providing a restricted set of target sequences in direct repeat elements that ensures physiological specificity . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Under a single optimized set of conditions we were able to obtain a pattern of spots representing all 27 exons of the CFTR gene and to readily detect 17 out of 17 identified sequence variations in 9 different exons in DNA from 11 CF patients and carriers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Previous inferences from epsilon globin gene sequences on cladistic relationships among the 16 extant genera of Ceboidea ( the New World monkeys ) were tested by strength of grouping and bootstrap values for the clades in the most parsimonious trees found : for this epsilon data set enlarged with additional Cebus and Saimiri orthologues ; for another nuclear DNA sequence data set consisting of IRBP ( interstitial retinol binding protein gene ) intron 1 orthologues ; and for tandemly combined epsilon and IRBP sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have constructed a set of isogenic strains to determine whether the DNA polymerases delta and epsilon contribute equally to proofreading of replication errors provoked by HAP during leading and lagging strand DNA synthesis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A simple , rapid , and cost effective protocol has been developed for a PCR based molecular typing method for Candida albicans , which includes the use of a commercially available medium ( Chelex 100 Resin ) for DNA extraction and a single set of two arbitrarily chosen oligonucleotide ( 10 nt length ) primers for random amplified DNA ( RAPD ) analysis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The nuclear matrix or scaffold that can be prepared and investigated in vitro has an affinity for distinct topological forms of DNA and for sequences that permit the induction of such a topology by their association with a corresponding set of proteins ( so called matrix or scaffold attached regions , S / MARS ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A new set of specific ovine primers was chosen to study the polymorphism of this DNA fragment by denaturing gradient gel electrophoresis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our results indicate that Myc Max heterodimers interact in vivo with a specific set of E box related DNA sequences and that Myc is likely to activate multiple target genes including a highly conserved DEAD box protein . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The primer set amplified an approximately 580 bp DNA fragment that included species specific restriction sites , and HapII , HhaI , CelII , HincII , or DdeI digestion of the product resulted in distinctively different PCR RFLP patterns . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of specific CPCR primers derived from a known 72 bp DNA segment of the nifH sequence permitted isolation of both the upstream and the downstream region of Trichodesmium sp . nifH . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These defects are associated with a characteristic set of polymorphic DNA markers in the C6 / C7 region , forming a distinct haplotype . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
If a linear block error correcting code is present in DNA then some bases would be a linear function of the other bases in each set of bases . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the first phase , all forms of overlap data are integrated into a simple abstract structure , called clusters , where each cluster is a set of mutually overlapping DNA segments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For a cross validated standard test set of 304 genes [ ftp : @ www hgc . lbl . gov / pub / genesets ] in human DNA , our gene finding system identified up to 85 % of protein coding bases correctly with a specificity of 80 % . 58 % of exons were exactly identified with a specificity of 51 % . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This network culminates in the transcriptional activation of a set of late competence proteins that mediate DNA binding and uptake during transformation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The results showed one set of loci that coordinately regulated serum levels of IgG antibodies to double stranded DNA , single stranded DNA , total histones , and chromatin , which overlapped with loci that were linked to the production of autoantibodies to the viral glycoprotein , gp 70 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
During a human papillomavirus infection ( HPV ) , a set of spliced messenger RNAs ( mRNA ) are produced from the coding strand of the 8 kilobase virus DNA genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These substitutions may have originated from a DNA stretch donation from an allele belonging to the B 15 group , enabling HLA B * 3514 to cope with the presentation of a new set of antigenic peptides . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To improve further the reliable detection and identification of clonal Ig ( lambda ) gene rearrangements , we developed a new set of seven ' isotype specific ' DNA probes : the IGLC1D probe for the J C ( lambda ) 1 gene region , the IGLC2D probe for the J C ( lambda ) 2 gene region , the IGLJ 2 probe for the highly homologous J C ( lambda ) 2 and J C ( lambda ) 3 gene regions , and the IGLC4D , IGLJ 5 , IGLJ 6 , and IGLJ 7 probes for the last four J C ( lambda ) gene regions , respectively . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The complete DNA sequence of cosmid clone 31A5 containing a 35 452 bp segment from the right [ corrected ] arm of chromosome 4 from Saccharomyces cerevisiae , was determined from an ordered set of subclones in combination with primer walking on the cosmid . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The combined sequence data set and the DNA DNA hybridization data strongly support the sister status of the two island species , D . sechellia and D . mauritiana . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the first set of experiments we determined whether PCP would augment DNA adduct formation from the benzo [ a ] pyrene metabolite , 9 hydroxybenzo [ a ] pyrene ( 9 OH BP ) , as 9 OH BP 4 , 5 epoxide is known to be involved in the metabolic activation of this compound . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Non radioactive DNA diagnosis of dentatorubral pallidoluysian atrophy and Machado Joseph disease using a new primer set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
As a first example , we aligned a set of 11 DNA sequences coding for functional helix loop helix proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This model is not intended to simply generate the set of binding sites of regulators distributed in a linear array in the DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Mitochondrial DNA variation was studied in 100 Indians using the same set of six restriction enzymes used in the study of other world ethnic groups in order to compare and discern possible relationships of the Indian populations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A new method of DNA sequencing by hybridization using a microchip containing a set of immobilized oligonucleotides is being developed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We propose that transformation and immortalization of Indian muntjac fibroblasts by SV 40 virus can lead to a set of persistent changes in gene expression that result in chromosome instability and increased sensitivity to DNA damaging agents . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One hundred five consecutive patients with adult AML entered on a multicenter treatment trial were studied with a comprehensive set of DNA probes recognizing the most relevant AML associated structural and numerical chromosome aberrations : translocations t ( 8 ; 21 ) , t ( 15 ; 17 ) , and t ( 11q23 ) ; inversion inv ( 16 ) ; chromosomal deletions ( 5q , 7q , 9q , 12p , 13q , 17p , and 20q ) ; and chromosomal aneuploidies . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Fragment walking achieves this without subcloning or preparing many kinds of primers ; fragments obtained by digesting a template DNA are sequenced in parallel directly from the fragment mixture by using a set of 16 primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We show that TSPY has homology with other human and non human proteins , including SET and NAP , factors that are suggested to play a role in DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Spirochetal isolates were identified as Borrelia burgdorferi sensu lato by PCR using a primer set based on ribosomal DNA sequences to amplify the variable spacer region between two conserved structures , the 3 ' end of the 5S rRNA and the 5 ' end of the 23S rRNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The argininamide is encapsulated within the structured DNA loop and is stabilized by an intricate set of intermolecular hydrogen bonds and stacking interactions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Comparison with the phenogram obtained by DNA fingerprinting analysis of a set of T . cruzi strains showed good qualitative correlation between the degree of divergence of the LSSP PCR profiles and the genetic distance between the strains . kDNA signatures of heart tissue from acutely or chronically infected animals revealed perfect concordance with the patterns obtained from cultured parasites for the CL and Colombiana strains but not for the Y strain , which is known to be multiclonal . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : DNA was extracted from fresh frozen and / or rehydrated formalin fixed , paraffin embedded tissue sections from nine recently diagnosed cases of mesothelioma , nine cases of pulmonary adenocarcinoma , and three reactive pleurae , and amplified by the polymerase chain reaction ( PCR ) using the primer pairs used previously on fresh frozen tissues namely , the SV primer set directed at the LTAg gene sequence unique to SV 40 and the PYV primer set directed at a sequence shared by SV 40 and papovavirus strains BK and JC , respectively . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Identification of a set of protein species approximately 40 kDa as high affinity DNA binding factor ( s ) to the cell cycle regulatory region of the human thymidine kinase promoter . ^^^ Through DNA affinity chromatography , we identified a set of protein species of approximately 40 kDa that copurified with the htk DNA binding activity . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Repair of alkylated bases in DNA is performed by O 6 methylguanine DNA methyltransferase ( MGMT ) and a set of enzymes of the base excision repair pathway involving N methylpurine DNA glycosylase ( MPG ) , apurinic endonuclease ( APE ) , DNA polymerase beta ( Pol beta ) and DNA ligase . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Probing of the HNF 1 ( hepatocyte nuclear factor 1 ) DNA binding region using a set of DNA duplexes containing pyrophosphate or O methyl substituted pyrophosphate internucleotide groups at different positions of the HNF 1 recognition sequence was performed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The frequency of a polymorphic mitochondrial DNA insertion into the nuclear genome was determined for 870 individuals from a geographically diverse set of 20 populations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Although the AcMNPV genome contains multiple sets of reiterated sequences that are thought to function as origins of DNA replication , no initiator protein has yet been identified in the set of viral replication enzymes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A plausible explanation for the hyper resistance phenotypes for various DNA damaging agents and a model for the genetic control of a second set of putative SOS regulons are presented . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
With the aim of determining the relevance of these two genes in the Italian population , we submitted to mutational analysis a set of 17 HNPCC families , all of which fulfilled the `` Amsterdam criteria . ' ' A combination of different techniques , including reverse transcription polymerase chain reaction ( RT PCR ) of long fragments and single strand conformation polymorphism ( SSCP ) on cDNA and genomic DNA , allowed the identification of ten molecular variants , seven of which are predicted to inactivate mismatch repair function . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These abnormalities are susceptible to correction by a number of DNA repair mechanisms , each of which requires a distinct set of proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This opening of duplex DNA occurred around the 13mer of ori 2 , whose sequence closely resembles the set of 13mers found in the chromosomal origin oriC . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA was isolated from the frozen samples at 1 , 5 and 10 months later . 32P postlabeling analysis was performed at the beginning and at the end of study with the whole set of samples . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The 165 kb sorghum BAC was tested for hybridization to a set of clones representing the contiguous 280 kb of DNA flanking maize Adh 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the set of 16 chromosomes forming the onion diploid complement , there are 4 NOR chromosomes and 5 chromosomes carrying DNA domains providing a nucleus with the competence to replicate , as previously shown . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The mitochondrial DNA of the chytridiomycete fungus Spizellomyces punctatusen codes only eight tRNAs , although a minimal set of 24 25 tRNAs is normally found in fungi . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
TheM . pneumoniae specific genes included a restriction modification system , two transport systems for carbohydrates , the complete set of three genes coding for the arginine dihydrolase pathway and 14 copies of the repetitive DNA sequence RepMP 1 which were part of several different translated genes with unknown function . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have calculated a full set of second order correlation functions of nucleotides in noncoding DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By screening a set of near isogenic lines carrying different leaf rust resistance genes with a wheat probe encoding a serine / threonine protein kinase , we detected a polymorphic DNA fragment in the line with the Lr 10 resistance gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The target DNA is a 780 bp fragment of the 16S rRNA gene of avian mycoplasmas amplified by a single set of primers ( multispecies polymerase chain reaction [ PCR ] ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of six synthetic overlapping oligonucleotides coding for noxiustoxin were coupled into a continuous DNA fragment by means of recursive polymerase chain reaction . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By using a reverse transcription PCR based approach and a set of primers specific for the DNA binding domains of highly homologous members of the C / EBP family of transcriptional regulators , we have cloned a novel human gene encoding a member of the C / EBP gene family , identified as the human homolog of CRP 1 , C / EBP epsilon . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Employing the single nucleotide incorporation assay using a heteropolymeric RNA template and DNA primers , we defined enzymatic profiles of recombinant human immunodeficiency virus type 1 ( HIV 1 ) reverse transcriptase ( RT ) containing a set of five mutations [ A62V , V75I , F77L , F116Y , and Q151M ] which confers resistance to multiple 2 ' , 3 ' dideoxynucleosides ( ddNs ) on HIV 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
On the other hand , cross linking of the high affinity IgE receptor ( Fc epsilon RI ) on mast cells induces a set of activation events , i . e . , degranulation , secretion of eicosanoids , secretion of cytokines , and DNA synthesis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The problem of the heterozygote excess in typing results obtained by using the previously reported PCR RFLP methods was resolved by nested PCR , in which an internal primer set reamplified the ADH 2 sequence selectively from a mixture of the ADH gene sequences amplified in the first PCR amplification of genomic DNA samples as templates . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In Escherichia coli , damage to DNA induces the expression of a set of genes known collectively as the SOS response . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
TAF 1 also stimulates transcription from the Ad core DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When diluted sera were tested , the most sensitive protocol was that using a set of primers and a probe selected within the 5 ' UTR , together with a colorimetric detection based on DNA enzyme immunoassay . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The cervical tissue samples from these patients were also subjected to PCR in order to detect the presence of human papilloma viruses ( HPVs ) type 6 , 11 and 16 DNA , using a set of primers for the E 6 open reading frames in order to establish the acquisition of HPV infection . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Trypanosoma cruzi : specific detection of parasites by PCR in infected humans and vectors using a set of primers ( BP1 / BP2 ) targeted to a nuclear DNA sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The boranophosphate linkages are resistant to nucleases and thus the positions of the boranophosphates can be revealed by exonuclease digestion , thereby generating a set of fragments that defines the DNA sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Calculations of the sedimentation coefficient were based on direct solution of the Burgers Oseen problem for an equilibrium set of DNA conformations generated for each condition by the Metropolis Monte Carlo procedure . ^^^ In the presence of just 10 mM MgCl ( 2 ) , supercoiled DNA adopts essentially the same set of conformations as in moderate to high concentrations of NaCl . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This method is based on coamplification of an internal standard and a target DNA sequence with one set of primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This method involves the amplification of a DNA target with two different sets of primers : a set of range primers , which will define the absolute length of the ladder , and a set of spacer primers which will determine the size difference between each one of the fragments of the DNA ladder . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The fact that the new data set does not reject the DNA hybridization tree of these species probably indicates poor ability of the cytochrome b sequences to discriminate among alternative trees , rather than consistency among data sets . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The overall robustness of the algorithms and the reproducibility of the cluster analysis results generated by two commercially available computer programs ( GelCompar and DENDRON ) for analysing DNA fingerprinting gels were tested by examining the same set of fingerprinting data independently in two laboratories with the different software packages . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To determine if retroviral infection is associated with IgAN in a large population of patients , genomic DNA from peripheral blood mononuclear cells from 90 patients seronegative for HIV and human T cell leukemia virus type 1 ( HTLV 1 ) ( 37 IgAN , 33 other glomerulonephritis , and 20 healthy controls ) was evaluated by nested PCR using a pan lentivirus specific primer set ( PLSPS ) , targeting the consensus sequence of the lentiviral pol gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An enlarged set of consensus primers for the study of organelle DNA in plants . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We first specified the equilibrium DNA conformation at the base pair level of resolution , using a set of the equilibrium dinucleotide angles and DNA sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In order to determine the most important part of the above sequence for the DNA recognition by topo , the interactions of the enzyme with a set of extremely short ( 2 5 nucleotides in length ) oligonucleotides corresponding to different parts of the nonanucleotide have been investigated . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Multiple complete digest mapping is a DNA mapping technique based on complete restriction digest fingerprints of a set of clones that provides highly redundant coverage of the mapping target . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Results of DNA binding site selection experiments suggest that C 1 has a broader DNA binding specificity than does P , which may help C 1 to activate a more diverse set of promoters . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This generates a set of DNA templates that are each composed of a short overhang positioned at a fixed interval with respect to one end of the original dsDNA fragment . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This set of tools may be used to sequence , track , and study repetitive DNA in model organisms and humans . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Collectively , this study describes a primer set , RBQBf / RBQBr , which detects both genomic DNA and DR B , DQ B , or DP B amplicon and furthermore illustrates the necessity of routine testing for potential inhibitory factors that may be introduced into the wipe test PCR . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Subsequent isolation of DNA provided a set of samples in which the search for genetic alterations was performed and superimposed on the histologic map . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Southern analysis of cellular DNA revealed the presence of 4 common alleles ( with collective allele frequency close to 94 % in the control group ) and a set of rare alleles . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Nucleotide sequence analysis of the different family members identified a set of closely related genes exhibiting between 75 . 2 and 98 . 6 % DNA sequence homology . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
First , DNA fragments containing a set of highly conserved repeats located within the 5 ' end of XIST stimulate reporter activity 3 fold in transiently transfected cell lines . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this manner , by selecting a specific set of conditions ( packing material , flow rate , and electric field strength ) , the molecular weight of DNA fragments retained by the column can be adjusted . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Direct support for this hypothesis was provided by the observation that the minimal set of AcMNPV genes that was essential for plasmid DNA replication also promoted recombination events leading to Tn 5 inversion in the absence of any other viral function . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using an oligonucleotide primer set specific for MN complimentary DNA , we performed reverse transcription PCR assays on RNAs extracted from human cell lines and tissues to evaluate whether this marker might be expressed at other sites . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have constructed a set of fragmentation vectors for the truncation of either the centromeric or the noncentromeric end of YACs containing a human DNA insert . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have synthesized a set of four energy transfer dyes and demonstrated their use in automated DNA sequencing . ^^^ The utility of the new dye set was demonstrated by sequencing of a BAC DNA with an 80 kb insert . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These viral genes are divided into two groups based on whether they are essential or nonessential ( dispensable ) for virus growth in cell culture : the essential gene products include a set of replication proteins which accomplish the viral DNA replication , while the dispensable gene products include those important in influencing pathogenesis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The same set of bands was observed when isolated DNA from infected figs was used as template DNA but no signal was visible when DNA from uninfected figs was used as template . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The mutant gene 4 protein can prime DNA synthesis normally , indicating that for lagging strand synthesis a different set of helicase / primase DNA polymerase interactions are involved . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Molecular genetic tools ( PCR amplification followed by restriction analysis of a 3 . 2 kb region of variable chloroplast DNA , and restriction fragment length polymorphism analysis of the Pistacia cpDNA with tobacco chloroplast DNA probes ) provided a new set of variables to study the phylogenetic relationships of 10 Pistacia species . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The integrated HMM was trained further on a set of eukaryotic DNA sequences and tested by using it to segment a separate set of sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A host vector system for transformation of Porphyromonas gingivalis was constructed using a set ( 1 ) strains that can incorporate plasmid DNA by electroporation regardless of its source and ( 2 ) stable vector plasmids with a selectable marker . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A beta globin gene specific primer set was also applied to examine the quality of the extracted DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have investigated the use of fluorescence detection and the FluorImager S 1 System ( Molecular Dynamics ) for analyzing a comprehensive set of human DNA typing tests . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The theory of mass action was applied to the set of simultaneous dimerization ( either simple or ligand induced ) and DNA binding reactions in order to fix the initial equilibrium composition of mixtures to be assayed . ^^^ Theoretical mobility shift patterns were obtained for a range of protein concentrations at constant DNA concentration by numerical solution of the set of simultaneous transport reaction equations appropriate for each model . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Comparison of DNA flow cytometry and fluorescence in situ hybridization with a set of 10 chromosome specific DNA probes in four head and neck carcinomas . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The mechanisms that ensure that Ti plasmid T DNA genes encoding proteins involved in the biosynthesis of opines in crown gall tumors are always matched by Ti plasmid genes conferring the ability to catabolize that set of opines on the inducing Agrobacterium strains are unknown . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Autoradiographs of DNA ladders are densitometrically scanned to yield a set of curves with peaks corresponding to specific DNA fragments , thereby allowing quantitative subtraction of concurrent DNA degradation from necrotic death . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thus , the concept of modular organization of functional regulatory DNA regions ( e . g . promoters ) could be successfully implemented into a set of computer tools which might be flexible and specific enough to be suitable for prospective analysis of new genomic DNA sequences . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Control experiments showed that the set of primers used was capable of amplifying A . fumigatus DNA specifically and that the DNA amount of detection limit was 1 pg . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A colored banding pattern for human chromosomes is described that distinguishes each chromosome in a single fluorescence in situ hybridization with a set of subregional DNA probes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 26 genes for cobalamin biosynthesis , genes for polyhydroxyalkanoic acid metabolism , DNA replication and recombination , and DNA gyrase were among those identified . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In COS cells transfected with Stat 3 expression plasmids , both Stat3alpha and Stat3beta were activated for DNA binding and transcription by the same set of growth factors and cytokines and both , when activated , formed homodimers and heterodimers with Stat 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The methyl directed DNA repair efficiency of a set of M13mp18 heteroduplexes containing 1 8 or 22 unpaired bases was determined by using an in vitro DNA mismatch repair assay . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To narrow the genomic location of this tumor suppressor gene , we analyzed 25 sporadic parathyroid adenomas for allelic loss of polymorphic DNA loci on chromosome 1 using 11 microsatellite markers not previously scored for this set of tumors . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have determined the chromosomal distribution of a set of randomly selected C . neoformans cDNA clones and have explored the feasibility of identifying these clones through partial DNA sequencing . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Viral sequences from sera of infected subjects were amplified by nested RT PCR using primers from the core region and typed by one or two techniques : ( 1 ) DNA enzyme immunoassay ( DEIA ) and ( 2 ) PCR with a set of type specific primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The second option could be achieved if a set of specific spatial points were encoded in the DNA of one nucleus and these points were to form a union with a corresponding set of points in the DNA of the nucleus to be joined , the spatial orientation of the points being such that the two nuclei are correctly aligned . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A comparison with the GAL 4 DNA and PPR 1 DNA complexes shows how a family of related DNA binding proteins can use a diverse set of mechanisms to discriminate between the base pairs separating conserved DNA half sites . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In order to study the implications of hydrophobic point mutations in the c Fox leucine zipper on DNA binding of the entire c Fos protein , we have constructed and purified a set of Fos mutant proteins harboring one or several isoleucine or leucine residues in the five Fos zipper a positions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A new set of Mu DNA transposition intermediates : alternate pathways of target capture preceding strand transfer . ^^^ We describe a new set of transpososomes in which Mu B bound target DNA interacts non covalently with previously characterized intermediates prior to the actual strand transfer . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The primer set C4R110 , C4G , C4T , and C4R provides acceptor emissions of high spectral purity with donor : acceptor emission ratios of < 0 . 002 for C4G , < 0 . 004 for C4T , and < 0 . 005 for C4R and excellent matching in the electrophoretic mobilities of single base extension DNA fragments . ^^^ The set C10R110 , C10G , C10T , and C10R , which uses only rhodamine dyes as acceptors , shows significantly improved matching in the electrophoretic mobilities of single base extension DNA fragments over the previously described set C10F , C10G , C10T , and C10R and is the best available for sequencing . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
MNDA does not bind specific DNA sequences , but rather a set of nuclear proteins that includes nucleolin ( C 23 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of DNA probes specific for the centromeric regions of chromosomes 1 , 7 , 10 , 17 , 10 and Y was applied . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We also discovered that topo 4 has an unexpectedly strong DNA relaxation activity that , together with gyrase and topo 1 , is able to set the supercoiling levels in Escherichia coli . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The length of DNA required to specify the complete set of protein sequences could be significantly shorter if transcription used a variable codon length . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Trichoderma harzianum is the collective name of a set of asexual fungal strains which exhibit heterogeneity in genome structure , DNA sequence and behavior . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have used a set of bacteriophage lambda and Escherichia coli replication proteins to establish rolling circle DNA replication in vitro to permit characterization of the functional properties of lambda replication forks . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When less than two marker loci display shifts in the microsatellite bands from tumor DNA , the panel should be enlarged to include an additional set of five marker loci . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These effects of pTpT are accomplished , at least in part , by the up regulation of a set of genes involved in DNA repair ( ERCC 3 and GADD 45 ) and cell cycle inhibition ( SDI 1 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thus , a set of chemically identical BPDE adducts yielded a greater than 100 fold range of repair rates , demonstrating that nucleotide excision repair activity is entirely dictated by local DNA conformation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Southern blot analysis of human genomic DNA suggested that the RPL 38 does not constitute a multigene family but it is encoded by a reduced set of active genes , among which we have also found a RPL 38 processed pseudogene located in the promoter region of the human type 1 angiotensin 2 receptor gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To determine the origin of these isoforms , the entire human PACE 4 gene has been isolated as a set of overlapping genomic DNA fragments , and analyzed by restriction enzyme digestion and nucleotide sequence determination . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A 15 kb DNA fragment from the Bacillus subtilis chromosome between citB and ppsC has been sequenced , and new ORFs encoding putative enzymes involved in lipopolypeptide synthesis , which complete a partial operon previously reported , and a new set of enzymes responsible for lipid metabolism have been identified . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To investigate the cytogenetic status at different stages of prostatic tumor development , we have applied interphase in situ hybridization ( ISH ) with a set of ( peri ) centromeric DNA probes specific for chromosomes 1 , 7 , 8 , and Y to routinely processed tissue sections of prostatic specimens from 75 different individuals . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The paper extends some of the most recently obtained results on the computational universality of specific variants of H systems ( e . g . with regular sets of rules ) and proves that we can construct universal computers based on various types of H systems with a finite set of splicing rules as well as a finite set of axioms , i . e . we show the theoretical possibility to design programmable universal DNA computers based on the splicing operation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Based upon the HTR1F cDNA sequence , a primer set that reacted with human genomic DNA but not mouse or hamster genomic DNA was derived from the relatively nonconserved 5 ' untranslated and coding region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Nature has provided a set of proteins that support DNA polymerases in performing processive , accurate and rapid DNA synthesis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To determine the base frequency conservation required for Fis to locate its binding sites , we collected a set of 60 experimentally defined wild type Fis DNA binding sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Comprehensive analysis of 1H NOESY spectra of 1 : 2 : 3 showed that terminal fragments of the complex [ 5 ' p 1T 2G 3A 4T ] , [ 21A 22T 23A 24C ] , [ 8T 9T 10T 11C 12T ] and [ 13A 14G 15A 15A 17A 18C ] gave a continuous set of intra and inter nucleotide interactions , typical of regular double stranded B DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results suggest that the rpbA gene product functions in controlling constitutive transcription from the cpcB1A1 gene set , possibly as a DNA binding transcriptional repressor element . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
On a data set of 570 DNA sequences , AAT identified 94 % of coding nucleotides correctly and 74 % of exons exactly . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The chromosome contains 853 genes encoding a basic set of proteins for DNA replication , transcription , translation , solute transport and energy metabolism , but , like Mycoplasma genitalium , it contains no genes for cellular biosynthetic reactions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Supposing that the two complementarity strands of DNA are coding , it is demonstrated that the complementary of a codon is classified in to the same set , which has been observed statistically ( with a few exceptions ) in the coding sequences by Arqus & Michel [ ( 1996 ) J . theor . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA of each positive strain was probed with a set of specific primers designed for 20 of these genes and for cry11A . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The preference for GT rich DNA by the yeast Rad 51 protein defines a set of universal pairing sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA fragments consisting of highly repetitive genomic sequences were detected as a set of bands corresponding to fragments between 464 and 67 bp in length . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Twenty two SCCs of the tonsil were analyzed for the presence of HPV DNA by polymerase chain reaction ( PCR ) using both a consensus primer set ( My09 / My11 ) and type specific primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In vitro , the two enzymes have different requirements for DNA binding , but both bind to , and transcribe from , the same set of chloroplast promoters . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of reporter compounds that bind to DNA by intercalation are known , but these compounds do not intercalate in PNA / DNA hybrid duplexes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The comparison of the electrophoretic patterns allowed the identification of a set of differentiation induced nuclear matrix proteins cross linked to DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this report we describe a process that applies fluorescence based re sequencing and an integrated set of analysis tools to automate and simplify the identification of DNA variations using the human mitochondrial genome as a model system . ^^^ We also show that employing the Consed program to display a set of highly annotated reference sequences greatly simplifies data analysis by providing a visual database containing information on the location of the PCR primers , coding and regulatory sequences and previously known DNA variants . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have assembled a high resolution physical map of human chromosome 13 DNA ( approximately 114 Mb ) from hybridization , PCR , and FISH mapping data using a specifically designed set of computer programs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These include a set of genes required for viral DNA replication and virion morphogenesis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When these promoter regions were placed upstream of the CAT reporter gene and transfected into a carp CF cell line , the 5 ' upstream 1 . 6 kb DNA fragment of the snf 5 gene displayed stronger promoter activity , approximately three fold higher than that of the 5 ' upstream 1 . 3 kb DNA fragment of the set gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To support this model , alanine scanning mutagenesis was used to assemble a set of 49 PI SceI mutant proteins that were purified and assayed for their DNA binding and cleavage properties . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Restriction site and sequence length polymorphism in a set of 14 PCR products covering this 6 . 9 kb region were used to identify the parental origin of DNA sequence information in prototrophic progeny of crosses heterozygous for auxotrophic mutations in his 3 and the silent sequence differences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Systemic lupus erythematosus ( SLE ) , for example , is characterized by a discrete set of antibodies directed to nuclear antigens ; these include autoantibodies to DNA and snRNPs that are diagnostic for SLE . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The C . eugametos mitochondrial DNA ( mtDNA ) , therefore , shares almost the same reduced set of coding functions and similar unusual features of rRNA gene organization with the linear 15 . 8 kb mtDNA of Chlamydomonas reinhardtii , the only other completely sequenced chlamydomonadalean mtDNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Probing with a set of DNA probes localized in the authentic telomeres , subtelomeric regions and bulk chromatin revealed that these chromosomal regions have nucleosomal organization but differ in size of nucleosomes and rate of cleavage between both species and regions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a new set of monoclonal antibodies directed either to the amino or the carboxy terminus of Xenopus p 53 , we demonstrate that the frog protein can be activated by specific carboxy terminus monoclonal antibodies in order to bind to human p 53 DNA response element . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The aim of this study is to investigate the usefulness of a simplified , time saving screening method for the detection of protein C mutations consisting of the combination of multiplex PCR amplifications using the same primers that were designed for sequencing , followed by single strand DNA conformation polymorphism ( SSCP ) electrophoresis analysis performed with one set of conditions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of statistical methods is given that enables a DNA histogram to be interpreted objectively and without human interaction . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 25 drug DNA NOEs define the binding site with some precision and are used as part of the structural analysis using restrained molecular dynamics simulations considering explicit solvation and the treatment of electrostatic interactions using the particle mesh Ewald method within AMBER 4 . 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of mutants obtained by that approach revealed that the fourth residue of the HTH ( Leu 41 ) , which points towards the core of the DNA binding domain in TetR , alters the recognition of base pair 4 , e . g . the mutant TetR LV41YM42 exhibits a new recognition specificity for tetO 4G . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : A set of 34 genes clustered around the rifK gene encoding AHBA synthase were defined by sequencing all but 5 kilobases ( kb ) of a 95 kb contiguous region of DNA from A . mediterranei . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This technique is based on the co amplification of an internal standard ( PCR MIMIC ) and target DNA sequence with one set of primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A statistical analysis of the information content of these binding sites shows that functional information on protein binding modes can be extracted from a set of DNA binding sites by comparing the information content of two different DNA populations , or sub populations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The results reveal sequence rules that were already identified in earlier studies of natural nucleosomal DNA , together with a large set of new rules having even stronger statistical significance . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Estimates for the geometric parameters describing the DNA bend induced by the catabolite activator protein ( CAP or CRP ) were obtained which correctly predict experimental DNA cyclization probabilities ( J factors ) , determined for a set of 11 150 to 166 bp DNA restriction fragments bearing A tracts phased against CAP binding sites . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Separation of heterochromatic ( H ) and euchromatic ( E ) fractions is monitored by hybridization with subtelomeric satellite DNA and ribosomal RNA gene and by PCR amplification of p 53 gene / pseudogene with one primer set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Together , they reveal an extraordinary set of new mechanisms by which endonucleases target the hydrolysis of specific DNA sequences . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To understand better its mechanism of DNA unwinding , we characterized a set of 4A ' mutant proteins ( Washington , M . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When this conjugate was treated with human nuclear or whole cell extracts , two sites of DNA breakpoints were detected : one set of double stranded breaks occurred close to the 3 ' side of the topoisomerase ( topo ) conjugation site , and there was another set of nicks about 30 nucleotides 3 ' to the topo site . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The method involves extraction of DNA from activated sludge , appropriate dilution of the extracted DNA with DNA extracted from nonintroduced activated sludge , PCR amplification of a gyrB gene fragment from the introduced strain with a set of strain specific primers , and quantification of the electrophoresed PCR product by densitometry . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Although widely used , the detection of DNA mutations by the single strand conformation polymorphism ( SSCP ) method is often hampered by the need to examine a large set of electrophoretic conditions in order to select the one suited to the DNA sequence under study . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here , we screened for additional mutations in a set of 14 CLD families of Polish , Swedish , North American , and Finnish origin using primers that allowed mutation searches directly from genomic DNA samples . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An additional screening set was used ( n = 38 families , 89 affecteds with DNA , 216 unaffecteds with DNA ) for the follow up analysis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
BACKGROUND : Zinc fingers of the Cys 2 His2 class comprise one of the largest families of eukaryotic DNA binding motifs and recognize a diverse set of DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of methods providing an increase in the content of the target product in the biomass ( plasmid DNA amplification and selection of clones of transformed cells ) was applied at the stage of cultivation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA was extracted from peripheral blood leukocytes and diluted , and PCR was performed by using a primer set specific for a well conserved sequence of the internal repeat 1 region of the EBV genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Expression of the late protein E 1 ( wedge ) E 4 and amplification of viral DNA were detected in the identical set of cells after suspension in methylcellulose . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA was isolated from the resulting pool of internalization competent bacteria and sequenced in a single set of reactions to determine which alanine substitutions maintained activity . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a separate set of experiments , 4 microg of ATA was administered intraventricularly 1 hour before ischemia and the brains were assessed for evidence of DNA fragmentation by the TUNEL method . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 26 genes for cobalamin biosynthesis , genes for polyhydroxyalkanoic acid metabolism , DNA replication and recombination , and DNA gyrase were among those identified . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The EcoGene project involves the examination of Escherichia coli K 12 DNA sequences and accompanying annotation in the public databases in order to refine the representation and prediction of the entire set of E . coli K 12 chromosomally encoded protein sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Polymerase chain reaction ( PCR ) with a set of degenerated primers produced a fragment of about 610 base pairs [ bp ] from genomic DNA of both species ; the PCR products appeared close in size to the amplified from rat PCNA and hybridized to the pCR 1 probe . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A 1 . 9 kb DNA region encoding most of the alpha and beta subunits of DSR could be recovered only from organisms capable of dissimilatory sulfate reduction with a PCR primer set targeting highly conserved regions in these genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When this occurs , repair is mediated by an elaborate set of recombinational DNA repair pathways which encompass most of the enzymes involved in DNA metabolism . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In Escherichia coli , the SOS response is induced upon DNA damage and results in the enhanced expression of a set of genes involved in DNA repair and other functions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : Unknown concentrations of DNA extracted from breast specimens were amplified by PCR using a set of primers spanning intron 2 / exon 3 of the eIF4E gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Apoptosis was estimated by the type of DNA fragmentation , amount of fragmented DNA , and percentage of cells with hypodiploid DNA set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Based on their molecular defects , prenatal diagnoses of 6 fetuses including one set of fraternal twins were successfully made at the ninth to eleventh week of gestation by polymerase chain reaction ( PCR ) restriction digestion using genomic DNA from chorionic villus sampling ( CVS ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In one set , the 3 ' nucleotide matches the allele under study so that the primer functions effectively only if the DNA contains the corresponding allele . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By use of a second , unrelated primer set , the presence of HHV 8 DNA was confirmed in 12 ( 63 . 2 % ) of 19 nontumorous samples and detected in another 6 ( 17 . 7 % ) of 34 samples tested . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
According to the newly identified sequence , we designed a new set of primers so that we could distinguish the DNA fragment amplified in RT PCR from that in genomic PCR . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA sequencing was performed on a set of representative alleles by Taq cycle sequencing using dye terminator labeling chemistry . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Cytosine ( C 5 ) specific DNA methyltransferases share a set of ten conserved motifs distributed evenly throughout the entire polypeptide chain . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
MOTIVATION : Automatic extraction of motifs that occur frequently on a set of unaligned DNA sequences is useful for predicting the binding sites of unknown transcription factors . ^^^ RESULTS : We propose a new program called YEBIS ( Yet another Environment for the analysis of BIopolymer Sequences ) which is capable of extracting a set of motifs , without any a priori knowledge , from a number of functionally related DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : A test set of DNA sequences has been constructed consisting of artificially evolved and real sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A double set of primers ( G1 / G2 , B 64 I / B64 2 ) , described before , were used to amplify by PCR a DNA fragment from serogroups belonging to Leptospira interrogans but did not allow to detect saprophytic strains isolated from soil and water ( L . biflexa ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Gelonin , pokeweed antiviral protein , and ricin , previously described as ribosome inactivating proteins , are shown to damage single stranded DNA by removal of a protein specific set of adenines and cleavage at the resulting abasic sites . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have isolated and sequenced a set of deletions stimulated by DNA palindromes in Escherichia coli . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have assessed the phylogenetic status of the Trypanosoma cruzi Genome Project CL Brener reference strain by multilocus enzyme electrophoresis ( MLEE ) and multiprimer random amplified polymorphic DNA ( RAPD ) including a set of cloned stocks representative of the whole genetic diversity of T . cruzi . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of primers specific for the nuc gene of S aureus was used to develop a PCR technique , and modification of the rapid boil method was used to isolate bacterial DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sections of the microarray provide targets for parallel in situ detection of DNA , RNA and protein targets in each specimen on the array , and consecutive sections allow the rapid analysis of hundreds of molecular markers in the same set of specimens . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A series of near IR fluorescent dyes were prepared which contained an intramolecular heavy atom for altering the fluorescence lifetimes to produce a set of probes appropriate for base calling in a single lane DNA sequencing format . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
As part of our analysis of the role of a uniquely clustered set of dam methylation sites ( the motif GATC ) within the origin of DNA replication in Escherichia coli , we have studied the effect of GATCs in various methylation states on the intrinsic curvature of DNA . ^^^ We have designed a set of DNA linkers and used commercially available linkers containing GATC motifs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Previous studies in our laboratory have identified a set of mutations in the Escherichia coli dnaE gene that confer increased accuracy of DNA replication ( antimutators ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : Because of the current shortage of full length cDNA data on which to base this work , tests were performed on a non redundant set of 660 initiation codon containing DNA sequences that had been conceptually spliced into mRNA / cDNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 33 cattle microsatellite primer pairs was tested with the DNA of American bison from a captive population in Belgium and evaluated for usefulness in parentage testing . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Partial digestion with 1 CeuI , which digests bacterial DNA at the gene coding for the large subunit rRNA , established the rrn genomic skeleton ( the distance in kb between rRNA operons ) in 56 strains of Salmonella , from Salmonella Reference B ( SARB ) set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
There are three types of DNA quadruplex structures , and these may play important roles in telomere , centromere , triplet repeat , integration sites and other DNAs , and this first set of porphyrin dyes show some selectivity between the quadruplex types . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The resilience of a gene is defined as the set of probabilities of synonymous base substitution ( one for each type of base substitution on each DNA strand ) , and is derived from the fraction of all possible substitutions which result in no change of encoded amino acids . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The crystal structure is in agreement with the underlying NMR data , but our structure reveals a well defined set of contacts and also reveals the locations and roles of water molecules at the protein DNA interface . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of nested oligonucleotide PCR primers that specifically amplified a 373 bp subunit from a variety of clinical isolates from farmed fish and human patients were constructed from a 524 bp consensus sequence of the S . iniae 16S 23S ribosomal DNA intergenic spacer . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To investigate this question , we prepared a set of double stranded DNA molecules in which deuterium had been incorporated specifically at each position in the deoxyribose of one of the four nucleotides . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An extensive set of Brf fragments has been examined for the abilities to assemble the TFIIIB DNA complex and recruit RNA polymerase 3 to accurately initiate transcription . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Quinolone congeners differ in their relative potencies for DNA gyrase and topoisomerase 4 Studies of an expanding set of resistant mutant enzymes and the crystal structure of the homologous enzyme in yeast have contributed to our understanding of interactions of these drugs with topoisomerase DNA complexes and the ways in which mutations effect resistance . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a pool of degenerate oligonucleotides we determined the DNA sequence ANNAGGAAA ( T / C ) GA ( CIG ) AA as the set preferentially recognized by mLIM 3 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a set of 42 antiretroviral naive HIV 1 infected persons who were treated with either Zidovudine ( AZT ) monotherapy , or a combination of AZT + ddC ( Zalcitabine ) or AZT + ddI ( Didanosine ) , the HIV 1 DNA load was measured by competitive polymerase chain reaction ( PCR ) and related to the HIV 1 RNA load in plasma , the CD4+ counts and to clinical markers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a set of primers designed for an open reading frame of the EHNV genome , PCR products of about 250 bp were obtained with the DNA of systemic piscine and amphibian iridoviruses . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DRI is a founding member of a growing protein family whose members share a conserved DNA binding domain termed the A / T rich interaction domain . dri is developmentally regulated , being expressed in a restricted set of cells including some neural cells and differentiating cells of the gut and salivary gland ducts . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genetic and biochemical data suggest that these two groups of regulatory factors may act through a common set of DNA elements . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
However , a series of recent papers has shown that members of a set of proteins that are crucial for the rejoining of DNA strand breaks are also required for normal telomere function , raising new questions about how these two types of termini maintain their functional distinction . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of NMR titrations of the ligand into solutions of G quadruplexes using various oligonucleotides related to human telomeric DNA showed strong and specific binding of the ligand to the G quadruplex . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Extensive sequencing in the HoxD complex of several vertebrate species has revealed a set of conserved DNA sequences interspersed between neighboring Hox genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The plasmid DNA solution was delivered directly to the target cells of the skin by a set of oscillating solid microneedles driven by a modified tattooing device . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The crystal structures of the conserved ETS domain of SAP 1 bound to DNA sequences from the E 74 and c fos promoters reveal that a set of conserved residues contact a GGA core DNA sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here , a complete set of sequence dependent empirical energy functions suitable for describing such behavior is extracted from the fluctuations and correlations of structural parameters in DNA protein crystal complexes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The target of the first primer set ( P 1 P2 ; sense , 5 ' GAC TAT CGC ATC AAC AAC CG 3 ' , and antisense , 5 ' AGG TAG CGA GTA TTA CTG CC 3 ' , respectively ) is a 704 bp DNA fragment . ^^^ The second set ( P 3 P4 ; sense , 5 ' GCT ATT TCA CCG CCG CTC AC 3 ' , and antisense , 5 ' CCG CAG AGC CGT AAA CCG AA 3 ' , respectively ) amplifies an internal 222 bp DNA fragment . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Beside the classical DNA histograms , a set of further evaluations was performed to detect optical errors as well as inhomogeneities in the measurements . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Consequently , one would expect the cell to have developed a well defined set of DNA polymerases with each one uniquely adapted for a specific pathway . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Although the sample set was limited , the data suggest that endogenous DNA adduct formation in human pancreas is not clearly derived from cigarette smoking or from ( NQO 1 ) mediated redox cycling . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Presence of HPV DNA was evaluated in cervical smears of 30 pregnant women before delivery and in buccal swabs of the corresponding 31 infants ( 1 set of twins ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Interphase in situ hybridization ( ISH ) was applied with a set of ( peri ) centromeric DNA probes , specific for chromosomes 1 , 7 , 8 and Y , to routinely processed tissue sections of 73 tumour specimens from 32 patients . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA multilocus fingerprinting was performed using probe M 13 core hybridizing to a set of hypervariable minisatellite sequences in S . cerevisiae . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have confirmed in a second set of patients having human pleural mesothelioma that DNA for regions of the amino terminus of SV 40 Tag can be amplified by the polymerase chain reaction . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the presence of an incomplete set of dNTPs , pfu was found to be extremely discriminative in nucleotide incorporation and proofreading at the initiation step of DNA synthesis , completely preventing primer extension when mispair ( s ) are found adjacent to the 3 ' end of the primer . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When the test primers are used to amplify batched DNA samples , and fluorescently labeled dNTPs are incorporated into the PCR product , the products from the best set of conditions can be loaded directly onto an automated sequencer , and the number of alleles , allele size range , and approximate allele frequencies can be estimated from one lane per locus . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of prediction tools is available at http : / ( / ) www . icgeb . trieste . it / dna . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
B 19 DNA detection was performed by polymerase chain reaction using a set of primers located in the VP 1 gene , separately in serum and in cryoprecipitates to investigate a possible capture of B 19 DNA in cryoprecipitate . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To analyze quinolone resistance mechanisms in the set of isolates , DNA sequencing of the genes corresponding to the quinolone resistance determining regions within the GyrA and ParC proteins was performed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Each of the five primers produced a different set of products when used to prime PCR from cyanobacterial genomic DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To identify stable RNA secondary structure causing band compression , 30 lambda DNA clones and four cDNA clones ( about 10 kb in total length ) were sequenced using Transcriptional Sequencing , which is based on the phage RNA polymerase chain termination reaction with fluorescent 3 ' deoxynucleoside triphosphate , using the canonical set of rNTPs for the substrate . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This work introduces an efficient and conceptually novel approach that in the future can make use of more data to optimize a larger set of DNA folding parameters in a more refined model . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this view , a set of master genes activates the DNA necessary to produce the appropriate proteins that the organism needs during development . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 428 DNA probes from different Poaceae ( grasses ) detected 2460 loci in F 1 progeny of the crosses Saccharum officinarum Green German 10 S . spontaneum IND 81 146 , and S . spontaneum PIN 84 1 10 S . officinarum Muntok Java . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We present the high resolution solution structures of a self complementary DNA decamer duplex featuring a single alpha anomeric nucleotide per strand encompassed by a set of 3 ' 3 ' and 5 ' 5 ' phosphodiester linkages , d ( GCGAAT 3 ' 3 ' alphaT 5 ' 5 ' CGC ) 2 , alphaT , and its unmodified control , d ( GCGAATTCGC ) 2 , obtained by restrained molecular dynamics . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A rapid PCR assembly method was developed that , together with this predefined set of zinc finger domains , provides ready access to 17 million novel proteins that bind the 5 ' ( GNN ) 6 3 ' family of 18 bp DNA sites . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The clinical performance of the novel SPF system was assessed in three different patient groups . 1 ) Analysis of 534 cervical scrapes , obtained from treated patients , showed that the detection rate in 447 ( 83 . 7 % ) scrapes with normal cytology was significantly higher using the SPF system as compared with the universal primer set GP5+ / 6+ ( P < 0 . 001 ) . 2 ) The SPF assay detected HPV DNA in 299 ( 98 . 4 % ) of 304 scrapes with cytological dyskaryosis . 3 ) The SPF system detected HPV DNA in 100 % of 184 formalin fixed , paraffin embedded cervical carcinoma specimens . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results from the alpha genes are corroborated by theta gene data and are in contrast to mitochondrial DNA studies of the phylogeny of this genus , which suggest a more gradual set of speciation events . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The nuclease sensitivity assays have revealed that TAF 1 remodels the Ad core , thereby making transcription and replication apparatus accessible to the template DNA . ^^^ To examine whether TAF 1 remodels the chromatin consisting of histones , the chromatin structure was reconstituted on the DNA fragment with core histones by the salt dialysis method . ^^^ Furthermore , it was shown that TAF 1 is capable not only of disrupting the chromatin structure but also of preventing the formation of DNA histone aggregation and transferring histones to naked DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
However , cells from one set of patients , XP variants , exhibit normal repair but are abnormally slow in replicating DNA containing UV photoproducts . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a combinatorial labeling technique and a specially designed filter set , each DNA probe can be identified by its unique spectral signature . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These experiments give additional insights into the mechanism of DNA replication and provide for E . histolytica a set of transfection vectors with unique properties . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An unexpectedly large set of factors appears to modulate the interaction of sperm cells with exogeneous DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These helper functions have been provided conventionally by a helper virus , usually a replication defective mutant of HSV 1 , or more recently , by a set of five cosmids that overlap and represent the genome of HSV 1 deleted for DNA cleavage / packaging signals ( pac ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
However , this minimal set of factors is not sufficient for transcription when the DNA template is packaged into chromatin . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
GIN is able to recognize multiple genes within genomic DNA as demonstrated by the identification of a globin gene ( gamma globin 1 ( G ) ) that has not been annotated as a coding region in the widely used the test set of Burset and Guigo . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For this data set , the incorporation of unoxidized betaC into microsomal membranes caused the level of binding of BaP metabolites to DNA to decrease by 29 % over that observed in the absence of betaC ; however , the incorporation of the mixture of betaCOP caused the binding of BaP metabolites to DNA to increase 1 . 7 fold relative to controls without betaC . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analysis of the strain distribution pattern of the C . albicans resistance gene ( Carg 1 ) and additional gene and DNA segment markers in the AKXL recombinant inbred ( RI ) set showed that 13 / 15 RI strains were concordant for Carg 1 , Tcra and Rib 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Deletion of SET 1 increases the viability of mec3delta mutants after DNA damage ( in a process that is mostly independent of Rad53p kinase , which has a central role in checkpoint control ) but does not significantly affect cell cycle progression . ^^^ Our findings indicate that interactions between SET 1 and MEC 3 have a role in DNA repair and telomere function . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Molecular cloning , DNA sequencing and sequence analysis indicate that the dif locus encodes a new set of chemotaxis homologues of the bacterial chemotaxis proteins MCPs ( methyl accepting chemotaxis proteins ) , CheW , CheY and CheA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Of the 21 genes that already were known to be induced by a DNA damaging agent , 18 can be scored as inducible in this data set , and surprisingly , most of the newly identified inducible genes are induced even more strongly than these 18 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Theoreticians , in collaboration with experimentalists , can contribute to this research program by settling on a small set of practical and efficient models for DNA computation . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thus , a coordinated set of protein protein and protein DNA contacts are essential for PU . 1 Pip ternary complex assembly . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of chimaeric genes was constructed containing different proportions of the Ad 12 and Ad2E1B DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this study , we discuss a set of criteria which should be systematically evaluated in information collection and consent procedures prior to blood or tissue procurement for DNA bank purposes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The P gp+ set of clonotypic B cells is extensively DNA aneuploid , an attribute of malignancy . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We , therefore , assessed both AP 1 DNA binding and the known AP 1 activating enzyme , c Jun NH 2 terminal kinase ( JNK ) , in a panel of 30 ER positive primary human breast tumors with acquired TAM resistance , as compared to a matched panel of 27 untreated control ER positive breast tumors and a separate control set of 14 primary tumors , which included 7 ER positive tumors that were growth arrested by 3 months of preoperative TAM . ^^^ The set of control ER positive breast tumors growth arrested by TAM showed no significant difference from untreated control tumors in their AP 1 DNA binding and JNK activities . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We had previously shown that tolerantly ALV infected males , from ALV injection into fertile chicken eggs at day of set , can transmit proviral DNA to their progeny through the germline . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Early biochemical experiments measuring nearest neighbor frequencies established that the set of dinucleotide relative abundance values ( dinucleotide biases ) is a remarkably stable property of the DNA of an organism . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We explored this phenomenon by examining a set of matched retinoblastoma and leukocyte DNA samples from 158 patients informative for DNA polymorphisms . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sera were tested for TTV DNA by seminested polymerase chain reaction ( PCR ) using a set of primers synthesized according to the published TTV sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The data reported here combined with our previous work provide for the first time a complete set of thermodynamic parameters for molecular recognition of DNA by DNA with or without single internal mismatches . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the second set of experiments , a DNA library was created from Saimiri genomic DNA , and clones were selected from that library by screening with probes containing di , tri , and tetranucleotide repeats . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The pufferfish Fugu rubripes was recently introduced as a new model organism for genomic studies , since it contains a full set of vertebrate genes but only 13 % as much DNA as a mammal . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using human autoantibodies to well characterized cellular proteins as detecting probes in immunoblotting , we observed that a defined and somewhat similar set of nuclear proteins , including poly ( ADP ribose ) polymerase ( PARP ) and DNA topoisomerase 1 ( Topo 1 ) , were selectively cleaved during both apoptosis and necrosis of cultured cells induced by various stimuli . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
HGV quantitation was performed using a research based branched DNA ( bDNA ) assay with a set of probes directed at the 5 ' untranslated region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Based on antibody anamnestic responses ( western , ELISA , and neutralizing antibodies ) and virus detection methods ( co culture of PBMC and LNMC , nested set PCR of DNA from PBMC and LNMC , and plasma QC PCR ) , there were major differences between the groups in the challenge outcome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
However , the technical problems revealed during the execution of these scientific set pieces make it unlikely that DNA will ever rival silicon for the solution of any real world problem . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
FRT DNA sequences were designed with different core mutations and subsequently cloned in direct orientation upstream and downstream of a marker gene to serve as template for the amplification of a set of different gene disruption cassettes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here we describe a set of primers for studying mononucleotide repeat variation in chloroplast DNA of angiosperms where database information is limited . ^^^ Consensus primer pairs were constructed and used to amplify total genomic DNA from a hierarchical set of angiosperms . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Six of the eight enzymes in the data set bound in the enveloping mode , with the protein presenting a large interface area effectively wrapped around the DNA . ^^^ From this structural analysis a preliminary set of rules that govern the bending of the DNA in protein DNA complexes , are proposed . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
HPV DNA was detected by polymerase chain reaction ( PCR ) using a general primer set that targets the L 1 region and synthesizes a product of only 65 base pairs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A mitochondrial DNA ( mtDNA ) phylogeny of cichlid fish is presented for the most taxonomically inclusive data set compiled to date ( 64 taxa ) . 16S rDNA data establish with confidence relationships among major lineages of cichlids , with a general pattern congruent with previous morphological studies and less inclusive molecular phylogenies based on nuclear genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To define the subtype of HSV DNA detected in the screening assay , we also designed one set of primers which amplifies the gG regions of both types of HSV and probes which are specific to either HSV 1 ( gG 1 ) or HSV 2 ( gG 2 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For each substance of interest , a set of primers and internal probe was designed , which specifically amplify the target cDNA , not co amplifying contaminating genomic DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The MJ method is demonstrated on a Tibetan mitochondrial DNA RFLP data set . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have used a set of HN HN NOEs derived from a perdeuterated protein DNA complex to describe the fold of ADR 1 bound to the UAS 1 binding site . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This same set of Listeria isolates has previously been studied by automated laser fluorescence analysis of randomly amplified polymorphic DNA ( RAPD Alfa ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To determine whether topoisomerase 1 is essential for controlling global or local DNA supercoiling , we have prepared a set of topA null mutant strains in combination with different plasmid DNAs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The sequences of oligonucleotides used in the amplification and hybridization included a set for the DNA polymerase region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The complete TAFI gene contains 11 exons and spans approximately 48 kb of genomic DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When the primer set amplifying the 690 bp fragment was used , faint bands were observed with H . felis as the target DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Template Activating Factor 1 ( TAF 1 ) alpha and beta , chromatin remodeling factors , were identified as the stimulatory factor for replication of the adenovirus DNA complexed with viral basic core proteins . ^^^ Template Activating Factor 1 ( TAF 1 ) alpha and beta , chromatin remodeling factors , were identified as the stimulatory factor for replication of the adenovirus DNA complexed with viral basic core proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
MOTIVATION : A new approach to the prediction of eukaryotic PolII promoters from DNA sequence takes advantage of a combination of elements similar to neural networks and genetic algorithms to recognize a set of discrete subpatterns with variable separation as one pattern : a promoter . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Finally , a first set of mobility shift experiments with erythroid ( K 562 and MEL ) and nonerythroid ( HeLa ) cell lines showed binding of erythroid component ( s ) in this DNA region and the binding pattern was modified upon induction of MEL cells by DMSO . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Polymerase chain reaction ( PCR ) using the Mycoplasma fermentans insertion sequence like element ( ISLE ) RW primer set amplifies DNA from Mycoplasma orale when more than 1 ng is present in the reaction tube . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When clones from a single plate are pooled and mixed with genomic DNA , the resultant RLGS gel is a normal profile with a defined set of spots showing enhanced intensity for that particular plate . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The properties of this complex require a fairly elaborate set of protein protein and protein DNA contacts . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Reported here is a simple in vitro assay to screen for DNA polymerases that accept modified nucleotides based on a set of primer extension reactions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A recommended set of procedures has been developed for the detection and quantitation of DNA adducts formed by PAHs , aromatic amines and methylating agents . ^^^ These trials have led to a much clearer idea as to what are the critical features and procedures of the 32P postlabelling assay and there is a set of standard DNA samples for use in quality control and against which biological samples can be normalized . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The major histocompatibility complex ( MHC ) region was examined as a set of candidate genes for association between DNA markers and antibody response . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We consider the problem of obtaining the maximum a posteriori probability ( MAP ) estimate of a consensus ancestral sequence for a set of DNA sequences . ^^^ Our maximization method , called ASA ( dnA Sequence Alignment ) , can be applied to the refinement of noisy regions of a DNA assembly , to the alignment of genomic functional sites , or to the alignment of any set of DNA sequences related by a star like phylogeny . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To this end , we have constructed a set of molecules of varying G+C content ( 40 , 50 , and 60 % GC ) having all possible base changes at a particular location the `` DNA toolbox ' ' . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using this set of DNA molecules as polymerase chain reaction ( PCR ) templates , amplicons of various lengths with the same base , mutated to all other bases , were generated . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A PCR based approach to sequencing complete mitochondrial genomes is described along with a set of 86 primers designed primarily for avian mitochondrial DNA ( mtDNA ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Template activating factor 1 ( TAF 1 ) alpha and TAF Ibeta have been identified as the host factors that activate DNA replication of the adenovirus genome complexed with viral basic core proteins ( Ad core ) . ^^^ TAF 1 causes a structural change of the Ad core , thereby stimulating not only replication but also transcription from the Ad core DNA in vitro . ^^^ TAF 1 also activates transcription from the reconstituted chromatin consisting of DNA fragments and purified histones through chromatin remodeling . ^^^ Indeed , mutations disrupting this putative structure abolished the dimerization capability and reduced the TAF 1 activity in the Ad core DNA replication assay . ^^^ Template activating factor 1 ( TAF 1 ) alpha and TAF Ibeta have been identified as the host factors that activate DNA replication of the adenovirus genome complexed with viral basic core proteins ( Ad core ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have investigated the geometry of the complex using a novel set of photocross linking probes that force Ku protein to be constrained in position and orientation , relative to a single free DNA end . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Transient expression of I2PP2A , a potent inhibitor of protein phosphatase 2A ( PP2A ) , in HEK 293 cells increased the concentration and DNA binding of the proto oncogene c Jun . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One primer set ( XF176f XF954r ) amplified a 779 bp DNA fragment from 34 PD strains including seven pathotypes of 10 . fastidiosa , but not from strains of Xanthomonas campestris pv . campestris , Xan . vesicatoria or Escherichia coli . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have developed a generic primer set based on the conserved immunodominant region of transmembrane protein gp 41 that can reliably amplify as few as 10 copies / PCR of viral DNA from near full length clones representing group M subtypes A to H ( subtypes 1 and J were not available ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A complete set of plasma and DNA determinations related to hemostasis was performed on this family . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of DNA primers were designed for use in PCR to amplify and detect the genomic DNA from humans and three test microorganisms Escherichia coli , Proteus vulgaris , and Candida albicans . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
From the complete sequences of the breakpoint cluster regions of the human MLL and AF 4 translocation partner genes , a novel set of 66 oligonucleotides that facilitates the rapid identification of translocation breakpoints by PCR analysis of genomic DNA was designed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The assay system described here consists of a congenic set of yeast strains mutated in DNA replication and mismatch repair genes and assay plasmids with which it is possible to measure differences in microsatellite stability in the range of 5 850 fold . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In an approach to identify new candidates for tumor related genes , a set of established and new polymorphic DNA markers ( simple sequence repeats ) was used in menigioma samples to test for deletions within human chromosome 22 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For the identification of quantitative genetic differences between pathogenic Entamoeba histolytica and the closely related but nonpathogenic species E . dispar , a set of 68 independent probes that had previously been isolated from an E . histolytica cDNA library were hybridized to total genomic DNA of both amoeba species . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this study , we screened 28 Belgian mesothelioma tumour samples for the presence of SV 40 LTag like DNA and its gene product by polymerase chain reaction amplification , using the SV . for3 / SV . rev primer set , and by tyramine amplified immunohistochemistry , using the pAb 419 and the pAb 101 SV40 LTag antibodies . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genomic research is discovering new classes of polymorphic loci ( such as the single nucleotide polymorphisms , SNPs ) and lineage markers ( such as the mitochondrial DNA and Y chromosome markers ) ; our aim , therefore , was to determine how many SNP loci are needed to match the power of this set of 13 STR loci . ^^^ We conclude that the current set of STR loci is adequate for addressing most problems of human identification ( including interpretations of DNA mixtures ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To analyze quinolone resistance mechanisms in the set of isolates , we performed DNA sequencing of the quinolone resistance determining regions within the gyrA and parC genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Therefore , studies of the set of the 10 unique double stranded modified dinucleotide steps included in regular oligomers could be used to predict the behaviour of any double stranded PS DNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In general , DNA PCR provided stronger amplification signals compared to RT PCR at the corresponding time points with the same PCR primer set , indicating a lower efficiency of RNA amplification compared to that of DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The conflicting phylogenies in primary sequence data sets make it difficult to determine the the exact origin of the apicomplexan plastid and the apparent artifactual association of apicomplexan and euglenoid sequences suggests that DNA sequence data may be an inappropriate set of characters to address this phylogenetic question . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A reasonable set of force field parameters for the Pt atom were refined by using the available cisplatinated DNA crystal structure as a guide . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA hybrid , substituted with bromouracil on either the RNA or DNA strand , we have detected by photoaffinity radiolabeling a limited set of proteins able to bind to RNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the present study , we analyzed DNA damage induced by phycocyanin ( PHY ) in the presence of visible light ( VL ) using a set of repair endonucleases purified from Escherichia coli . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The same set of strains was typed by randomly amplified polymorphic DNA ( RAPD ) analysis , ribotyping , and pulsed field gel electrophoresis ( PFGE ) in order to compare the discriminatory power of the methods . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Specific expression of c Jun is a sufficient trigger for ECs to undergo apoptosis , as demonstrated by a set of combined assays including an ELISA specific for histone associated DNA fragmentation , DNA laddering , and TdT mediated dUTP nick end labeling ( TUNEL ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The putative pseudogene was mapped to human chromosome band 1q12 using the polymerase chain reaction with template DNA from human / rodent somatic cell hybrids , a radiation hybrid panel , and a set of primers that were chosen to be maximally divergent from the genuine VHL gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We cautiously advance the hypothesis that in parentage testing DNA minisatellite polymorphisms from an optimal set of tools . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We argue that there is a commonality of mechanisms and protein sequences , shared between prokaryotes and eukaryotes for several modes of DNA repair , reflecting diversification from a minimal set of genes thought to represent the genome of the LUCA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To address the difficulties encountered during conventional PCMV detection and characterization a set of nested PCR primers were constructed which generated DNA fragments of 415 and 257 bp from the DNA polymerase gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
MOTIVATION : Molecular biologists frequently can obtain interesting insight by aligning a set of related DNA , RNA or protein sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The present paper offers a set of methods to reveal the most important nucleosomal DNA characteristics and to show a common pattern of nucleosome site properties . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Template activating factor 1 ( TAF 1 ) was originally identified as a host factor required for DNA replication and transcription of adenovirus genome complexed with viral basic proteins . ^^^ Template activating factor 1 ( TAF 1 ) was originally identified as a host factor required for DNA replication and transcription of adenovirus genome complexed with viral basic proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To assess the contribution of the upstream DNA sequence to H1t transcriptional silencing in nonexpressing cells , a set of histone H1t promoted reporter vectors was constructed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In order to further elucidate the tropism of the novel hepatitis TT virus ( TTV ) we investigated 22 intravenous drug users ( IVDU ) for the presence of viral DNA in their peripheral blood mononuclear cells ( PBMC ) by means of seminested polymerase chain reaction using a set of primers specific for the conserved region of its genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The study was performed on 2 independently collected DNA banks , each with appropriate controls , and throughout the analysis associations described in the first set were confirmed in the second set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our results suggest that a set of highly conserved residues stabilizing the tertiary structure of the HMG 1 BD mainly determines the extent of DNA bending in the complex . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To identify specific residues in this region that are involved in DNA binding and / or catalysis , alanine scanning mutagenesis was used to create a set of PI SceI mutant proteins that were assayed for activity . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a subsequent set of experiments HHV 8 DNA was detected in 10 of 12 ( 83 % ) CD 34 positive cell fractions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A specific set of immune functions is switched on in response to DNA containing unmethylated CpG dinucleotides in particular base contexts ( ' CpG motifs ' ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When replication forks encounter a DNA lesion or strand break , repair is mediated by an adaptable set of pathways encompassing most of the enzymes involved in DNA metabolism . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA arrays of the entire set of Escherichia coli genes were used to measure the genomic expression patterns of cells growing in late logarithmic phase on minimal glucose medium and on Luria broth containing glucose . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Past studies have shown a consistent association of a specific set of mitochondrial DNA 9 base pair ( bp ) deletion haplotypes with Polynesians and their Austronesian speaking relatives , and the total lack of the deletion in a short series of New Guinea Highlanders . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We now report a general quantitative assay of DNA curvature that we have validated using a set of phased A ( 5 ) tract standards . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA methylation is the primary silencing mechanism for a set of germ line and tumor specific genes with a CpG rich promoter . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This YAC was used as template DNA for long distance and Alu PCR , using a set of putative exonic primers , designed on the cDNA sequence of alpha actinin 2 , in order to characterize the ACTN 2 intron exon boundaries . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This set of six cervical cancer cell lines included three lines with HPV 45 , a major non Western high risk HPV type , the first reported HPV 67 positive cell line , and two cell lines with integrated and episomal HPV 16 DNA , respectively . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Pdd2p is one of a small set of Tetrahymena polypeptides whose time of synthesis , nuclear localization , and physical association with sequences destined for elimination suggest an involvement in the DNA elimination process . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA sequence analysis of a set of isolated clones defined the minimal folding domain of Gal 3 required for lactose binding , which consisted of 136 amino acid residues . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To evaluate the results , the same lymphomas were analyzed by DNA fiber FISH with a 600 kb set of BCL 2 DNA clones labeled in alternating colors in combination with a color barcode covering the IGH locus . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
T4MPyP ( 4+ ) binding to [ d ( GCACGTGC ) ] ( 2 ) produced a single set of ( mostly ) upfield shifted DNA resonances in slow exchange with the resonances of the free DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Since technology limits the number of probes on the SBH chip , a challenging combinatorial question is the design of a smallest set of probes that can sequence an arbitrary DNA string of a given length . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To investigate the origin of a set of atypical isolates and their relationship to typical isolates , we employed a combination of molecular phylogenetic and population genetic analyses using rDNA sequencing , PCR fingerprinting , and analysis of co dominant DNA nucleotide polymorphisms to characterize the population structure of one typical and two atypical populations of C . albicans from Angola and Madagascar . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analysis of chromosomal heteromorphisms and microsatellite DNA polymorphisms in the infant and her parents indicated that the extra haploid set in the infant resulted from nondisjunction at maternal second meiosis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : Using DNAs prepared from an artificial mixture of male and female cells , a set of standard curves has been obtained and the sensitivity of the established quantitative PCR was found to be 25 pg of male DNA , which corresponds approximately to 0 . 005 fg competitor DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The prevalence rates of serum TT virus ( TTV ) DNA among children with or without a history of transfusion or liver disease were studied by polymerase chain reaction ( PCR ) using either the Okamoto primer set or the Takahashi primer set developed more recently . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The RT PCR with the set of primers specifically amplified the target size of DNA fragment in all the tested cucumoviruses ( CMV S IA , S IB and S 2 , PSV and TAV ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In summary , this set of breast cancer cell lines displaying prominent DNA amplifications should facilitate discovery and functional analysis of genes and signal transduction pathways contributing to breast cancer development . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Second , they regulate the DNA binding activity of p 53 by modulating the redox status of a critical set of cysteines in the DNA binding domain , which are also involved in the coordination of zinc . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of plasmid vectors conferring chloramphenicol resistance ( Cm ( R ) ) , 3064bp in size , or kanamycin resistance ( Km ( R ) ) , 2972bp in size , were developed , having multiple cloning sites in lacZ ' genes for alpha complementation . pTH18cs1 , pTH19cs1 , pTH18ks1 and pTH19ks1 are temperature sensitive ( ts ) in DNA replication ( ts Rep ) ; pTH18cs5 , pTH19cs5 , pTH18ks5 and pTH19ks5 are ts in plasmid segregation ( ts Seg ) ; and pTH18cr , pTH19cr , pTH18kr and pTH19kr are temperature resistant ( tr ) in both . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Combining this in vitro priming reaction and a set of chimeric RNA DNA Depsilon analogues , we found that only five ribose residues in the 57 nucleotide stem loop were sufficient to provide a functional template ; these are a single residue in the template region and the two base pairs at the tip of the lower stem . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
With a set of highly polymorphic DNA markers the parental origin of the 10 chromosome in 41 men with severe idiopathic infertility was determined . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The three offspring that resulted from seven embryo transfers ( a set of anatomically normal twins , one male and one female , stillborn 35 days premature , and a healthy male born at term ) demonstrate that primate spermatozoa with exogenously bound DNA retain their full reproductive capacity in ICSI , but raise the concern that , theoretically , ICSI could transmit infectious material as well . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The complexes possessed isolates with a variety of DNA fingerprints , yet each complex appeared to have isolates with a unique set of DNA fingerprints . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To investigate whether H RS cells in latent membrane protein 1 ( LMP 1 ) negative HD cases harbor fragments of the EBV genome , we combined fluorescence in situ hybridization ( FISH ) using a set of six overlapping DNA probes spanning the whole EBV genome with immunophenotyping of fresh frozen lymphoma sections . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When the map details the positions of genes ( or any set of orthologous DNA sequences ) on chromosomes , syntenic blocks of one or more genes may be identified and used , with appropriate models , to estimate the number of chromosomal segments with conserved content conserved between species . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It is hypothesized that an ancient prototype receptor evolved into an intricate set of dimerizing isoforms , capable of recognizing an ensemble of hormone responsive element motifs in DNA , and exerting ligand directed combinatorial control of gene expression . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 3000 mouse thymus cDNAs was analyzed by extensive measurement of expression using complex probe hybridization of DNA arrays ( `` quantitative differential screening ' ' ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We show how to encode information in DNA and use DNA amplification to implement a logically reversible gate that comprises a complete set of operators capable of universal computation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this designed DNA model system , a set of 16 oligonucleotides , each a 16mer , is used with the format 5 ' FFFFvvvvvvvvFFFF 3 ' in which 4 8 bits of data are stored in eight central variable ( ' v ' ) base locations , and the remaining fixed ( ' F ' ) base locations are used as a word label . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Inspired by the experiments in the emerging area of DNA computing , a somewhat unusual type of computation strategy was recently proposed by one of us : to generate a ( large ) set of candidate solutions of a problem , then remove the non solutions such that what remains is the set of solutions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We describe a particular set of DNA operations to effect the interconversion of electrical and DNA data and to represent the Hopfield associative memory and the feed forward neural network of Rumelhart et al . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We present techniques for automating the design of computational systems built using DNA , given a set of high level constraints on the desired behavior and performance of the system . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Extracted DNA was quantified and DNA profiled by a set of seven STRs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
B chromosome specific molecular markers are easy to detect by AP PCR based DNA profiling in the presence of a full set of A chromosomes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We analyzed a series of 8 randomly obtained , consecutive cases of non MAS FD and identified R 201 mutations in the GNAS 1 gene in all of them by sequencing cDNA generated by amplification of genomic DNA using a standard primer set and by using a novel , highly sensitive method that uses a protein nucleic acid ( PNA ) primer to block amplification of the normal allele . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of DNA molecules encoding all candidate solutions to the computational problem of interest is synthesized and attached to the surface . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Moreover these method we have maked : detection of mecA , phage typing with the international set of phages and study of the PGFE patterns by digestion of chromosomic DNA with Smal . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A complementary set of experiments employing differential phasing from an array of phased A tracts provides further evidence for both intrinsic and polymerase induced bends in the T 7 RNA polymerase promoter DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The primer set amplified an approximately 1 . 6 kb DNA fragment ( 0 . 7 kb in some strains ) , and BsrI , BstYI , or NlaIII digestion of the product resulted in six distinctively different PCR RFLP groups and two independent borrelial strains . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Several sequence motifs within the ALL 1 protein , such as the SET domain , PHD fingers and the region with homology to DNA methyl transferase are shared with other proteins involved in transcription regulation through chromatin alterations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We cloned a set of overlapping cosmid clones containing 115 kb of DNA surrounding Bat 6 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA was obtained from gastric specimens of 75 patients with gastric IM ( 30 cancer , 26 peptic ulcer , and 19 chronic gastritis patients ) and was amplified with a set of eight microsatellite markers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Allele specific products are generated using a special primer , a conditioned set of alpha S dNTPs and alpha S ddNTPs and a fresh DNA polymerase in a primer extension reaction . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These constructs might be used for in vivo intramuscular delivery of plasmid DNA and as a set of reagents for the development of retroviral as well as adeno associated viral ( AAV ) vectors expressing angiogenesis inhibitors . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Nucleotide excision repair of DNA with recombinant human proteins : definition of the minimal set of factors , active forms of TFIIH , and modulation by CAK . ^^^ The 15 recombinant polypeptides define the minimal set of proteins required for dual incision of DNA containing a cisplatin adduct . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Whichever guidelines were used , there was a strong relationship between DNA ploidy and / or S phase and classical clinicopathological factors ( T , N , histological type , grade , receptor status , or lymphatic invasion ) , with the exception of age , whose correlation was discrepant with S phase according to the set of guidelines . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We analyzed 39 t ( 11 ; 14 ) positive MCLs by either comparative genomic hybridization ( CGH ; n = 8 ) , fluorescence in situ hybridization ( FISH ) with a set of DNA probes detecting the most frequent aberrations in B cell neoplasms ( n = 12 ) , or both techniques ( n = 19 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of primers for polymerase chain reaction ( PCR ) was designed to detect viral DNA from cells infected with each of the four parapoxviruses . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The interaction of Escherichia coli Fpg protein , which catalyzes excision of several damaged purine bases including 8 oxoguanine ( oxoG ) from DNA with a set of single ( ss ) and double stranded ( ds ) 23 mer oligodeoxyribonucleotides ( ODNs ) containing 8 oxoguanine ( s ) at various positions , has been investigated . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Spectral karyotyping ( SKY ) is based on the simultaneous hybridization of a set of 24 chromosome specific DNA painting probes , each labeled with a different fluor combination . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It is also important to derive a set of defined criteria by which a tumor suppressor gene can be concluded to have been inactivated by DNA methylation in a manner that contributes to carcinogenesis . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The deamination of DNA bases by three alpha nitrosaminoaldehydes , butylethanalnitrosamine , methylethanalnitrosamine , and N nitroso 2 hydroxymorpholine ( NHMOR ) , the direct metabolite of potent animal carcinogen N nitrosodiethanolamine , was demonstrated by a set of in vitro experiments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sensitivity analysis revealed that the set 2 3 was more sensitive than 2 2 ' , detecting by gel visualisation the amount of DNA equivalent to 1 and 10 parasites , respectively . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
AlignACE is a Gibbs sampling algorithm for identifying motifs that are over represented in a set of DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Examination of a set of 21 B . stabilis strains by means of random amplified polymorphic DNA analysis and pulsed field gel electrophoresis typing suggested that the genome of this organism is highly conserved , which is in sharp contrast to the generally accepted genomic diversity , variability , and plasticity among B . cepacia strains . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
TTV DNA was detected by PCR using two different set of primers ( TTV A and TTV B ) derived from open reading frames 1 and 2 , respectively . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We describe a genomic DNA based signal sequence trap method , signal exon trap ( SET ) , for the identification of genes encoding secreted and membrane bound proteins . ^^^ To test the applicability of SET for the screening of complex genomic DNA , we evaluated two critical features of the method . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Most of the genome is sequenced by the former process that requires only a set of non specific primers and a template DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In three cases , DNA analysis allowed to establish the origin of the extra haploid chromosome set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The occurrence of these DNA regions was tested in a set of meningitis associated strains and in a control group composed of non meningitis associated strains belonging to the same B 2 group . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our objective in this study was to design a DNA probe set that enables optimal detection of MLL rearrangements using interphase FISH . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Furthermore , we can determine infectious titre by quantitative PCR on genomic DNA from infected cells , using an additional set of primers and probe to albumin to normalise for the genomic copy number . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The major histocompatibility complex ( MHC ) , known to affect immune response and disease resistance , was examined as a set of candidate genes for association between DNA markers and antibody response . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The study investigated the maternal species origin ( s ) of sour cherry using chloroplast DNA ( cpDNA ) markers and a diverse set of 22 sweet , 25 sour , and 7 ground cherry selections . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The present data set does not allow the resolution of this three taxon problem , and new kinds of data , such as nuclear DNA sequences , need to be collected . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One of the primers from each set was labeled with a fluorescent dye , which enabled amplified fragments to be detected and sized automatically on an automated DNA sequencer . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Certain groups of proteins , e . g . molecular chaperones and DNA repair enzymes , thought to be ubiquitous and represented in the minimal gene set derived by bacterial genome comparison , are missing in M . jannaschii , indicating massive non orthologous displacement of genes responsible for essential functions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The first procedure carried out by a newly remodeled computer program ( PCRAna A 1 ) was shown to be competent to calculate a set of random PCR products from Escherichia coli genome DNA ( 4 . 7 Mb ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This data set has been incorporated into a DNA secondary structure prediction algorithm ( DNA MFOLD ) ( http : / / mfold2 . wustl . edu / mfold / dna / for m1 . cgi ) as well as a DNA hybridization prediction algorithm ( HYTHERtrade mark ) ( http : / / jsl1 . chem . wayne . edu / Hyther / hythermenu . html ) . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA trinucleotide repeats ( TNRs ) are found at a higher than expected frequency within ORFs , and the amino acids encoded by the TNRs represent a biased set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The spectra of mutations found in aging animals were identical to those in younger animals , suggesting that they originated from a common set of DNA lesions manifested during DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Overexpression of p 21 from an inducible promoter in a human cell line induces growth arrest and phenotypic features of senescence . cDNA array hybridization showed that p 21 expression selectively inhibits a set of genes involved in mitosis , DNA replication , segregation , and repair . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sample DNA from the peripheral blood and from the bone marrow of two patients with B CLL was analyzed in the new set up at different time points before and after therapy . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analyzing the nucleotide sequences of the existing polymerase chain reaction ( PCR ) primers of TTV DNA , we developed a set of noble primers ( HM 1 ) and looked for the prevalence of TTV DNA in sera from 39 normal healthy Japanese individuals using PCR . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
From the DNA sequence of this fragment , a second set of primers was designed , and using these primers , a 511 bp DNA fragment was amplified only when MBV DNA was the template . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this paper , we describe our algorithmic approach to constructing an alignment of ( contiging ) a set of restriction maps created from the images of individual genomic ( uncloned ) DNA molecules digested by restriction enzymes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One current approach to quality control in DNA array manufacturing is to synthesize a small set of test probes that detect variation in the manufacturing process . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To elucidate the mechanism of interaction of restriction endonuclease EcoRII with DNA , we studied by native gel electrophoresis the binding of this endonuclease to a set of synthetic DNA duplexes containing the modified or canonical recognition sequence 5 ' d ( CCA / TGG ) 3 ' . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The main topic of this paper is to determine the most probable pedigree given a certain set of data including DNA profiles . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
However , each genotype represents a cluster of closely related strains which retain their sequence signature in the conserved gene pool and carry a set of genotype specific DNA blocks . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thus , the rDNA array is the first identified set of DNA sequences specifically bound by condensin in vivo . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Structures and energetics of complexes between guanine . . . cytosine Watson Crick ( GCWC ) DNA base pair and various metal cations were investigated by an ab initio Hartree Fock ( HF ) study in the absence of basis set superposition error . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In order to elucidate the effect of the sugar and phosphate backbones on the stable structure and electronic properties of stacked DNA base pairs , we performed ab initio molecular orbital ( MO ) calculations based on the density functional theory and Slater type basis set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Forty nine primer pairs were designed and preliminarily evaluated for their ability to amplify genomic DNA from a set of six varieties , including parents of a mapping family . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the nested PCR assays , the expected DNA fragment of 1 . 1 kb was amplified with this specific primer set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Restriction site specific PCR ( RSS PCR ) involves the amplification of DNA fragments using primers based on specific restriction enzyme recognition sequences , without the use of endonucleases , to generate a set of amplicons that yield `` fingerprint ' ' patterns when resolved electrophoretically on an agarose gel . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA microarrays have the ability to analyze the expression of thousands of the same set of genes under at least two different experimental conditions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Specifically , one set of primers was able to amplify DNA of subgroup B but not subgroup C and E viruses . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
MOTIVATION : In the maximum parsimony ( MP ) method , the tree requiring the minimum number of changes ( discrepancy ) to explain the given set of DNA or amino acid sequences is chosen to represent their evolutionary relationships . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Based on a search for long DNA segments where all the independent structural measures agree , we have found a set of 20 regions with identical and very extreme structural properties . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 38 Leishmania stocks from the Andean valleys of Peru was characterized by both Multilocus Enzyme Electrophoresis ( MLEE ) and Random Amplified Polymorphic DNA ( RAPD ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Binding of bacterially expressed human and rat SET to the DNA site at 418 / 399 of the rat P450c17 gene transactivates P450c17 in neuronal and in testicular Leydig cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A complete set of DNA energy parameters is now available and the RNA parameters have been improved . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
On average , each set of AFLP primers amplified 28 single copy DNA markers that were useful for identifying overlapping BAC clones . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Resolution and synthesis of a full set of natural product analogues and subsequent evaluation of their DNA alkylation properties revealed that the CPyI analogues retain identical DNA alkylation sequence selectivity and near identical DNA alkylation efficiencies compared to the natural products . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Motif combination and classification approaches were used in the analysis of a sample DNA array data set derived from genome wide gene expression analysis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : This paper introduces a deterministic pattern discovery algorithm , called Splash , which can find sparse amino or nucleic acid patterns matching identically or similarly in a set of protein or DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An example is estimating the significance of the observed match of a macromolecular sequence ( DNA or protein ) to a set of patterns ( motifs ) that characterize a biological sequence family . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This method employs a DNA polymerase and a set of four specially designed primers that recognize a total of six distinct sequences on the target DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using the published sequences from HPRS 103 ( ALV J isolated in 1989 in Great Britain ) , we designed a set of PCR primers that amplified proviral DNA from nine U . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Five typing methods , including biotyping ( API ID 32 ; BioMrieux , Marcy l ' Etoile , France ) , quantitative antibiogram typing based on actual zone sizes , plasmid typing , randomly amplified polymorphic DNA ( RAPD ) analysis ( with primer M 13 and primer set ERIC 2 1026 ) , and pulsed field gel electrophoresis ( PFGE ) , were compared with a previously performed method of DNA fingerprinting by AFLP ( amplified fragment length polymorphism analysis ) for their performance in the typing of blood isolates of Staphylococcus epidermidis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A minimal tiling set of the clones we have mapped will facilitate both the assembly of the DNA sequence of the chromosome and a functional analysis of its genes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of guidelines that utilises duplication of results to interpret profiles originating from picogram levels of DNA is introduced . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA damage was lowered in the presence of SOD and catalase or DMSO , indicating a set of reactions that leads to oxy radical generation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Amplification of DNA was carried out using a primer set which amplified a region of the mitochondrial cytochrome b gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the first amplification step the same set of primers were used to amplify a conserved DNA region of the large T antigen gene of JCV , BKV and SV 40 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To investigate whether Raf 1 mutation is involved in our set of tumor especially those without ras mutations , the PCR based single strand conformation analyses ( SSCA ) and direct DNA sequencing were employed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA microarray hybridization experiments revealed a limited set of yeast genes differentially expressed under growth conditions of excess copper or copper deficiency . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A phase sensitive gel mobility shift assay , using a set of DNA fragments with a sequence directed bend and a single methyltransferase binding site , indicated that M . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genes which confer a disease when mutated , or for which population variability contributes to a quantitative trait such as longevity or disease susceptibility , can be localized in the genetic map by use of an appropriately dense set of polymorphic DNA markers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This method helped us to characterize a new set of amplification primers , which permitted amplification of virtually all of the coding sequence of ABCA 1 and its intron exon boundaries with a single DNA amplification program . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An algorithm , `` MobyDick , ' ' is presented that decomposes a set of DNA sequences into the most probable dictionary of motifs or words . ^^^ This method is applicable to any set of DNA sequences : for example , all upstream regions in a genome or all genes expressed under certain conditions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of four aniline mustards ( both mono and bifunctional ) linked to a DNA affinic 9 aminoacridine ( 9 AA ) carrier was used , together with the untargeted mustards chlorambucil ( CHL ) and its half mustard , and the DNA binding carrier , 9 AA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This is the first study in which accumulation both of uncleaved replication intermediates and of B capsids has been obtained in the presence of the full set of proteins required to package virus DNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA topoisomerases and DNA site specific recombinases are involved in a diverse set of cellular processes but both function by making transient breaks in DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
PCR amplification was carried out using a set of primers designed from the DNA nucleotide sequences reported for alpha actins from humans and various animals . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of oligonucleotide primers 1 and 2 was developed by analyzing the specificity of a cloned kinetoplast DNA ( kDNA ) fragment of Leishmania donovani and sequencing the fragment . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here we have characterized variation in gene expression patterns in a set of 65 surgical specimens of human breast tumours from 42 different individuals , using complementary DNA microarrays representing 8 , 102 human genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Comparison of the detection of oncogenic human papilloma virus ( HPV ) DNA by hybrid capture tube test with smears classified as negative , ASCUS , or SIL revealed that seven of eight reviewers did not demonstrate a stronger association between HPV detection and cytologic diagnosis in the posttest set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Furthermore , we analyzed the relative in vitro DNA binding activity , the stimulatory potency on the AP 2 dependent APOE promoter , as well as the ability to inhibit the effect of the wild type protein of each one of a set of single site substitution AP 2 mutants spanning the identified region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The repetitive sequence probe is clearly able to discriminate between the genomic DNA of both species in Southern analysis , and effectively ' paints ' only the chromosome set of L . perenne in diploid and triploid hybrids with L . temulentum . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Of the 48 oocytes with one set of DNA , 48 % were haploid , 44 % were aneuploid for one or more chromosomes , and 8 % were polyploid . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have reported the application of MVR PCR at minisatellite MS 32 ( D1S8 ) and MS31A ( D7S21 ) in a paternity case lacking a mother and showed that it resulted in higher paternity probabilities than for a set of 12 other DNA markers including six STRs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sequencing analysis of 7364 bases of the pFV 1 and 6861 bases of the pFV 2 revealed that the both plasmids had one set of two open reading frames ( ORFs ) each of that encoded putative DNA and RNA polymerases similar to those of mitochondrial plasmids in other filamentous fungi . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Amplification of DNA isolated from muscle samples was carried out using a set of primers flanking a region of 436 bp from the mitochondrial 12S rRNA gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Microsatellite size was established by comparison to M13mp18 DNA ladder and a documented set of four bovine controls . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : We used polymerase chain reaction from three pairs of primers to amplify different regions of the large T antigen from DNA from cell lines and cDNA from both cell lines and an independent set of tumour biopsies from patients with mesothelioma . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In eukaryotic cells , DNA transactions such as replication , repair , and transcription require a large set of proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the puromycin group , the DNA content of the PN of parthenogenones with 1PN2PB was half that of a set of metaphase 2 chromosomes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of six bacterial artificial chromosomes ( BACs ) representing a 431 kb contiguous region of chromosome 2 of A . thaliana was mapped on both chromosomes and DNA fibers of B . rapa . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A well supported molecular phylogeny for North American Gryllus species based on a combined data set of mitochondrial ( mt ) DNA is presented . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The advantage of these assays is that they can quantitatively determine over several orders of magnitude the types of mutations that occur under a given set of conditions , without DNA sequencing . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Broad spectrum HPV DNA amplification and genotyping was performed with the SPF 10 primer set and line probe assay ( LiPA ) , respectively . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The codon degeneracy model ( CDM ) predicts relative frequencies of substitution for any set of homologous protein coding DNA sequences based on patterns of nucleotide degeneracy , codon composition , and the assumption of selective neutrality . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of Hox proteins interact with the Maf oncoprotein to inhibit its DNA binding , transactivation , and transforming activities . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Such analyses have revealed a number of surprises : novel DNA structural features of the circular genome such as the displacement loop ( D loop ) ; multiple sized and deleted forms of the circular genome ; a minimal set of mitochondrially encoded rRNAs and tRNAs needed for translation ; a bacteriophage like , nuclear encoded mitochondrial RNA polymerase for transcription ; and a direct linkage between transcription and the commitment to replication of the leading mtDNA strand that centres on the nuclear encoded mitochondrial transcription factor A . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : A set of 30 genes clustered with the previously characterized blmAB resistance genes were defined by sequencing a 85 kb contiguous region of DNA from S . verticillus ATCC 15003 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
TTV DNA was amplified by polymerase chain reaction ( PCR ) by using two different sets of primers : one based on the sequence of the original N 22 clone within the open reading frame 1 ( set A ) and the other derived from the untranslated region ( set B ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Of three sets of siblings , two unrelated sets of twins , ages 33 and 37 months , were negative for fecal TTV DNA , while the third set of siblings , ages 99 and 35 months , was positive . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For elimination of DNA damage , a set of repair mechanisms , mainly photoreactivation , excision , and recombination repair , has evolved . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The eventual set of approximately 3 , 000 Ccap BACs should facilitate the production of BAC containing DNA chips for assessing copy number of genomic segments by matrix comparative genomic hybridization . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A combined data set of DNA sequences ( 6021 bp ) from five protein coding genes of the chloroplast genome ( rbcL , atpB , psaA , psaB , and psbC genes ) were analyzed for 42 strains representing 30 species of the colonial Volvocales ( Volvox and its relatives ) and 5 related species of green algae to deduce robust phylogenetic relationships within the colonial green flagellates . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Eukaryotic cells activate an evolutionarily conserved set of proteins that rapidly induce cell cycle arrest to prevent replication or segregation of damaged DNA before repair is completed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Nuclear domains called ND 10 ( nuclear domain 10 ) are discrete nuclear protein aggregations characterized by a set of interferon upregulated proteins including Sp 100 and PML , where papova , adeno , and herpesviruses begin their transcription and DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
SSCP ( single stranded conformation polymorphism ) offers a sensitive but inexpensive , rapid , and convenient method for determining which DNA samples in a set differ in sequence , so that only an informative subset need be sequenced . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An overlapping set of DNA elements in the rat aldolase B gene origin / promoter regulates transcription and autonomous replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : By single stranded conformational polymorphism ( SSCP ) and DNA sequencing analyses , we screened exon 3 of beta catenin from a panel of 81 primary tumors obtained at radical prostatectomy , 22 lymph node metastases from untreated patients , and a unique set of 61 metastatic tissues from 19 patients who died of hormone refractory disease . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This paper introduces two exact algorithms for extracting conserved structured motifs from a set of DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In physical mapping , one orders a set of genetic landmarks or a library of cloned fragments of DNA according to their position in the genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set of partial complementary DNA clones identified in this screen was found to encode a protein kinase , nerve injury associated kinase . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To examine the potential for DNA recovery from spirit preserved medical material , a set of specimens from the Hunterian Collection of the Royal College of Surgeons was investigated . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Centromeric region of human chromosome 21 comprises two long alphoid DNA arrays : the well homogenized and CENP B box rich alpha 21 1 and the alpha 21 2 , containing a set of less homogenized and CENP B box poor subfamilies located closer to the short arm of the chromosome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the first restriction pattern , observed in UT 7 cells , the single stranded viral DNA was converted to double stranded replicative intermediates , identical to those found in bone marrow cells , and a full set of viral transcripts were observed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The practical motivation for our algorithm is oligonucleotide fingerprinting , a method for the simultaneous identification of sequences ( cDNA or genomic DNA ) by their hybridisation tags according to a set of short probes such as octamers , although the algorithm is of course not restricted to that application . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of fluorescently labeled DNA probes that hybridize with the target RNA and produce fluorescence resonance energy transfer ( FRET ) signals can be utilized for the detection of specific RNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Of special interest is the feature that this family of proteins has modular structures and can recognize a diverse set of DNA sequences in a sequence specific manner . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
STUDY DESIGN AND METHODS : The sera of 289 blood donors were tested for the presence of TTV DNA by two PCR systems detecting genes located in the 5 ' UTR ( primer set A [ Set A ] ) and the open reading frame ( ORF 2 ) ( primer set B [ Set B ] ) of the viral genome . ^^^ The specificity of TTV DNA amplification was confirmed by sequencing 10 PCR products obtained with each set of primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In our study , a comparative analysis of the DNA at centromeric regions of Beta species , including cultivated and wild beets , was performed using a set of repetitive DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A single primer set ( 23F ) amplified DNA from all of the positive samples , suggesting that PCR could be used as a rapid postmortem assay for these viruses . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using this data set and previously determined ADH : sequence data , DNA variation was analyzed in a 4 . 4 kb region of the locus . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The experimental performance of the two schemes using two sets of human DNA sequences as well as another set of Gaussian data indicates that proposed schemes have the potential of significantly improving accuracy of neural networks to recognize rare events . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To test if p 53 regulates repair of the dG C 8 ABP adduct in genomic DNA , an isogeneic set of cell lines was obtained by infection of the TCC 10 cultures with a retroviral construct expressing a trans dominant mutant of p 53 , namely a Val > Ala mutation at codon 143 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A data set that combined in a tandem alignment these two sets of noncoding DNA orthologues from the two unlinked nuclear genomic loci yielded the following confirmatory results both on the course of cladistic branchings ( the divisions in a cladistic classification of higher ranking taxa into subordinate taxa ) and on the ages of the taxa ( each taxon representing a clade ) . ^^^ Rates of noncoding DNA evolution were assessed using a data set of noncoding gamma sequence orthologues that represented 18 catarrhines , 16 platyrrhines , 3 non anthropoid primates ( 2 tarsiers and 1 strepsirhine ) , and rabbit ( as outgroup to the primates ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this study , we report the development of a ( 32 ) P postlabeling / HPLC method for detection of ( 1 ) two DHR 3 ' dGMP and four DHR 3 ' dAMP adducts and ( 2 ) a set of eight DHR derived DNA adducts in vitro and in vivo . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This may result either in triploid offspring if the whole haploid chromosome set of the sperm fuses with the diploid egg nucleus or in siblings with microchromosomes if only subgenomic amounts of paternal DNA are included . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Because of a set of exceptional chemical , physical , and biological properties , polyamide or peptide nucleic acids ( PNAs ) hold a distinctive position among various synthetic ligands designed for DNA targeting purposes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
On the other hand , under the identical set of experimental conditions of light and drug dose , the DNA ( pBR 322 ) photocleavage abilities of these ruthenium ( 2 ) complexes follow the order [ Ru ( phen ) 2 ( dicnq ) ] 2+ > [ Ru ( phen ) ( dicnq ) 2 ] 2+ > > [ Ru ( dicnq ) 3 ] 2+ , an order which is the same as that observed for their MLCT emission quantum yields . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA sequence polymorphisms provided a significant phylogenetic signal and no homoplasy for each data set , yielding completely and significantly congruent phylogenies for these four genomes and no evidence of horizontal transmission . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA from blood from 53 monkeys housed at the Stichting AAP Shelter for Exotic Animals , all Old World monkeys , was amplified by polymerase chain reaction ( PCR ) with a primer set spanning approximately 390 nucleotides of the mitochondrial 12S rRNA gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To circumvent some of these difficulties , we designed a vector set that directs the in vivo production of single stranded DNA ( ssDNA ) of a desired target sequence with limited extraneous vector nucleotide sequences . ^^^ To test this expression system , we constructed a plasmid set , pssXA / pssXB that produces ssRNA cleaving DNA 10 23 enzyme ( Santoro , S . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of primers designed for 4 different genes encoding the alpha , beta , epsilon , and iota toxins was used in a single reaction with a sensitivity of gene detection of 200 fg for DNA extracted from pure culture . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Polymorphic DNA markers applied were individual haplotypes constructed using a set of restriction enzyme sites within or close to the genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When a similar array hybridization analysis with DNA probes from different strains was used , a set of M 13 clones which carried sequences present in the majority of human P . aeruginosa isolates from a wide range of clinical sources was identified . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the study reported here , a set of oligonucleotide primers of 21 and 24 bases was used in Taq PCR to amplify DNA from S . aureus ( isolates from bovine mastitis ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 72 DNA samples from 60 M . tuberculosis clinical isolates was analyzed for the presence or absence of these insertion sites , and the assay was found to be highly reproducible . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of nested primers amplified a 377bp fragment specifically with A . pleuropneumoniae DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To confirm the co localization of cellular DNA fragmentation in germ cells and each NOS , each set of consecutive testis sections ( one stained for cellular DNA fragmentation and the others for each NOS ) were examined . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
MOSAIC is a set of tools for the segmentation of multiple aligned DNA sequences into homogeneous zones . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here we describe Gene2EST ( http : / / woody . embl heidelberg . de / gene2est / ) , a server that brings together a set of tools enabling efficient retrieval of ESTs matching large DNA queries and their subsequent analysis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
However , using the amplified fragment length polymorphism ( AFLP ) DNA fingerprinting technique with three different primer combinations , small but clear reproducible differences between the banding patterns of the autoaggregative mutants and their non autoaggregative parent strains were observed for each primer set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The predictive power of the method is demonstrated and tested via comparisons with DNA bending data on sets of sequences not included in the training set , including A tracts with and without periodic helix phasing , phased A4T4 and T4A4 motifs , a sequence with a phased GGGCCC motif , some `` unconventional ' ' helix phasing sequences , and three short fragments of kinetoplast DNA from Crithidia fasiculata that exhibit significantly different behavior on non denaturing polyacrylamide gels . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 90 nonpolypotic colon cancer families in which germ line mutations of MSH 2 and MLH 1 had been excluded were screened for mutations in two additional DNA mismatch repair genes , MSH 6 and MSH 3 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In vitro evaluation of the probe set was done including all Enterococcus type strains , and a selection of other representatives of the gram positive bacteria with a low genomic DNA G+C content . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To design a new set of PCR primers located on the two flanking regions of the gene , the genomic DNA was sequenced by SUGDAT method ( sequencing using genomic DNA as a template ) upstream or downstream from the respective partial gene sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Based on alignment of the cDNA sequence with the mouse genomic sequence , a local primer set was designed , incorporating the variable position , and was found to give very good amplification with brown trout genomic DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Five haplotype structures , spanning the two IL 8 DNA segments , were unambiguously defined for the set of seven IL 8 SNPs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The isolated spores were morphologically characteristic of microsporidial ones in chromotrope stain , and proven to be E . cuniculi by a polymerase chain reaction ( PCR ) with a species specific primer set and by direct DNA sequencing of the PCR products . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The fabricated DNA biosensor was used to detect a set of real samples . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The proposed computational scheme uses crystallographic information to define the set of amino acid base contacts between the proteins of a given DNA binding protein family and their DNA targets . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA microarray data set can be viewed as a set of mutually associated genes in a high dimensional space . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a second set of experiments , CB derived progenitor cells were incubated with interleukin ( IL ) 3 , stem cell factor ( SCF ) and granulocyte colony stimulating factor ( G CSF ) and their cell cycle status assessed both by the cytosine arabinoside ( Ara C ) suicide approach and by flow cytometric DNA analysis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To overcome these difficulties , we developed an improved PCR protocol using a set of primers designed to amplify a rather stable , highly repetitive D . repens specific genomic DNA target . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this study , we examined the DNA binding regions of MDP 1 by using a set of synthetic peptides . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When three primer sets were used two gene specific sets for the alpha 1 and alpha 2 globin genes and one set for the beta actin gene ( serving as an internal control ) PCR products from genomic DNA were simultaneously amplified and analyzed after coamplification and gel electrophoresis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The amino acid sequence of the protein portion of mp 58 as deduced from the DNA sequence of its encoding gene ( FBP1 / PRA1 ) was used to synthesize a complete set of overlapping dodecapeptides ( overlap , 7 ; offset , 5 ) covalently attached to the surface of derivatized polyethylene pins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The common methods used to monitor DNA fragmentation and cell morphology as markers of apoptosis have their own set of advantages and disadvantages . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To elucidate the impact of matrix chemical and physical properties on DNA sequencing separations by capillary electrophoresis ( CE ) , we have synthesized , characterized and tested a controlled set of different polymer formulations for this application . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA analysis of one set of parents demonstrated that the father carried the missense mutation and the mother carried the IVS 8 1G > C mutation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The extreme resistance of D . radiodurans to the DNA damaging factors is defined by 1 ) repair mechanisms which fundamentally differ from those in other procaryotes ; 2 ) ability to increase the efficiency of a standard set of the DNA repairing proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By modifying sample pretreatment , viral mRNA or DNA sequences can be detected using the same set of oligonucleotide probes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our results provide an unusual view of the pervasiveness of DNA alterations , in this case an epigenetic change , in human cancer and a powerful set of markers to outline the disruption of critical pathways in tumorigenesis and for derivation of sensitive molecular detection strategies for virtually every human tumor type . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We designed a single set of degenerate primers which enables the PCR amplification of an approximately 1300 bp DNA fragment spanning both conserved ( the RepA gene ) and variable ( the long intergenic region and MP gene ) portions of these viruses ' genomes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These approaches involve cotransfection of amplicon plasmid DNA with either a five cosmid set or a bacterial artificial chromosome ( BAC ) that contains the HSV genome without its cognate pac signals . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Furthermore a set of hot spot mutants of p 53 bearing mutations in the DNA binding domain had no post transcriptional inhibitory effect . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These genes function in a diverse set of pathways that involve the recognition and removal of DNA lesions , tolerance to DNA damage , and protection from errors of incorporation made during DNA replication or DNA repair . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To identify a set of genes involved in the development of colorectal carcinogenesis , we compared expression profiles of colorectal cancer cells from eight tumors with corresponding noncancerous colonic epithelia using a DNA microarray consisting of 9216 human genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : The primer and probe sets have been shown to be 100 % specific for their respective species ; there was no crossreaction between any set and human DNA , or extracts from other candida species , fungal , bacterial , or viral pathogens tested . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A complete set of late competence genes is present , indicating the ability of L . lactis to undergo DNA transformation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The following properties of the polymerase render it appropriate for this application : ( 1 ) the phi 6 polymerase can replicate a number of single stranded RNA templates in vitro . ( 2 ) In contrast to the primer dependent DNA polymerases utilized in the sequencing procedure by Sanger et al . ( Proc Natl Acad Sci USA , 1977 , 74 : 5463 5467 ) , it initiates nascent strand synthesis without a primer , starting the polymerization on the very 3 ' terminus of the template . ( 3 ) The polymerase can incorporate chain terminating nucleotide analogs into the nascent RNA chain to produce a set of base specific termination products . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here , we have correlated a specific set of Alu repetitive DNA elements , known to be the basis of certain genetic defects , with their phylogenetic roots in primate evolution . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : Polymerase chain reaction ( PCR ) was used to amplify the genomic DNA of rat , with a set of specific primers designed according to the cDNA sequence of ALR . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The polymerase chain reaction technique was used with a first primer set to check whether DNA extraction was successful , and with a second primer set specific for BPV DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Such a conclusion is corroborated by chemical shift mapping experiments of XPA EM with a single strand DNA oligomer , dCCAATAACC ( d 9 ) , that show the same set of 15N / 1H HSQC cross peaks are effected by the addition of DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The analysis of completed archaeal genome sequences led to the identification of a set of approximately 10 20 genes whose protein products were inferred to be involved in chromosomal DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Getting the appropriate set of sequences for your research : how to use sequence retrieval system on DNA Data Bank of Japan ( DDBJ ) ] . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We prepared an extensive set of DNA restriction fragments , irradiated them with UV light , and detected crosslinked complementary strands by electrophoresis in denaturing agarose gels . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Both regulators bind as homodimers to DNA fragments containing a complete set of regulatory elements , while removal of either repeat , or alterations in the length of the spacer region , significantly weakened binding of both protein dimers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Nevertheless , harmonization has been achieved regarding the DNA information stored in national databases , and a European standard set of genetic systems has been recommended which is included either in part or completely in the DNA profiles of offenders and crime stains for all European databases . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A generic RT primer set containing two dengue specific anti sense primers ( DV L 1 and DV L 2 ) could be used to transcribe extracted viral RNA of all four dengue virus types to complimentary DNA ( cDNA ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sixty four Histocompatibility Workshop cell lines and 150 DNAs provided by the UCLA DNA exchange were investigated by the DPB 1 primer set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The set of 11 483 genes identified in mouse preimplantation embryo development provides the starting point for the design of DNA microarrays targeted at early mammalian embryogenesis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Guidelines published by the Scientific Working Group for DNA Analysis Methods , a working group of DNA forensic experts in the United States , are used to set the format for the written protocol on interpretations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Construction of nested set of unidirectional deletion of recombinant plasmid DNA for sequencing ] . ^^^ In order to rapidly sequence a batch of large DNA fragments , we developed a method for the construction of nested set of unidirectional deletions . ^^^ A nested set of unidirectional deletions of the large DNA fragment of a c type retrovirus gene was successfully constructed by the adoption of this method . ^^^ The DNA was digested with Exo 3 from 5 ' overhanging end to generate a set of unidirectional deletion . ^^^ With the use of this method a set of deleted plasmid DNA and the deleted target DNA excised from the deleted constructs were observed on agrose gel electrophoresis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a set of in vivo experiments , the levels of alpha subunit of the insulin receptor , the insulin receptor substrate 1 ( IRS 1 ) and the phosphatidylinositol 3 kinase ( PI3K ) were determined . [ 3H ] thymidine incorporation into DNA 24 or 48 h after surgery was assessed in all the experimental groups . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
With this set , therefore , we could easily and rapidly amplify complete mitochondrial genomes with small amounts of arthropod DNA . ^^^ Thus , this primer set can serve various research fields , such as molecular evolution , population genetics , and molecular phylogenetics based on DNA sequences , RFLP , and gene rearrangement of mitochondrial genomes in arthropods and other invertebrates . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We consider construction of a set of smaller 4 10 4 matrices to represent DNA primary sequences which are based on enumeration of all 64 triplets of nucleic acids bases . ^^^ Construction of similarity / dissimilarity tables based on different invariants for a set of sequences of DNA belonging to the first exon of the beta globin gene of eight species illustrates the utility of newly formulated invariants for DNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We tested whether the LB model accurately predicts experimentally deduced curvature angles and helical repeat parameters for DNA sequences not in its training set , particularly when challenged with quantitative data and subtle sequence phasings . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Transient expression assays with a set of deletion clones containing the putative SpliNPV non hr origin of DNA replication permitted functional characterization of sequence elements within the origin fragment . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Origins with the distal set were inactive unless the adjacent P 1 DNA sequences beyond the boxes were included . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The IgL set fusion sequence was not found in cDNA preparations and genomic DNA of the immunoblastic HIV associated B NHL . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genetic markers were developed and used to map a subset of 17 genes , selected on the basis of function or of the ability to design primers that successfully amplified porcine genomic DNA , to 10 different porcine chromosomes , providing a set of mapped markers corresponding to genes expressed during conceptus elongation . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genomic bacterial DNA from type strains and wild type B . cepacia complex isolates of previously determined genomovar status was amplified employing these four primer pairs , as well as a fifth primer set ( E ) already published . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Once bound to its recognition DNA sequence termed antioxidant responsive element or Maf recognition element , Nrf2 / small Maf induces a set of antioxidative stress genes , including heme oxygenase 1 and gamma glutamylcysteine synthetase , whose products have been demonstrated to contribute to the scavenging of reactive oxygen species and to exhibit anti inflammatory effects . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analysis of the sequence revealed a set of features conserved in all rpoN genes and flanking DNA regions previously analysed in other bacterial species . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The mechanistic approach through a set of biomarkers during the first year included age , condition , somatic growth , liver , gonad , and spleen weights , and a number of other physiological variables , in addition to ethoxyresorufin O deethylase , glutathione S transferase , glutathione reductase , catalase , and the formation of DNA adducts in the liver . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : We showed that the average predictive accuracy of JTEF is higher than the presently available best programs ( GenScan and Genemark . hmm ) based on a test set of 65 human DNA sequences with 121 genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The purposes of this study are to present a set of 10 adjustments derived from a single large study that optimizes the prognostic strength of both DNA ploidy and S phase and to test the validity of this approach on two other large multicenter studies . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The yeast SET domain protein Set1p regulates chromatin structure , DNA repair , and telomeric functions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In another set of experiments , the tamarin DNA hybridizing to the mouse semenoclotin gene was investigated . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using this system , we have previously identified , from HeLa cells , template activating factor 1 as a stimulatory factor for the Ad core DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
On the other hand , the test did not reject the hypothesis of clonality when applied to a data set from the coding region of human mitochondrial DNA , despite its high level of ARH and homoplasy . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A collective variable model for DNA structure is used to predict the conformation of a set of 30 octamer , decamer , and dodecamer oligomers for which high resolution crystal structures are available . ^^^ We find that the number of local minimums is highly sequence dependent , with certain sequences having a set of minimums that span the entire range between canonical A and B DNA conformations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The method is compared with established detection methods on a set of synthetic benchmark sequences and two real world DNA sequence alignments . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
TmHU has higher affinity for DNA containing a set of 4 nt loops separated by 9 bp ( K ( d ) =1 . 4 ( + / 0 . 3 ) nM ) , consistent with its introduction of two DNA kinks . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A pooled DNA strategy was used to facilitate rapid polymerase chain reaction screening of markers in the Weber v8 . 0 genome screening set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Matrix attachment regions ( MARs ) comprise a set of AT rich DNA elements postulated to interact with the nuclear scaffold and to mediate long distance interactions between LCR elements and their target promoters . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : Nine of 32 patients with OA ( 28 . 1 % ) had evidence for bacterial DNA in joint tissues with at least one set of primers for Chlamydia : 7 for C . trachomatis ( 21 . 9 % ) , 2 for C . pneumoniae ( 6 . 2 % ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The assay was used to genotype 10 SNPs from a set of 192 genomic DNA samples in a high throughput format . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Polymorphic Alu insertions provide a set of DNA markers of interest in human population genetics . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We also designed a new pmoA targeting primer set which could be used in a nested protocol to amplify PCR products from DNA extracted directly from the soil . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The phylogenetic relationships of thirteen Diabrotica ( representing virgifera and fucata species groups ) and two outgroup Acalymma beetle species ( Coleoptera : Chrysomelidae ) were inferred from the phylogenetic analysis of a combined data set of 1323 bp of mitochondrial DNA ( mtDNA ) cytochrome oxidase subunit 1 ( COI ) and the entire second internal transcribed spacer region ( ITS 2 ) of nuclear ribosomal DNA of 362 characters . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of DNA primers was designed within the DNA binding domain of the Manduca hormone receptor 3 ( MHR 3 ) cDNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In addition , both 16S rRNA and 16S ribosomal DNA ( rDNA ) were retrieved using a PCR primer set specific to type 1 methanotrophs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a set of 40 samples , without knowledge of the HPV DNA status in the corresponding cervical carcinomas , we could detect 8 ( 20 % ) positive samples , of which 7 ( 17 . 5 % ) were HPV 16 and 1 ( 2 . 5 % ) was HPV 18 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Ag protein contents , integral area and number of nucleoli in polyploidizing nuclei of gonadal nutrient cells of the snail Succinea lauta were estimated on the squashed preparations by means of morphometry and cytophotometry . 8 NORs of different size were found in haploid chromosome set of prophase spermatocytes ( n = 22 ) , but usually 1 2 nucleoli per 2c DNA are present in the nutrient cell nuclei . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A sequenced collection of plasmid borne random fusions of Escherichia coli DNA to a Photorhabdus luminescens luxCDABE reporter was used as a starting point to select a set of 689 nonredundant functional gene fusions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This primer set allowed the amplification of complete 5S DNA units and was used to isolate SS Rrna A 1 sequences from polyploid and diploid wheat species . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The markers were set up for subsequent detection of hybrids and introgression of wheat DNA into wild relatives . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The genome sizes in a set of triploid Musa cultivars or clones were quite different , with 2C DNA values ranging from 1 . 61 to 2 . 23 pg . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of pea DNA sequences representing the most abundant genomic repeats was obtained by combining several approaches . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
New investigations on laid eggs and ovariole squashes , either DAPI stained or FISH labeled , revealed that in hybridogens the `` grandii ' ' set is excluded from the germ line prior to meiosis and that a DNA extra synthesis should occur to produce hemiclonal eggs after two cytologically normal meiotic divisions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have shown that a set of highly purified mitochondrial proteins , including AP endonuclease ( APE ) , DNA polymerase gamma , and mtDNA ligase , is capable of efficiently repairing abasic ( AP ) sites in mtDNA . ^^^ Thus , it is evident that the scope of DNA repair activities undertaken within mitochondria is determined by the set of nucleus encoded DNA repair enzymes that are capable of being imported into the organelle . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The purified SET complex required only GzmA to reconstitute single stranded DNA nicking in isolated nuclei . ^^^ The SET complex contains a 25 kDa Mg ( 2+ ) dependent nuclease that degrades calf thymus DNA and plasmid DNA . ^^^ Thus , GzmA activates a DNase ( GzmA activated DNase ) within the SET complex to produce a novel form of DNA damage during cytotoxic T lymphocyte mediated death . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In addition , a nested PCR protocol using two sets of primers in the glycoprotein D gene , one set internal to the other , was evaluated for the amplification of HSV DNA in cerebrospinal fluid ( CSF ) from patients suspected of having herpes simplex encephalitis ( HSE ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
First , incremental truncation for the creation of hybrid enzymes is used to create a comprehensive set of fusions between fragments of genes in a DNA homology independent fashion . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We found that DNA damage accumulated in response to chronic irradiation and persisted in a unique set of epidermal cells located at the basal layer . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a second set of experiments , with a group of 13 subjects , DNA repair kinetics were assessed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : We have used NMR spectroscopy and restrained molecular dynamics to determine a set of structures of the AlcR DNA binding domain [ AlcR ( 1 60 ) ] in complex with a 10 mer DNA duplex . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We found that treatment of MDA MB 453 human breast cancer cells with adriamycin ( also known as doxorubicin , a DNA topoisomerase IIalpha inhibitor ) induced a series of time dependent events , including the mitochondrial release of cytochrome c and apoptosis inducing factor , mitochondrial membrane depolarization , activation of a set of caspases ( caspase 9 , 3 , 7 , 2 , and 8 ) , cleavage of poly ( ADP ribose ) polymerase ( PARP ) , and up regulation of expression of the Fas ligand . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Several of these repeats were found to vary considerably in length in the set of genomic DNA tested . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using Sanger sequencing reactions , we have also developed a method for preparing nested 3 ' deletion sets from a target and evaluated the use of stem loop DNA arrays for detecting p 53 mutations in the deletion set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It is possible to accurately and quantitatively analyze SNPs using a set of primers that correspond to the wild type and mutant DNA segments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It was concluded that the nested multiplex primer set was the most optimal primer set to use for the detection of malaria DNA extracted from blood samples . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
TTV DNA was detected from blood by a semi nested PCR assay , and a selected set of PCR products was genotyped by direct sequencing . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Among the hundreds of genes whose expression was affected by Mec1p , one set of genes appears to represent an MEC 1 dependent expression signature of DNA damage . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Gas phase metal affinities of DNA and RNA bases for the Na ( + ) and K ( + ) ions were determined at density functional level employing the hybrid B3LYP exchange correlation potential in connection with the 6 311+G ( 2df , 2p ) basis set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An opportunity to control the DNA protection against radiation in cells and the formation of 2 desoxyribose residue epimers ( sites of potential point mutations ) by using a set of free radical scavengers differing by parameters of availability ( molecular mask and access window ) is discussed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A collection of backcross lines containing ml o alleles derived from six barley genotypes allowed us to identify a set of DNA markers very tightly linked to the resistance locus . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA samples extracted from the matched tumour and normal tissues of nine twin pairs were analysed for allelic imbalance using a set of microsatellite markers on chromosomes 1 , 13 , 16 and 17 , containing loci with known tumour suppressor genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The second internal transcribed spacer ( ITS 2 ) of ribosomal DNA is amplified by polymerase chain reaction ( PCR ) from any of the seven species using a single set of oligonucleotide primers ( of which the reverse one is fluorescently labelled ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This paper deals with phylogenetic relationships among a set of 90 clinical strains representative of the worldwide diversity of the Mycobacterium tuberculosis complex ( Kremer et al . 1999 ) using eight independent genetic markers : IS 6110 , IS 1081 , the direct repeat ( DR ) locus , and five variable number of tandem DNA repeat loci ( VNTR ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of primer pairs labeled with ROX was developed to amplify 12 DNA fragments , 58 417 bp , derived from a conserved region of plant chloroplast DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The PCR was shown to amplify a set of DNA molecules exhibiting significant sequence differences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of overlapping cosmids corresponding to the entire genome of RRV was capable of complementing oriLyt dependent DNA replication only when additional ORF 50 was supplied as an expression plasmid in the transfection mixture , suggesting that the level of ORF 50 protein originating from input cosmid DNA was insufficient . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In contrast , MVMi did not complete its life cycle in any of the human nervous cells , though it efficiently killed the astrocytic tumor cells by two types of nonproductive infections : ( 1 ) normal synthesis of all viral macromolecules with a late defect in infectious virion maturation and release to the medium in U 373 ; and ( 2 ) high levels of accumulation of the full set of viral messenger RNAs and of both nonstructural ( NS 1 ) and structural ( VP 1 and VP 2 ) proteins , under a very low viral DNA amplification , in U 87 and SW 1088 cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
GST PRIME primer pairs were tested on a set of 1900 Arabidopsis genes coding for chloroplast targeted proteins : 95 % of the primer pairs used in PCRs with genomic DNA generated the correct amplicons . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Deletion analysis demonstrates that the responsive region is composed of two separate DNA binding elements , a set of overlapping GC boxes , which bind BMP regulated Smads upon BMP stimulation , and three repeats of CAGAC boxes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We used a set of autosomal DNA markers , mtDNA restriction site polymorphisms ( RSPs ) and mtDNA hypervariable segment 1 ( HVS 1 ) sequence polymorphisms in this study . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The probe was prepared by PCR amplification of the Korean mistletoe DNA using a primer set designed on the basis of amino acid sequences of the Korean mistletoe lectin that we had purified and reported . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We address the following issues : the number of protein coding genes in the human genome and certain classes of noncoding repeat elements in the genome ; features of genome evolution , including large scale duplications ; an overview of the predicted protein set to highlight prominent differences between the human genome and other sequenced eukaryotic genomes ; and DNA variation in the human genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Whereas D ( B ) is indeed the structure generally defined as D DNA , a critical analysis based on a comparison between different possible DNA double helices leads us to propose dihedral angles , a set of atomic coordinates and a stereo view of another new form of D DNA , the D ( A ) structural model . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the present study , additional sequences flanking this segment were determined from a PCR product successfully amplified using a set of known degenerate primers , which covered a 692 bp region within the tortoise herpesviral DNA polymerase gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this study , using a chub ( Leuciscus cephalus ; Cyprinidae ) mitochondrial DNA data set ( 13 populations in Western Greece , 14 haplotypes ) , we compare three distinct ' historical ' methods that could possibly infer relative importance of basic evolutionary mechanisms ( isolation vs migration ) shaping genetic variation : the nested clade analysis , the psi test and the ' mismatch distributions ' . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Within a basic geometric modeling of the chromatin assembly , we give a complete set of elastic constants ( twist and bend persistence lengths , stretch modulus and twist stretch coupling constant ) of the so called 30 nm chromatin fiber , in terms of DNA elastic properties and geometric properties of the fiber assembly . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of DNA probes for FISH included : ( 1 ) centromeric alphoid DNA probes for chromosomes 7 , 8 , 13 and 21 , 18 , 10 and Y ; ( 2 ) classical satellite DNA probes for chromosomes 1 and 16 ; and ( 3 ) region specific DNA probes for chromosomes 13 , 21 and 22 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : The first set of primers revealed TTV DNA in 73 % of thalassemic patients , in 8 % of healthy children , and in 5 % of healthy blood donors . ^^^ With the second set of primers , the prevalence of TTV DNA was , respectively , 100 % in thalassemic patients , 44 . 5 % in healthy pediatric patients , and 87 % in healthy blood donors . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We used partial DNA sequences of the mitochondrial ND 2 gene and a set of morphological characters to study their phylogenetic relationships . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Previous studies demonstrated that a 23 . 3 kb S . putrefaciens wild type DNA fragment conferred metal reduction capability to a set of respiratory mutants with impaired Fe ( 3 ) and Mn ( 4 ) reduction activities ( T . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The use of a primer set targeted for an intron containing sequence or RNA extract without contaminating DNA has been established to overcome this problem . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a second prospective routine test set analysis , 66 more CIN lesions ( 14 CIN 1 , 15 CIN 2 , and 37 CIN 3 ) were routinely graded ( also by six different pathologists , routine CIN grade=CIN ( ROUT ) ) , studied for oncogenic HPV DNA , and graded by quantitative Ki 67 features ( quantitative pathological CIN grade=CIN ( QP ) ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These data suggest that Xenopus SET is able to bind to specific DNA sequences to activate transcription at all stages of Xenopus oogenesis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
ATP dependent DNA ligases , NAD ( + ) dependent DNA ligases , and GTP dependent RNA capping enzymes are members of a covalent nucleotidyl transferase superfamily defined by a common fold and a set of conserved peptide motifs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The recognition sites can activate transposition of non Mu DNA sequences if a complete set of Mu sequences is not available . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA from each sample was amplified by the polymerase chain reaction using a specific set of oligonucleotide primers developed against the 16S ribosomal RNA coding sequence of T . whippelii . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the second , a set of experimental results for the removal of endotoxin from DNA is used . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
TTV DNA was amplified by PCR using two different sets of primers : one derived from the original N 22 sequence ( Set A ) and the other from the untranslated region ( Set B ) . ^^^ The prevalence of TTV DNA detected by primers Set A and that detected with either Set A or B were similar among patients with autoimmune hepatitis ( 4 / 20 and 16 / 20 , respectively ) and controls ( 9 / 50 and 40 / 50 , respectively ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sequence analysis of the complete region and subsequent association analyses revealed that a DNA variant , C / T 13910 , roughly 14 kb upstream from the LCT locus , completely associates with biochemically verified lactase non persistence in Finnish families and a sample set of 236 individuals from four different populations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In response to DNA damage , p 53 is activated and mediates a set of antiproliferative responses including cell cycle arrest and apoptosis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Structural and biochemical studies of Cys ( 2 ) His ( 2 ) zinc finger proteins initially led several groups to propose a `` recognition code ' ' involving a simple set of rules relating key amino acid residues in the zinc finger protein to bases in its DNA site . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We report studies of the dynamics of a set of exactly solvable lattice models for the force induced DNA unzipping transition . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Cervical scrapes were tested for the presence of human papillomavirus ( HPV ) DNA using a general primer set directed against the L 1 open reading frame , and HPV genotyping was performed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Utilizing TCC 10 containing wild type p 53 ( wt p 53 ) as the parental line , an isogenic set of cell lines was derived by retroviral infection that expressed a transdominant mutant p 53 ( Arg > His at codon 273 , TDM 273 TCC10 ) , or the human papilloma virus 16 E 6 oncoprotein ( E 6 TCC10 ) . 32P postlabeling analyses were performed on DNA from TCC cultures obtained after treatment with N hydroxy 4 aminobiphenyl ( N OH ABP ) , N hydroxy 4 acetylaminobiphenyl ( N OH AABP ) and N acetoxy 4 acetylaminobiphenyl ( N OAc AABP ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We show using PCR that psbC , atpA and petB genes are present in the plastid DNA minicircles from the dinoflagellate Amphidinium operculatum , extending the set of plastid genes identified from this organism . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The resultant primer set is suitable for all influenza A viruses to generate full length cDNAs , to subtype viruses , to sequence their DNA , and to construct expression plasmids for reverse genetics systems . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
SSCP , which utilized one primer set which reacted with both VT 1 and VT 2 in the PCR method , was followed by CE analysis of secondary structure of single strand DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The PDMS microchannels are used to ( 1 ) fabricate `` 1 D ' ' single stranded DNA ( ssDNA ) line arrays that are used in SPR imaging experiments of oligonucleotide hybridization adsorption and ( 2 ) create `` 2 D ' ' DNA hybridization arrays in which a second set of PDMS microchannels are placed perpendicular to a 1 D line array in order to deliver target oligonucleotide solutions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We assessed the utility of eight DNA sequence markers ( 5 . 8S rDNA , 18S rDNA , 28S rDNA , ITS regions , long wavelength opsin , elongation factor 1 alpha , cytochrome b , and cytochrome oxidase 1 ) in reconstructing phylogenetic relationships at various levels of divergence in gallwasps ( Hymenoptera : Cynipidae ) , using a set of eight exemplar taxa . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In general , these analyses indicate that we have reached a point of strongly diminishing returns with respect to the effect of adding mtDNA sequence characters for the current set of taxa ; our sample of 3809 mtDNA characters is apparently `` enough . ' ' The next steps to improve the phylogenetic estimate may be to add nuclear DNA sequences , morphology , or behavior , or to sequence additional mtDNA lineages within species . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Amplified ribosomal DNA restriction analysis confirmed that a larger set of 50 clones had frequencies of the three phylotypes similar to those above . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The database search output gave a set of proteins already known as DNA or RNA binding factors , some of which have enzymatic activity ( RNA processing , splicing , cleavage , homologous DNA recognition , transcription factor ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A new set of charges specifically developed for biologically relevant N 7 alkylated purine adducts have been implemented in the AMBER force field of the MacroModel package and applied to the conformational search of azinomycin B DNA interactions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These studies demonstrate that these DE adducts provide a novel set of tools to study DNA topoisomerases and emphasize the importance of contacts between the minor groove and top 1 ' s catalytic site . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This was corroborated by fluorescence in situ hybridisation with genomic DNA from 5 . amoena var sericea , which not only showed that the tetraploid contains more than one chromosome set , but also that its constituent sets have undergone considerable reorganisation . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Use of SYTOX Orange stain can greatly improve the measurement of DNA fragments by CE , which will enable an expanded set of applications in genomics and diagnostics . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Multiplex PCR requires that primers lead to amplification of unique regions of DNA , both in individual pairs and in combinations of many primers , under a single set of reaction conditions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Transcription of the CLN 3 G ( 1 ) cyclin in Saccharomyces cerevisiae is positively regulated by glucose in a process that involves a set of DNA elements with the sequence AAGAAAAA ( A ( 2 ) GA ( 5 ) ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have developed a set of tools to construct positional weight matrices from known transcription factor binding sites in a species or taxon specific manner , and to search for matches in DNA sequences . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have estimated pre steady state kinetic parameters for the addition of a single nucleotide residue by a set of RB 69 DNA polymerase mutants in which four highly conserved residues in the fingers domain have been replaced by Ala . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By spliced alignment of human DNA and transcript sequence data we constructed a data set of transcript confirmed exons and introns from 2793 genes , 796 of which ( 28 % ) were seen to have multiple isoforms . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We examine the mutation load of a transcription factor interacting with a set of n regulatory response elements as a function of the factor / DNA binding specificity and conclude on theoretical grounds that the optimal specificity decreases with n . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA replication results from the action of a staged set of highly regulated processes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : We were able to determine the full coding sequences of 19 HOX genes and their genome structure and successfully designed a complete set of PCR primers to amplify the entire coding region of each of the 39 HOX genes from genomic DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
As part of a program to develop agents that can recognize mismatched base pairs in DNA , a set of four polyamide trimers with and without terminal formamido groups was synthesized , and their interactions with predicted DNA recognition sequences in the two different stacking modes were evaluated . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Defects in the G1 / S transition in the cell cycle affect both tumor proliferation and the fidelity of check points responsible for chromosomal integrity and DNA damage response and has lately been shown to represent one of a rather limited set of key aberrations in the transformation process . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
CAR and PXR have a rather broad , overlapping set of ligands that range from natural steroids to xenobiotics and also recognize similar DNA binding sites , referred to as response elements ( REs ) , primarily in promoter regions of cytochrome P 450 ( CYP ) genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thus , the functional genomic approaches of large gene set expression ( complementary DNA microarray ) and genome wide analyses continue to provide novel insights into the genetic susceptibility of lung injury . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a separate set of experiments the expression of DNA gyrase was manipulated and the control on DNA supercoiling and topoisomerase 1 expression was measured [ part of these latter experiments has been published in Jensen , P . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
UVA light induced DNA single strand cleavage by a set of 12 monomethyl substituted benz [ a ] anthracenes ( MBAs ) along with their parent compound , benz [ a ] anthracene ( BA ) , and the potent carcinogen , 7 , 12 dimethylbenz [ a ] anthracene ( DMBA ) , was studied . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have thus shown that within this set of sequence specific bis intercalators , both DNA grooves can be accessed , setting the stage for longer threading polyintercalators designed to have linkers occupying both grooves in an alternating fashion . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A 270 to 420 kDa endoplasmic reticulum associated complex ( SET complex ) containing the nucleosome assembly protein SET , the tumor suppressor pp 32 , and the base excision repair enzyme APE can induce single stranded DNA damage in isolated nuclei in a granzyme A dependent manner . ^^^ The normal functions of the SET complex are unknown , but the functions of its components suggest that it is involved in activating transcription and DNA repair . ^^^ We now find that the SET complex contains DNA binding and bending activities mediated by the chromatin associated protein HMG 2 . ^^^ This physical association suggests that HMG 2 may facilitate the nucleosome assembly , transcriptional activation , and DNA repair functions of SET and / or APE . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This method relies on the slippage of the specificity of mung bean nuclease so that it digests A / T rich double stranded DNA into a set of deletion fragments that can then be cloned into M 13 , sequenced and the original sequence assembled therefrom . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using the contextual information obtained from the analysis of gene neighborhoods , we provide evidence of the interaction of the bacterial members of each of these SSAP superfamilies with a similar set of DNA repair / recombination protein . ^^^ They generally occur in predicted operons encoding one or more of a set of conserved DNA recombination proteins that appear to be the principal functional partners of the SSAPs . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Therefore , we have developed a sensitive and reliable method for plant diagnosis , based on measuring changes in expression of a set of genes in a DNA microarray . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
After rigorous validation with the characterized control tet templates , this primer set was used to determine the genotype of the corresponding tetracycline resistance genes in total DNA of swine feed and feces and in the lagoons and groundwater underlying two large swine production facilities known to be impacted by waste seepage . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The divergence of Drosophila pseudoobscura from its close relatives , D . persimilis and D . pseudoobscura bogotana , was examined using the pattern of DNA sequence variation in a common set of 50 inbred lines at 11 loci from diverse locations in the genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To elucidate the function of Cb 2 in myeloid leukemia cells , a set of in vitro experiments was carried out using 32D / G CSF R ( granulocyte colony stimulating factor receptor ) cells transfected with exon 1B / exon 2 Cb 2 complementary DNA and a myeloid cell line carrying a virus insertion in Cb 2 ( ie , NFS 78 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To refine the HNA locus further , we carried out genetic linkage studies in seven pedigrees with a high density set of DNA markers from chromosome 17q25 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The primer set previously designated and erroneously transcribed B 64 I / B64 2 amplified a DNA fragment of 352 base pairs from Leptospira grippotyphosa and Leptospira sejroe but not from Leptospira autumnalis , Leptospira bratislava , Leptospira canicola , Leptospira hardjo , Leptospira icterohaemorrhagiae , and Leptospira pomona . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In order to evaluate a polymerase chain reaction ( PCR ) for the detection of this zoonotic bacterium in animal tissues a set of primers was designed based on the DNA base sequence of part of the 16S rRNA gene from 11 S . moniliformis strains . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Both in vitro and in vivo evidence suggests that the DNA binding and condensing activities of a set of basic nuclear `` transition proteins ' ' may be crucial to the integrity of the chromatin remodeling process . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To assess the applicability of this technique in the diagnosis of ( sub ) telomeric imbalances , we here describe a blinded study , in which DNA from 20 patients with known cytogenetic abnormalities involving one or more telomeres was hybridized to an array containing a validated set of human chromosome specific ( sub ) telomere probes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Recombinant DNA techniques provided a new set of highly variable genetic markers based on DNA nucleotide sequence polymorphism . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a different set of experiments , mice bearing a cachexia inducing tumour ( the Lewis lung carcinoma ) showed an increase in muscle DNA fragmentation ( 9 . 8 fold ) as compared with their non tumour bearing control counterparts as previously described . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
From observations made on synthetic analogs of DNA and RNA where the phosphates are replaced by nonanionic linking groups , we infer a set of rules that highlight the importance of the phosphodiester backbone for the proper functioning of DNA as a genetic molecule . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The results indicated that the first set of binding sites was occupied by 1 mol of drug bound per near eight base pairs of DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Myeloid differentiation ( MyD ) primary response and growth arrest DNA damage ( Gadd ) genes comprise a set of overlapping genes , including known ( IRF 1 , EGR 1 , Jun ) and novel ( MyD 88 , Gadd45alpha , MyD118 / Gadd45beta , GADD45gamma , MyD116 / Gadd 34 ) genes , that have been cloned by virtue of being co ordinately induced upon the onset of terminal myeloid differentiation and following exposure of cells to stress stimuli . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of three tomato chromosome 7 introgression lines ( ILs ) containing overlapping segments of Lycopersicon pennellii DNA was screened with a set of 10 EcoRI MseI and 10 PstI MseI AFLP primer combinations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genome specific DNA sequences were first identified in a random set of A . sativa genomic DNA cosmid clones by gel blot hybridization using labeled genomic DNA from different Avena species . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA thus obtained was successfully amplified by polymerase chain reaction ( PCR ) using a set of primers specific to a 359 bp region of the mitochondrial cytochrome b gene , and the species of origin were identified by visualizing the restriction fragment length polymorphism ( RFLP ) with the endonucleases PalI and MboI . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To test the nature and extent of similarities in the gene pools of these regions we have collected DNA samples from four ethnic populations of northern India , and have screened these samples for a set of 18 Y chromosome polymorphic markers ( 12 unique event polymorphisms and six short tandem repeats ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Chromosome banding and fluorescence in situ hybridization ( FISH ) applying a comprehensive set of genomic DNA probes were performed in a single reference laboratory . ^^^ Furthermore , molecular cytogenetics using this comprehensive set of DNA probes provides a valuable diagnostic tool for patients with poor chromosome morphology , low or no yields of metaphase cells , or both . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To facilitate such measurements , a set of 1 , 827 Arabidopsis thaliana genes coding for plastid proteins was PCR amplified from genomic DNA and spotted on nylon membranes to generate an array of chloroplast specific gene sequence tags ( GSTs ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Phylogenetic footprinting is a technique that identifies regulatory elements by finding unusually well conserved regions in a set of orthologous noncoding DNA sequences from multiple species . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We consider the problem of inferring gene functional classifications from a heterogeneous data set consisting of DNA microarray expression measurements and phylogenetic profiles from whole genome sequence comparisons . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have constructed a set of promoters carrying tandem DNA sites for CRP with one site centred at position 61 . 5 and the other site located at different upstream positions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Furthermore , viruses and plasmids carry a remarkably diverse set of DNA polymerase genes , suggesting that lateral gene transfer is frequent and includes non orthologous gene displacements between cells and viruses . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To standardize the PCR and to avoid false negative results , an internal control DNA was co amplified by the same set of primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Given a set of homologous parental proteins to be recombined at the DNA level , the optimal DNA sequences encoding these proteins are sought for a given diversity objective . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A third set of 326 nonredundant sequences had no DNA or amino acid sequence similarity to almost 1 million plant and over 7 million animal sequences in dbEST ( as of 22 June 2001 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a set of specially designed primers and fluorogenic probes , we evaluated the 19 markers ' informativity on a panel of 126 DNA samples from 63 recipient / donor pairs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We determined the error spectrum of DNA polymerase beta in the human APC gene under PCR conditions and compared it with the set of mutations reported in human colon tumors . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a set of nine Bedouin multiplex celiac disease families and one simplex , we genotyped DNA samples at HLA DQA 1 and DQB 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A series of expression microarray analyses of chronic myeloid leukemia ( CML ) by means of complementary DNA microarray representing a set of 1024 human genes were initiated to evaluate the role of expression microarray analysis in CML and to identify CML associated genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of cattle microsatellite DNA markers for genome analysis of riverine buffalo ( Bubalus bubalis ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the present study , which focused on rainbow trout but included eleven other species , it is shown that fish ubiquitin genetic organisation and expression are similar to those of other phylogenetic groups through the following set of observations : ( a ) Multiple loci were detected , ( b ) These loci encode repeats of ubiquitin , ( c ) Although the DNA sequences are not conserved , the encoded amino acid sequences are fully conserved , ( d ) The expression of ubiquitin was influenced by cell culture conditions and viral infection . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Amplification of genomic DNA isolated from single adult small strongyles from a set of 7 species consistently generated allele specific products . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
HhaI DNA methyltransferase belongs to the C 5 cytosine methyltransferase family , which is characterized by the presence of a set of highly conserved amino acids and motifs present in an invariant order . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We developed a new technique to immobilize a set of molecular beacons on an agarose film coated slide and found that it has the ability to identify a single nucleotide difference in label free DNA targets . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We reexamined this issue in light of a morphological data set composed of 207 characters and molecular data sets of published 12S , 16S , and cytochrome b mitochondrial DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The set of recognition mechanisms involved in the lac repressor operator system is unique among other protein DNA complexes and presents a nice example of the adaptability that both proteins and DNA exhibit in the context of their mutual interaction . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One data set is derived from adult morphology and the two molecular data sets are from 12S ribosomal RNA and cytochrome b mitochondrial DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A rapid execution of cell killing in premitotic apoptosis is presumably due to the prompt activation of a set of pre existed molecules following DNA damages . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This transition is normally dependent on or concomitant with expression of a set of genes specifying cellular proteins , some of which directly participate in DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA repair related genes were found to be enriched for about eight fold in the resulting gene set relative to the entire gene set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A larger set of 32 mutant DNA specimens was then analyzed using these optimized tandem CAE SSCP / HA protocols and materials and yielded 100 % sensitivity of mutation detection , whereas each individual method yielded lower sensitivity on its own ( 93 % for SSCP and 75 % for HA ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The largest of TGB proteins , TGBp 1 , is a member of the superfamily 1 of DNA / RNA helicases and possesses a set of conserved helicase sequence motifs necessary for virus movement . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A key feature of their strategy for persisting in the host is the ability of all herpesviruses to establish latent infection a state in which no , or only a very limited set of , viral genes are expressed in cells in which viral DNA persists . ^^^ The principal gamma herpesvirus of humans , Epstein Barr virus ( EBV ) , is latent mainly in B lymphocytes : EBV persistence in B cells is associated with expression of a limited set of viral genes encoding functions necessary for the maintenance of the episomal viral DNA as B cells divide . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Two different previously characterized broad spectrum primer sets ( targeting the E6 / E7 or L 1 regions ) were used to amplify HPV DNA , and another primer set was used to amplify the ColE1 / pBR322 origin of replication by polymerase chain reaction amplification . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We now report results of a DNA sequence similarity ( BLAST ) analysis of an additional 4190 cochlear ESTs and a comparison to the first set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Finally , a discrete set of genes , the `` telomerase deletion signature ' ' , is uniquely up regulated in the TDR but not under other conditions of stress and DNA damage that have been reported . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
As an alternative , we studied the ligation of shorter DNA oligonucleotides ( 6 11mer ) containing a degenerate binding site and a desired mutation mismatch to a nested set of megaprimers annealed to the gene of interest . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Trx G genes encode proteins that modulate transcriptional programs through protein protein interactions that are mediated by PHD and SET domains , and by binding to DNA via A T hooks and methyltransferase homology motifs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analyses based on the individual nuclear DNA fragments and on 34 unique indels all produced phylogenies largely congruent with the topology from the combined data set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have screened a large tomato EST database against the Arabidopsis genomic sequence and report here the identification of a set of 1025 genes ( referred to as a conserved ortholog set , or COS markers ) that are single or low copy in both genomes ( as determined by computational screens and DNA gel blot hybridization ) and that have remained relatively stable in sequence since the early radiation of dicotyledonous plants . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The structure shows that the triple mutation causes a collapse of the alpha 2 3A / DNA interface that results in a reorganized set of alpha 2 3A / DNA contacts , thereby enabling the mutant protein to recognize the wild type DNA sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
With the goal of creating a resource for in depth study of myelopoiesis , we have executed a 2 pronged strategy to obtain a complementary DNA ( cDNA ) clone set enriched in hematopoietic genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : A set of specific primers were synthesized according to HBV DNA sequence of a Chinese strain . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 6 random decamer primers ( Al , A 4 , A 5 , A 7 , A 10 , and A 15 ) was applied to a panel of DNA from 57 representatives of different Old World Leishmania species . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We designed a set of primers to specifically amplify DNA fragments from HBV cccDNA but not from viral genomic DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To avoid or minimize the damage to DNA we have evolved an elaborate set of DNA repair pathways that survey the DNA and fix the errors . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Taken together , our results suggest that DNA polymorphism at the FRI gene in A . thaliana from western Europe has been shaped by recent positive selection for earliness in a set of isolated populations . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Swi / Snf remodeling complexes characterized in yeast , Drosophila and mammals all contain a conserved set of core subunits composed of homologs of yeast SNF 2 type DNA dependent ATPase , SNF 5 and SWI 3 proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The aim of this paper is to present a new approach , called ' Hybrid Chromosome Model ' ( HXM ) , which allows both the extraction of regions of similarity between two sequences , and the compartimentation of a set of DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Loop mediated isothermal amplification ( LAMP ) is a novel nucleic acid amplification method that amplifies DNA with high specificity , efficiency and rapidity under isothermal conditions using a set of four specially designed primers and a DNA polymerase with strand displacement activity . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using DNA microarrays , we found that introduction of Blimp 1 into B cells blocked expression of a remarkably large set of genes , while a much smaller number was induced . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Following random amplification of polymorphic DNA from R . equi and R . rhodochrous with a set of 40 arbitrary 10 base pair ( bp ) primers , a pair of species specific primers was designed to detect a unique 700 bp fragment of R . equi chromosomal DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of universal PCR primers for APH encoding genes was used to probe genomic DNA from three collections of actinomycetes to determine the utility of molecular screening . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The data search in our testing DNA database can be carried out using only some loci of the set of 8 STR markers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : Genomic DNA was extracted from peripheral blood cells and amplified by polymerase chain reaction ( PCR ) using 1 set of primers targeting the connexin 26 gene ( nucleotide 36 to 256 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A new method , based on branched DNA ( bDNA ) technology , is described for the specific detection of negative strand RNA of influenza A strains using a set of oligonucleotides designed for the A / PR / 8 / 34 nucleoprotein ( NP ) transcript . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : We develop methods to measure and characterize symmetry at multiple orders , and analyze a wide set of genomes , encompassing single and double stranded RNA and DNA viruses , bacteria , archae , mitochondria , and eukaryota . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here we report a phylogenetic analysis of DNA sequences from the myosin heavy chain type 2 ( myosin 2 ) gene from a large set of metazoans , including acoels and nemertodermatids . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Nevertheless , the application of DNA microarrays to biodefense related diagnostics will depend on solving a set of substantial , yet approachable , technical and logistical problems that encompass diverse topics from amplification efficiency to bioinformatics . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We propose that the telomere checkpoint is distinct from the DNA damage checkpoint and requires a specific set of gene products to delay the cell cycle and presumably to activate telomerase and / or other telomere repair activities . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To circumscribe the moss family Amblystegiaceae , we performed a broad scale analysis of trnL trnF spacer sequence data for 168 species of the Hypnales and 11 species of the Hookeriales and additional analyses of trnL trnF and atpB rbcL ( chloroplast DNA ) , one nuclear region , the internal transcribed spacers of 18S 26S rDNA , and 68 morphological characters for a reduced data set of 54 species of Hypnales . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In an attempt to further localize the point in the HSV 1 replication cycle where arrest occurred , a set of key regulatory events leading to viral multiplication was examined , including viral immediate early ( alpha ) , early ( beta ) , and late ( gamma ) gene expression and DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a related study ( published elsewhere ) , we have applied this optimized protocol to the screening of a set of 32 mutant DNA samples from p 53 exons 7 and 8 and recorded 100 % sensitivity of mutation detection for tandem CE SSCP / HA , whereas each individual method yielded lower sensitivity on its own ( 93 % for SSCP and 75 % for HA ) . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Kinetic and crystallographic analyses of the EcoRV E45A mutant enzyme further show that the Glu 45 carboxylate group facilitates an extensive set of conformational transitions which occur upon DNA binding . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The selected primer probe set identified a 138 bp section specific to a C . parvum genomic DNA sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genomics is the study of the structure and function of the genome : the set of genetic information encoded in the DNA of the nucleus and organelles of an organism . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this paper , we present two methods for measuring the efficiency of DEP for trapping DNA molecules as well as a set of quantitative measurements of the effects of strand length , buffer composition , and frequency of the applied electric field . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In order to determine the critical factors that control the formation of dynamic wall coatings , we have created a set of model polymers and copolymers based on N , N dimethylacrylamide ( DMA ) and N , N diethylacrylamide ( DEA ) , and studied their adsorption behavior from aqueous solution as well as their performance for microchannel electrophoresis of DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA from normal tumor or metastatic tissue was used as the template for PCR amplification of a set of 16 polymorphic microsatellite loci on human chromosome 7 and 6 loci on the human chromosome region 12p13 12 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thereafter , successional development of nitrifying the bacterial community within both biofilms was visualized in situ by fluorescent in situ hybridization ( FISH ) wih a set of fluorescently labeled 16S rRNA targeted DNA probes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Exposure of Escherichia coli cells to sublethal concentrations of methylating agents triggers the expression of a set of genes , which allows the cells to tolerate DNA lesions , and this kind of inducible repair is called the adaptive response . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the yeast Saccharomyces cerevisiae the RAD 6 epistasis group defines a more poorly characterized set of DNA damage response pathways , believed to be distinct from NER . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
First , HPV DNA testing of 2978 clinical specimens by MY 09 MY011 primer set , using AmpliTaq Gold DNA polymerase ( MY Gold ) were compared with MY Taq testing . ^^^ In a separate analysis , PGMY 09 PGMY11 ( PGMY Gold ) , a redesigned MY09 / 11 primer set , was compared with MY Gold for HPV DNA detection ( n = 439 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We distilled nearly one megabase ( 1 million base pairs ) of heterogeneous avian genomic DNA from 20 birds and an alligator into genomic signatures , defined as the complete set of frequencies of short sequence motifs ( strings ) , thereby providing a way to directly compare higher order features of nonhomologous DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using this specially designed chip , we examined a data set of repeated measurements to extract estimates of the distribution and magnitude of statistical errors in DNA microarray measurements . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Multiplexed SBE ELFSE genotyping analysis resulted in the simultaneous and accurate genotyping of three p 53 loci on five different DNA templates in a single reaction set and single CAE analysis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The NarL response regulatory protein of Escherichia coli has been engineered by covalent modification with 1 , 10 phenanthroline ( OP ) to create a set of site specific DNA cleaving agents . ^^^ The first class set cleaved the DNA nearby the center of a synthetic 7 2 7 sequence composed of two NarL heptamer sites separated by a 2 bp spacer element . ^^^ A second set of DNA cleaving agents was constructed using the carboxy terminal domain of NarL called NarL ( C ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We used a biochemical genomics method of assaying Saccharomyces cerevisiae proteins , derived from a nearly complete set of glutathione S transferase fusions , to develop an approach that is able to identify proteins that bind to a DNA element . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Campylobacter isolates originating from one set of breeder hens and the feces from their respective progeny demonstrated identical ribotype patterns as well as identical flaA SVR DNA sequences , thereby suggesting that these isolates were clonal in origin . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The distribution patterns were shown to reflect the degree of satellite DNA evolutionary divergence , which could be revealed by taxonprint method , i . e . , through the analysis of genomic DNA with a set of restriction endonucleases and subsequent computer aided treatment . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Toward true DNA base stacking energies : MP 2 , CCSD ( T ) , and complete basis set calculations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using DNA extracted from a single bulb and the best set of primers , we applied this protocol to simultaneously sex type 96 individuals accurately . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We thus obtain a coarse grained description of the given DNA string in terms of a smaller set of distinct domain labels . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here we analyze origin of DNA replication ( ori ) binding by the E 1 initiator and show sequential binding to a set of overlapping binding sites . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA from 213 schizophrenic patients and 241 normal individuals from Canada were genotyped with this marker set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We concluded that the PCR amplification employing the EgO / DNA IM 1 primer set showed high sensitivity and specificity for the identification of Echinococcus granulosus eggs . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 26 DNA samples from HCC and normal liver was analyzed by RFLP and SOMA , and 5 samples were positive for the p 53 mutation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using the characteristic sequences , we construct a set of 2 10 2 matrices to represent DNA primary sequences , which are based on counting of the frequency of occurrence of all ( 0 , 1 ) triplets of characteristic sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Concomitantly , another set of genes for protein processing and related to DNA / RNA synthesis and repair were found to be up regulated . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Additionally , analysis of expression levels of a subset of genes by real time PCR technology revealed an agreement in expression of 90 % of the examined genes when genomic DNA normalization was applied instead of 29 68 % agreement when RNA normalization was used to measure the expression levels in the same set of RNA samples . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An in silico case study of a set of subtilases reveals that , as expected , the presence of significant sequence identity between distant portions of the parental sequences gives rise to out of sequence annealing events that upon reassembly generate sequences with missing or repetitive DNA segments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Validation of the model was done through comparisons of hydrogen bonded dimer energies and relative free energies of solvation using AM 1 BCC charges in conjunction with the 1994 Cornell et al . forcefield for AMBER . ( 13 ) Homo and hetero dimer hydrogen bond energies of a diverse set of organic molecules were reproduced to within 0 . 95 kcal / mol RMS deviation from the ab initio values , and for DNA dimers the energies were within 0 . 9 kcal / mol RMS deviation from ab initio values . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Transformation of follicular lymphoma to diffuse large cell lymphoma is associated with a heterogeneous set of DNA copy number and gene expression alterations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Either DNA fragmentation is masked at midpoint by temporary repair , or two waves of damage occur , but repair rescues the first set , not the second . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this paper we present methods to classify an individual , based on the observed chromatogram , as a homozygous wild type or a carrier of a specific variant for the given DNA segment by comparison to representative chromatograms that are obtained from the training set of individuals with known variant status . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For another set of 68 clinical specimens , DNA purified with a glass fiber filter column ( High Pure ) with an additional sonication step yielded results well in accord with those obtained by the standard method . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These elements appear to have a diversified set of characteristics including cell to cell contact using pili or cell aggregation , transfer of single stranded or double stranded DNA , low or high specificity of integration and serine or tyrosine recombinases . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
First , 8 DNA samples representing superpools were subjected to PCR with a set of primers to amplify a part of the genomic sequence of interest . ^^^ Second , 36 4 D DNA samples from the superpool that contained BAC clone ( s ) of interest were subjected to PCR with the same set of primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Viral DNA accumulated normally , as did a set of viral mRNAs that were monitored in ADsubTRS 1 infected cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of primers was designed according to the sequence of the mitochondrial cytochrome b gene of C . elaphus canadensis and by PCR amplification about 450 bp band was observed for all four animal species and these primers were not cross reacted with DNA of other animal species tested in the study under the tested reaction conditions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Different satellite sequences co exist in the genome , thus forming a set called a satellite DNA library . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It is shown that the number , T ( M ) , found by the algorithm is the least number of topologies required to explain a set of DNA sequences sampled under the infinite site assumption . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Three new cases are presented , in which DNA marker analysis showed that the extra set of chromosomes in each case was derived from the mother . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We show the applicability of this assay by measuring the level of activity for a set of in vitro synthesized polymerase mutants and by screening for the incorporation of a fluorescent nucleotide analog by DNA polymerases . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These data provide an expanded set of thermodynamic rules for the formation of tetraloops in DNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The samova algorithm was then applied to a set of European roe deer populations examined for their mitochondrial DNA ( mtDNA ) HVRI diversity . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A 16 S rRNA gene from the chromosomal DNA of the fish pathogenic bacterium Flavobacterium columnare ( formerly Flexibacter columnaris ) , strain ARS 1 , was cloned , sequenced and used to design a polymerase chain reaction ( PCR ) primer set . ^^^ The primer set amplified a specific 1193 bp DNA fragment from F . columnare strains but not from related bacteria , F . psychrophilum , F . aquatile , F . branchiophilum , or other bacterial pathogens of fish , Flexibacter maritimus , Cytophaga johnsonae , Edwardsiella ictaluri , E . tarda , Aeromonas hydrophila , and Streptococcus iniae or from the non fish pathogen Escherichia coli . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
At each asymmetric cell division , adult stem cells have been postulated to selectively retain a set of chromosomes that contain old template DNA strands ( i . e . , `` immortal DNA strands ' ' ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This paper reports the methods and results of a computer based algorithm that takes as input the expression levels of a set of genes as given by DNA microarray data , and then searches for causal pathways that represent how the genes regulate each other . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We report here a highly efficient method for modifying BACs by using a novel set of shuttle vectors that contain the R6Kgamma origin for DNA replication , the E . coli RecA gene for recombination , and the SacB gene for negative selection . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Interesting findings included the drastic changes in the levels of genes for Id ( inhibitor of DNA binding ) proteins , which are involved in the regulation of multiple genes , and of a set of genes in the pathway of cholesterol biosynthesis and disposal . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
High density filter sets from all three libraries , made using different restriction enzymes ( HindIII , EcoRI , and MboI , respectively ) , were evaluated with a set of complex probes including the 185 bp knob repeat , ribosomal DNA , two telomere associated repeat sequences , four centromere repeats , the mitochondrial genome , a multifragment chloroplast DNA probe , and bacteriophage lambda . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The cDNA was amplified by Taq DNA polymerase with a set of specific 5 ' primers corresponding to Ig FR 1 and 3 ' primers corresponding to CH 1 ( C micro / C ) or CL ( Ckappa / Clambda ) , the PCR products of variable regions of Ig heavy ( IgH ) and light ( IgL ) chains were sequenced by ABI PRISM Dye terminator cycle sequencing ready reaction kit and ABI PRISM 310 Genetic Analyzer . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We performed a systematic screen of the set of approximately 5 , 000 viable Saccharomyces cerevisiae haploid gene deletion mutants and have identified 103 genes whose deletion causes sensitivity to the DNA damaging agent methyl methanesulfonate ( MMS ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An Arabidopsis SET domain protein required for maintenance but not establishment of DNA methylation . ^^^ In order to elucidate the factors that control genomic DNA methylation patterning , a genetic screen for mutations that disrupt methylation correlated silencing of the endogenous gene PAI 2 was conducted in Arabidopsis : This screen yielded seven loss of function alleles in a SET domain protein with histone H 3 Lys9 methyltransferase activity , SUVH 4 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Reconstitution of DNA fragments containing the 28S gene sequence into a set of nucleosomes with different translational frames revealed that the R 2 site adopted the same rotational orientation with respect to the histone octamer . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The spectrum of postmortem damage in mitochondrial DNA was analyzed in a large data set of cloned sequences from ancient human specimens . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The specific primer set amplified 156 bp fragment and could detect as a little as 0 . 01 fg of purified HPV DNA which equivalent to three viral particles . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : We present a variational independent component analysis ( ICA ) method for reducing high dimensional DNA array data to a smaller set of latent variables , each associated with a gene signature . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA sequences were determined using a cycle sequencer with fluorescence labeled dye terminators , and aligned using a set of reference sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A primer set that produces a large amplicon ( approximately 2 , 125 ) was used to detect ALV J proviral DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The cell cycle regulatory factor TAF 1 stimulates ribosomal DNA transcription by binding to the activator UBF . ^^^ Confocal microscopy showed that TAF 1 colocalizes with UBF in Hela cells , and cell fractionation experiments provided further evidence that a portion of TAF 1 is localized in the nucleolus , the organelle devoted to ribosomal DNA transcription . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Both fragment and viral DNA were added to a single PCR reaction to compete for the same set of primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : The DNA sequence upstream of the human CP 49 coding region was subcloned as a set of 5 ' and 3 ' deletion series . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the presence of 300 DNA copies of the IAC , the detection probability for primer set 139 141 was found to be 100 % when a cell suspension containing 10 ( 4 ) CFU / ml was used as the template in the PCR ( 50 CFU per reaction ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We confirmed the strong impact of RDCs on the structure determination , and , above all , we found that a small set of RDC constraints ( ca . 50 ) detectable at the natural abundance is sufficient to accurately derive the global and local DNA duplex structures when used in conjunction with nOe distances < 5 A . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Based on the proton chemical shifts measured for the central nucleotides in 64 triplets and the correction factors determined for the next nearest neighbor effects , a parameter set has been derived for predicting random coil DNA proton chemical shifts . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Fetal DNA levels in trisomy 13 cases were significantly elevated ( P=0 . 016 ) by analysis of variance of the ranks of values within each matched set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
From a set of four selected samples , cells identified by immunostaining were collected by laser microdissection and then tested by quantitative fluorescent polymerase chain reaction ( QF PCR ) for the presence of paternally derived DNA markers , in order to establish their fetal origin . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using home made DNA arrays in an approach easily compatible with academic research nylon support and radioactive detection we identified a predictor set of 23 genes whose expression patterns differentiated two groups of breast cancer patients with different survival after adjuvant chemotherapy . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
SUMMARY : We have developed U PRIMER , a primer design program , to compute a minimal primer set ( MPS ) for any given set of DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The system consists of four elements : a chain molecule ; a set of free ( elemental ) molecules , all of which refer to the elements of DNA ; a quasi free molecule , which is the last elemental molecule of the chain molecule ; and a molecular machine . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
PURPOSE : A complete set of subtelomeric fluorescent DNA probes , except the acrocentric p arms , was developed in 1996 , was optimized in 1998 , and is commercially available . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Repair of DNA double strand breaks by the non homologous end joining pathway ( NHEJ ) requires a minimal set of proteins including DNA dependent protein kinase ( DNA PK ) , DNA ligase 4 and XRCC 4 proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here we report that the rate limiting enzyme of DNA base excision repair , apurinic endonuclease 1 ( Ape 1 ) , which is also known as redox factor 1 ( Ref 1 ) , binds to GzmA and is contained in the SET complex , a macromolecular complex of 270 420 kDa that is associated with the endoplasmic reticulum and is targeted by GzmA during cell mediated death . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Approximately 8 . 4 % ( 31 kb ) of the highly repeated satellite DNA ( AATAT and TTCTC ) was sequenced , representing the largest data set of Drosophila satellite DNA sequence to date . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We assayed the functions of 152 of these DNA fragments , chosen at random from the entire set , in a luciferase based transfection assay in four human cultured cell types . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using in vivo genomic footprinting , we have identified protein DNA interactions within the cyclin D 1 core promoter that are disrupted upon inactivation of TAF 1 in ts 13 cells . ^^^ Temperature dependent DNA binding activity is also observed for TAF 1 TAF2 heterodimers assembled with the ts 13 mutant but not the wild type TAF 1 protein . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An oligonucleotide primer set based on internal transcribed spacer regions of ribosomal DNA for PCR which gives the amplicon for only the DNA from Fonsecaea species was designed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNMT 1 knockdown also leads to an induction of a set of genes that are implicated in genotoxic stress response such as NF kappaB , JunB , ATF 3 , and GADD45beta ( growth arrest DNA damage 45beta gene ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An extended set of nanosecond scale molecular dynamics simulations of DNA duplex sequences in explicit solvent interacting with the minor groove binding drug 4 ' , 6 diamidino 2 phenylindole ( DAPI ) are investigated for four different and sequence specific binding modes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Of the 158 pairs of SSR primers screened against a set of 19 diverse tomato cultivars , 129 pairs produced the expected DNA fragments in their PCR products , and 65 of them were polymorphic with the polymorphism information content ( PIC ) ranging from 0 . 09 to 0 . 67 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of NBS containing sequences was isolated from genomic DNA of two grape species ( Vitis amurensis and Vitis riparia ) and characterised in a panel of Vitis genotypes carrying different levels of resistance against downy mildew and other diseases . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We conclude that dysregulated expression of a particular set of downstream target genes by DNA binding via the homeodomain is of central importance for leukemia initiation mediated by HOX11 . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Phases of the project performed by the groups at the Carnegie Institution and Duke University involve the generation of normalized cDNA libraries , sequencing of cDNAs , analysis and assembly of these sequences to generate contigs and a set of predicted unique genes , and the use of this information to construct a high density DNA microarray . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of MS 4 STS primers was used to amplify two genomic DNA fragments ( MS4a and MS4b ) from a male plant and one ( MS4a ) from a female plant , which indicates that MS4b is located on the Y chromosome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The design of primers , through the close examination of predicted DNA oligomer melting temperatures ( T ( m ) ) and primer dimer interactions , can reduce the amount of testing and optimization required to obtain a well balanced set of amplicons . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Within this plasmid , we have cloned a set of random DNA sequences and analyzed the products of these reactions with several phage and bacterial DNA polymerases capable of strand displacement synthesis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A complete set of 64 domains would provide comprehensive recognition of any desired DNA sequence , and new proteins could be assembled by any laboratory in a matter of hours . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We describe a set of RNA molecules that work as transcriptional activators when tethered to DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Complementary DNA and expression of the complete set of 47 60S ribosomal proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This paper describes a molecular modelling study for a set of MGBs in order to rank them through their complementarity to the Dickerson Drew Dodecamer ( DDD ) according to their interaction energies with B DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
While both the investigated cobalt ( 3 ) complexes and also [ Ni ( phen ) ( 2 ) ( qdppz ) ] ( 2+ ) affected the photocleavage of DNA ( supercoiled pBR 322 ) upon irradiation by 360 nm light , the corresponding dicnq complex of nickel ( 2 ) was found to be ineffective under a similar set of experimental conditions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The SOS response , a set of cellular phenomena exhibited by eubacteria , is initiated by various causes that include DNA damage induced replication arrest , and is positively regulated by the co protease activity of RecA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
After GzmA loading or CTL attack , SET and NM 23 H1 translocate to the nucleus and SET is degraded , allowing NM 23 H1 to nick chromosomal DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The cleavage products are unaltered DNA bases , 5 methylenefuranone ( 5 MF ) , and a complete set of 3 ' and 5 ' phosphorylated DNA fragments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA molecule studied contains a fixed bend produced by a set of phased adenine tracts . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Salivary gland polytene chromosomes of Drosophila melanogaster have a reproducible set of intercalary heterochromatin ( IH ) sites , characterized by late DNA replication , underreplicated DNA , breaks and frequent ectopic contacts . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Similarly , the signalling component of the DNA damage response might contribute unequally to organismal outcomes depending on its set point : an inadequate response to DNA damage sanctions carcinogenesis but might limit local ageing , whereas overzealous signalling provides cancer protection but accelerates ageing . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : We present an automatic non supervised set of algorithms for a fast and accurate spot data extraction from DNA microarrays using morphological operators which are robust to both intensity variation and artefacts . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Comparisons with the similarity / dissimilarity results based on 2 D and 3 D representations for a set of eight short DNA sequences corresponding to the first exon of beta globin in eight species , including human , are considered to illustrate the use of our novel sequence invariants based on the entries in derived sequence matrices restricted to a selected width of a band along the main diagonal . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Binding discrimination of MutS to a set of lesions and compound lesions ( base damage and mismatch ) reveals its potential role as a cisplatin damaged DNA sensing protein . ^^^ Using gel mobility shift competition assays and surface plasmon resonance , we have analyzed the interaction of Escherichia coli MutS protein with site specifically modified DNA oligonucleotides containing each of the four cisplatin cross links or a set of compound lesions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Variations in length of the major DNA fragment , containing reiteration 1 ( within the a sequence ) and / or reiteration 4 ( within introns of genes US 1 and US 12 ) , were detected between isolates of each multiple recurrence set , but not of the primary recurrence set . ^^^ Thus , HSV 1 isolates of multiple recurrence sets are assumed to have diverged more widely within each set than those of primary recurrence sets , probably because of more rounds of virus DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here we study the extent of antisense transcription in the human genome by analyzing the public databases of expressed sequences using a set of computational tools designed to identify sense antisense transcriptional units on opposite DNA strands of the same genomic locus . ^^^ We conclude that > or =60 % of this data set , or approximately 1 , 600 predicted sense antisense transcriptional units , are transcribed from both DNA strands . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : A set of specific primers was synthesized according to DNA sequence of HBV strain found in China . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Although a variety of evidence has supported an apoptotic contribution to PD neuronal loss particularly in the nigra , two factors have weighed against general acceptance : ( 1 ) limitations in the use of in situ 3 ' end labeling techniques to demonstrate nuclear DNA cleavage ; and ( 2 ) the insistence that a specific set of nuclear morphological features be present before apoptotic death could be declared . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These data suggest that the DNA binding saddle of monomeric unliganded yeast TBP is only partially accessible to solvent , the N terminal domain is partially structured , and the N and C terminal domains form a different set of contacts in the free and DNA bound protein . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
After discussing some pre analytical aspects , the complete set of methods , i . e . , microscopy , histopathology , culture , antigen detection , DNA detection , and antibody detection , is concisely described . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have previously shown that a DNA methylation mutant of Neurospora crassa , dim 5 ( defective in methylation ) , has a nonsense mutation in the SET domain of an H 3 specific histone methyltransferase and that substitutions of H 3 Lys9 cause gross hypomethylation of DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The nick directed DNA repair efficiency of a set of M13mp18 derived heteroduplexes containing 8 , 12 , 16 , 22 , 27 , 45 , and 429 nucleotide loops was determined by in vitro assay . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have determined that riddelliine induces liver tumors in rats through a genotoxic mechanism involving the formation of ( + / ) 6 , 7 dihydro 7 hydroxy 1 hydroxymethyl 5H pyrrolizine ( DHP ) , which reacts with DNA to form a set of eight DNA adducts . ^^^ When metabolism was conducted in the presence of calf thymus DNA , the same set of eight DHP derived DNA adducts was formed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
As is evident from structural and functional studies , TBP ' s concave DNA binding surface is inhibited by a number of potential mechanisms , including homodimerization and binding to the TAND domain of the TFIID subunit TAF 1 ( yTAF ( 2 ) 145 / 130 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A previous whole genome DNA microarray study identified variation at a large chromosomal region ( RD 13 ) of Staphylococcus aureus which encodes a family of proteins with homology to staphylococcal and streptococcal superantigens , designated staphylococcal exotoxin like ( SET ) proteins . ^^^ A central variable region which contained from 6 to 10 different set genes , depending on the strain , was identified , and DNA sequence analysis suggests that horizontal gene transfer and recombination have contributed to the diversification of RD 13 . ^^^ Phylogenetic analysis based on the RD 13 DNA sequence of 18 strains suggested that loss of various set genes has occurred independently several times , in separate lineages of pathogenic S . aureus , providing a model to explain the molecular variation of RD 13 in extant strains . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using pooled DNA from individuals with asthma , Crohn ' s disease ( CD ) , schizophrenia , type 1 diabetes ( T1D ) , and controls , we selected 534 SNPs from an initial set of 1435 SNPs spanning a 25 Mb region on chromosome 6p21 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA fragmentation products , consisting of 3 ' and 5 ' phosphate terminated fragments , were quantified by ion exchange chromatography using a set of reference compounds . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
As part of a pharmacogenetics project , we screened exons and flanking intronic regions for variation in a set of 24 membrane transporter genes ( 96 kb ; 57 % coding ) in 247 DNA samples from ethnically diverse populations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Mammalian somatic cells contain a set of H 1 linker histone subtypes , H 1 ( 0 ) and H1a to H1e , that bind to nucleosome core particles and to the linker DNA between nucleosomes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA Surveillance is a Web based application that assists in the identification of the species and population of unknown specimens by aligning user submitted DNA sequences with a validated and curated data set of reference sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We demonstrate the efficacy of our approach by applying these techniques to an artificial data set as well as several gene expression data sets derived from DNA microarray experiments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of oligonucleotide probes was designed to assemble a DNA microarray to discriminate the methylation patterns of several adjacent CpG sites . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Non standardised measurements of mitochondrial DNA content for the same sample set varied by 19 % between laboratories ( based on log ( 10 ) values , 96 % non logged values ) , and after standardisation results varied by less than 3 % ( based on log ( 10 ) values , 54 % non logged values ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of PCR primers were designed for bovine specific mitochondrial DNA sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis ( 38 nucleotides ) and Nitrosomonas eutropha ( 39 nucleotides ) were hybridized to perfect match probes ( 18 mer and 19 mer ) and to a set of probes having all possible single base pair mismatches . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a previous study , using a primer set designed from Mycoplasma fermentans , we amplified a PCR fragment from Mycoplasma orale similar to the 206 bp DNA fragment amplified from M . fermentans insertion sequence like element ( ISLE ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
G , affording a new set of heterocycle pairs to target the four Watson Crick base pairs in the minor groove of DNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Alternative substrates for DNA and RNA polymerases offer an important set of biochemical tools . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We analyzed a large DNA data set ( 5 , 322 nucleotides ) for 23 species including both mitochondrial ( cytochrome b , 12S ribosomal RNA ( rRNA ) , and 16S rRNA ) and nuclear ( kappa casein , cytochrome P 450 , lactoferrin , and alpha lactalbumin ) markers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 11 sequence tagged microsatellite markers for carnation ( Dianthus caryophyllus ) was developed using a DNA library enriched for microsatellites . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These studies have revealed multiple functions of the BRCA 1 that may contribute to its tumor suppressor activity , including roles in : cell cycle progression , several highly specialized DNA repair processes , DNA damage responsive cell cycle check points , regulation of a set of specific transcriptional pathways , and apoptosis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a set of bicistronic recombinant DNA constructs expressing two reporter genes separated by the HCV IRES , it was determined whether the HCV 3 ' NTR sequence , in the presence or absence of HCV proteins , played a role in the efficiency of HCV IRES dependent translation ex vivo . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set of globular domains of the same condensin SMC is essential for the DNA reannealing activity . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In multivariate analysis , the best discriminating set of features was DNA ploidy and SPF ( both by ICM ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We identified novel p 53 induced and DNA damage induced genes ( the proapoptotic SIVA gene and a set of transforming growth factor beta related genes ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We report the molecular characterization of 18 T . rangeli strains isolated from the salivary glands of naturally infected Rhodnius colombiensis , R . pallescens and R . prolixus by using two independent set of molecular markers . kDNA and mini exon amplification indicated dimorphism within both DNA sequences : KP 1 , KP 2 and KP 3 or KP 2 and KP 3 products for kDNA mini circles and 380 or 340bp products for the mini exon . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An overlapping set of four mutants had defects that appear to be associated with DNA melting to create the fork junction . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Different patterns of amplification products were obtained with DNA from desiccated / rehydrating cells and a liquid culture derived from the dried material , using the same set of primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this study , a polymerase chain reaction ( PCR ) primer set capable of amplifying a mitochondrial DNA segment of multiple species ( cattle , sheep , goats , deer , and elk ) whose rendered remains are prohibited from being fed to ruminants was characterized . ^^^ However , the primer set also amplifies DNA derived from the rendered remains of pigs and horses , which are exempt from the feed ban . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To determine if RARbeta ( 2 ) regulates the expression of a unique set of genes , through the use of subtractive hybridization and DNA array analysis , we have identified and characterized genes that are differentially expressed in F 9 RARbeta ( 2 ) ( / ) teratocarcinoma cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An oligonucleotide primer set specific for Hortaea werneckii was designed on the basis of the internal transcribed spacer regions of the ribosomal DNA ( rDNA ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Limited proteolysis of a high molecular mass complex containing SET ( also named putative HLA associated protein 2 or PHAPII ) , PHAPI ( pp 32 , leucine rich acidic nuclear protein ) and HMG 2 by GzmA liberates NM 23 H1 , a Mg2+ dependent DNase that causes single stranded breaks in nuclear DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The only required inputs are ( 1 ) a single genome wide set of absolute or relative mRNA abundances and ( 2 ) the DNA sequence of the regulatory region associated with each gene that is probed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Drug resistance patterns of recombinant herpes simplex virus DNA polymerase mutants generated with a set of overlapping cosmids and plasmids . ^^^ A new system is reported for rapid generation of recombinant HSV type 1 ( HSV 1 ) DNA Pol mutants based on transfection of a set of overlapping viral cosmids and plasmids . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This protein set , however , is different from that expressed under heat shock conditions and predominantly comprises proteins such as helicases , nucleases , and ribosome associated components that directly or indirectly interact with the biological information molecules DNA and RNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our data indicate that , for clinical molecular diagnostics in multiple myeloma , FISH with a disease specific DNA probe set is superior to CGH analysis . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : For PCR based identification of the major dermatophyte species , a common primer set ( dPsD 1 ) for these species and species specific primer sets ( PsT and PsME ) for each species were designed based on the genomic sequences of the DNA topoisomerase 2 genes of the dermatophytes , and tested for their specificities in PCR amplifications . ^^^ The method consisted of amplification of the genomic DNA topoisomerase 2 gene by the common primer set , followed by a second PCR with the primer sets consisting of species specific primers for each dermatophyte species . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : To estimate the activity of a drug combination against a particular viral strain , we develop a scoring function whose independent variables describe a set of antiviral agents and viral DNA sequences coding for the molecular targets of the respective drugs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our approach has two key properties : ( 1 ) it provides a coherent set of predictions for related regulatory elements of various types and ( 2 ) it takes advantage of both DNA sequence and gene expression data , including expression measurements from inter genic probes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Glass DNA arrays containing a selected set of 1 , 019 genes ( including all 178 pSOL 1 genes ) covering more than 25 % of the whole genome were designed , constructed , and validated for data reliability . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Furthermore , this study provides a set of data that should prove useful as a test for theoretical models of DNA condensation . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To explore the suitability of PMSG for tumor genotyping , 25 human squamous cell carcinomas of the head and neck , as well as a set of cell lines derived from those tumors , were analyzed for mutations in exons 5 to 8 of the TP 53 gene , the exons that encode the DNA binding domains of the p 53 protein . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Set of fluorochromophores in the wavelength range from 450 to 700 nm and suitable for labeling proteins and amino modified DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In order to generate a restriction map and to investigate the gene organisation of EpapGV genome , DNA isolated from occlusion bodies as well as a set of cloned genomic fragments were analysed using combinations of restriction endonucleases and Southern blot analyses that lead to a first version of the physical map . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Defects in DNA mismatch repair ( MMR ) have been implicated in the genesis of a diverse set of human cancers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here , by analyzing a set of diverse protein DNA complexes of known three dimensional structures , we investigated whether the normal vectors of a protein surface at the interface exhibited any relationship with DNA conformation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here we describe a novel approach for characterization of a metagenomic library by hybridizing the library with DNA from a set of groundwater isolates , reference strains , and communities . ^^^ A cosmid library derived from a microcosm of groundwater microorganisms was used to construct a microarray ( COSMO ) containing approximately 1 kb PCR products amplified from the inserts of 672 cosmids plus a set of 16S ribosomal DNA controls . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The possible role of the TPR 1 insertion in the set of interactions with the nascent chain during the first steps of TP DNA replication is discussed . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Phylogenetic analysis of mitochondrial DNA ( mtDNA ) performed in Western Mediterranean populations has shown that both shores share a common set of mtDNA haplogroups already found in Europe and the Middle East . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
TAF 1 has been shown previously to promote more ordered transfer of histones to naked DNA through a direct interaction with histones . ^^^ Using in vitro assays for TAF 1 activity in chromatin assembly , we show that VP 22 inhibits nucleosome deposition on DNA by binding to TAF 1 . ^^^ We also observed that VP 22 binds non specifically to DNA , an activity that is abolished by TAF 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The Mixed Stain Study 3 ( MSS 3 ) interlaboratory challenge exercise evaluated the 2001 performance of STR multiplex DNA typing systems using a set of seven DNA extracts of designed concentration and composition . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Effector IFN gamma secreting responses were only detected on the animals receiving the new set of DNA constructs , alone or in combination with a recombinant virus boost , with or without in vitro re stimulation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A fragment of the DNA polymerase gene from each of the five human herpesviruses was successfully amplified by the set of consensus primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The heart of the method is based on parsimony : given a wildtype DNA sequence , a set of observed variations at each position collected from sequencing data , and a complete catalog of all possible mutations , determine the smallest set of mutations from the catalog that could fully explain the observed variations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of single stranded DNA ( ssDNA ) expression vectors , which can generate intracellularly any ssDNA or oligodeoxynucleotide ( ODN ) molecules , have been developed in our laboratory . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The Roche MagNA Pure automated nucleic acid extraction system was tested for its ability to extract Borrelia burgdorferi DNA from a diverse set of spiked specimen types including blood , cerebral spinal fluid , synovial fluid , urine and ticks . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 44 strains representing serotypes 1 / 2a , 1 / 2b , and 4b was probed with a shotgun DNA microarray constructed from the serotype 1 / 2a strain 10403s . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
AIM : To develop and evaluate heteroduplex forming templates ( HFTs ) as a common set of molecular standards for genotyping by denaturing high performance liquid chromatography ( DHPLC ) using hypervariable regions of human mitochondrial DNA ( mtDNA ) as a model system . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
QPCR , with an improved primer set specific for lambda phage and coupled with fluorescent dye detection of PCR products , was used to detect and quantify phages in lysates with no prior DNA purification . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It provides a set of components that may be assembled to construct a self updating database of DNA sequence , mapping data , and annotations of possible genome features . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
High density DNA microarray chips with a set of 13 , 872 human genes / Ests were used to generate the expression profile of triptolide treated or untreated control Jurkat cells by hybridizing with fluorescent labeled probes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We investigated the effect of DNA supercoiling on transcription from a set of promoters present on a plasmid by using a series of topoisomers with different superhelical densities ranging from totally relaxed to more than physiological . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using DNA microarray analysis , we have found that DAF 16 affects expression of a set of genes during early adulthood , the time at which this pathway is known to control ageing . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One replicate from each set was processed and interpreted according to standard culture ( SC ) protocol , whereas cultures from the second replicate were harvested at 6 weeks postinoculation ; DNA extracts from the harvested material were evaluated by a polymerase chain reaction ( PCR ) test for the Mpt specific IS 900 gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We describe a new set of HLA A , B , and C locus specific primers for the polymerase chain reaction ( PCR ) amplification of the whole coding sequence of these genes from complementary DNA ( cDNA ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Previously , ( 32 ) P postlabeling HPLC was used to detect a set of eight DHP derived adduct peaks from DNA modified both in vitro and in vivo . ^^^ Identification of the entire set of DHP derived DNA adducts further validates the conclusion that riddelliine is a genotoxic carcinogen and enhances the applicability of these biomarkers for assessing carcinogenic risks from exposure to pyrrolizidine alkaloids . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Importantly , the results suggest that tirapazamine may generate a set of poorly repaired , potentially cytotoxic DNA base lesions that block DNA transcription and replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Ndc10p CDEII binding involves a dispersed set of sequence selective and nonselective contacts over approximately 80 base pairs of DNA , suggesting formation of a multimeric structure . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A special target of the granzyme A cell death pathway is an endoplasmic reticulum associated complex , called the SET complex , which contains three granzyme A substrates , the nucleosome assembly protein SET , the DNA bending protein HMG 2 , and the base excision repair endonuclease Ape 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The synergistic effect required a set of DNA bindings of two proteins on the RAmy1A promoter region . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using SELEX , we have generated a set of DNA sequences that can bind efficiently ( K ( d ) values ranging from 10 to 80 nM ) to the human RNase H 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We established a set of real time PCR assay to accurately quantify human immunodeficiency virus type 1 ( HIV 1 ) DNA in infected cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have developed a triple color DNA probe set for the visualization of chromosomal copy number changes directly in thin layer cervical cytology slides by fluorescence in situ hybridization . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Biochem . 269 , 2383 2393 ] that initiation of in vivo SV 40 DNA replication is reversibly suppressed by hypoxia in a state where viral minichromosomes exhibit a nearly complete set of replication proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using DNA database information , one can configure a set of distinct , uniformly labeled oligonucleotide probes from these stretches that is expected to exclusively co localize within a 250 kb chromatin domain . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genomic DNA extracted from the peripheral blood mononuclear cell pellet was used for amplification of HLA class 2 region ( second exon ) with a set of forward ( 5 ' ) and reverse ( 3 ' ) primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To understand how human cells process DNA loop structures , a set of circular heteroduplexes containing a 30 nucleotide loop were constructed and tested for repair in vitro by human cell nuclear extracts . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The target stacking oligonucleotide duplexes were hybridized with DNA chips containing a set of eight 7 mer probes designed to detect the wild type sequence and the seven point mutations described . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genome sequences of a number of archaea have revealed an apparent paradox in the phylogenies of the bacteria , archaea , and eukarya , as well as an intriguing set of problems to be resolved in the study of DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The analysis was performed on a set of isogenic strains with mutations that affect expression of genes of the SOS system : ( 1 ) the lexA+ strain , in which the SOS system can be induced after DNA damage , ( 2 ) lexAind mutants in which the SOS system can not be induced , and ( 3 ) lexAdef mutants in which the SOS system is induced constitutively . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : The genomic DNAs of the dermatophytes ( ten species of Trichophyton , seven species of Microsporum , and Epidermaphyton floccosum ) were amplified by PCR using a common primer set ( dPsD 1 ) for the dermatophytes , followed by nested PCR using other primer sets ( dPsD 2 , PsT and PsME ) that contained primers specific for the DNA topoisomerase 2 genes of the dermatophytes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A multiplex PCR was designed for the differential diagnosis of the two parasite species by targeting the 18S rRNA gene with a set of primer combinations , amplifying DNA fragments of 1451 bp and 833 bp for P . falciparum and P . vivax , respectively . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In addition to amelogenin , this system comprises the complete set of eight STR systems which are components of the German DNA database established in 1998 by the Federal Criminal Office of Germany ( BKA ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To identify a set of genes involved in the development of radiation induced tumorigenesis , we used DNA microarrays consisting of 1176 mouse genes and compared expression profiles of radioresistant cells , designated NIH3T3 R 1 and NIH3T3 R 4 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 25 barley and 3 wheat microsatellite markers were tested for their ability to cross amplify DNA from four accessions of E . trachycaulus and two accessions Pseudoroegneria spicata . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Virus loads in plasma at the set point were significantly lower in vaccinia virus primed / DNA boosted animals versus controls ( P = 0 . 03 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It was since revealed that much of its anti inflammatory activity is not DNA dependent after all , but instead is the result of a complex set of protein protein interactions which lead to transcriptional inhibition of pro inflammatory targets . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA mimics representing negatively charged analogues of peptide nucleic acids ( PNAs ) , particularly hetero oligomers constructed from alternating phosphono PNA residues ( pPNA ) and monomers on the base of trans 4 hydroxy L proline ( HypNA ) as well as mimics composed of phosphono HypNA monomers ( pHypNA ) were tested in a set of in vitro and in vivo assays , and they demonstrated a high potential for the use in nucleic acid based diagnostic , isolation of nucleic acids and antisense experiments . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A four color set of negatively charged , single dye as well as energy transfer dye labeled ddNTPs were synthesized and evaluated in combination with a novel polymerase in a `` direct load ' ' DNA sequencing , obviating the laborious and time consuming post reaction work up . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Bacteria mediated transfer of plasmid DNA into mammalian cells ( bactofection ) is a potent approach to express plasmid encoded heterologous proteins ( protein antigens , toxins or enzymes ) in a large set of different cell types including phagocytic and nonphagocytic mammalian cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the second set of experiments , we incubated pure or enriched samples of 1 , 2 , 3 , or 4 for 18 64 h at 25 degrees C with a 19 base pair ( bp ) DNA duplex , whose radiolabeled top strand contained one GA and one AG sequence as the only reactive sites . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Each screen employed a dense set of microsatellite markers and DNA pooling . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
IH contains mainly unique DNA sequences , and shares certain features with other heterochromatin types such as pericentric , telomeric , and PEV induced heterochromatin , the inactive mammalian 10 chromosome and the heterochromatized male chromosome set in coccids . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Ninety three SNPs in 42 genes were selected among those resequenced in the context of the SNP 500 project , using a set of 102 reference DNA samples from the Coriell Biorepository . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Rat liver microsomal incubations of riddelliine N oxide in the presence of calf thymus DNA produced a set of DHP derived DNA adducts as detected and quantified by 32P postlabeling / HPLC . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Transposition of mobile genetic elements proceeds through a series of DNA phosphoryl transfer reactions , with multiple reaction steps catalyzed by the same set of active site residues . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We use fluorescein as the energy donor and rhodamine as the acceptor to measure the efficiency of fluorescence resonance energy transfer ( FRET ) in a set of hybridized DNA constructs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The method relies on that the specificity of DNA polymerase in allele specific extensions can be enhanced by terminating the extension reactions with apyrase and that a tiling set of primers are synthesized covering the investigated gene sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Employing a set of 41 derivatized DNA fragments , each having a phenyl azide photoactivable crosslinking agent incorporated at a single , defined site within positions 40 to +1 of the gdh promoter of the hyperthermophilic marine archaea , Pyrococcus furiosus ( Pf ) , we have determined the locations of PfRNAP subunits PfTBP and PfTFB relative to promoter DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Among the significantly upregulated genes were a set of target genes of the tumor suppressor protein p 53 , indicating a DNA damage response . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The total conformity of the strategy with the DNA sequencing based approach was proved on the full set of reference strains and a group of Polish clinical isolates . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : A set of specific primers was synthesized according to the HBV DNA sequence of a Chinese strain . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The five most promising candidate pairs were further analysed with an extended set of DNA templates , and PCR products were separated on sequencing gels . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To obtain comprehensive information on 17beta estradiol ( E 2 ) sensitivity of genes that are inducible or suppressible by this hormone , we designed a method that determines ligand sensitivities of large numbers of genes by using DNA microarray and a set of simple Perl computer scripts implementing the standard metric statistics . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Structural analysis of hPR showed that DNA and ligand binding domains are essential for the activation , and missing the TAF 1 domain weakens the activation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Positive and negative regulation of the cardiovascular transcription factor KLF 5 by p 300 and the oncogenic regulator SET through interaction and acetylation on the DNA binding domain . ^^^ SET negatively regulated KLF 5 DNA binding , transactivation , and cell proliferative activities . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of different bioanalytical assays based on genetically modified Escherichia coli strains was set up to quantify cytotoxicity and specific reactivity toward the important biological nucleophiles DNA and glutathione ( GSH ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Each promoter is regulated by a distinct set of regulatory sequences in DNA and transcription factors that bind to these specific sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Non homologous end joining , the major pathway for repairing DNA double strand breaks ( DSBs ) in mammalian cells , is mediated by a set of proteins including DNA dependent protein kinase ( DNA PK ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The output , a set of fluorescent DNA fragments , is analysed via capillary sequencer and spreadsheet software . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Due to its sensitivity to inhibitors , the NS primer set was determined to require a 10 fold smaller volume addition of compost DNA to PCR than the EF and NL primer sets , based on a logistic regression model for a 75 % PCR success rate . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using MethyLight , a high throughput DNA methylation assay , we analyzed 39 genes in a gene evaluation set , consisting of 10 sera from metastasized patients , 26 patients with primary breast cancer , and 10 control patients . ^^^ In the training set , patients with methylated serum DNA for RASSF1A and / or APC had the worst prognosis ( P < 0 . 001 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This primer set was more sensitive than mip gene primers and was able to detect 0 . 25 ng of purified DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a set of exon specific cosmid DNA probes representing 18 exons , one color FISH on metaphase and interphase preparations was performed to identify Duchenne / Becker muscular dystrophy ( DMD / BMD ) deletion carriers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Six structurally diverse auxins were analyzed to determine genes that are unique to a specific auxin , as well as a common set of genes that are rapidly regulated by all tested auxins , thus enabling the identification of shared DNA motifs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 956 unique sequences found in the CREM SSH library was further characterized by generating stage specific expression profiles during spermatogenesis by hybridization with cDNA from pre pubertal mice at defined stages of spermatogenesis using nylon DNA arrays . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of four primers , two outer and two inner primers , were designed from WSSV genome DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Suppression subtractive hybridization ( SSH ) was shown to be suitable for generating a set of DNA fragments differing between two closely related bacterial strains . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We investigated the thermodynamics of site selection by the DNA binding domain by following the PU . 1 ETS / DNA equilibrium with a large set of cognate variants under various temperature and salt conditions by filter binding . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The much cheaper D > T extrapolation provided a complete basis set limit close ( by less than 0 . 7 kcal / mol ) to the more accurate T > Q term , and the D > T extrapolation can be recommended for evaluation of complete basis set limits of more extended complexes ( e . g . larger motifs of DNA ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Two categories of algorithms have been developed to identify common motifs from a set of DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Within the experimental set of 416 identified proteins , a significant number of low abundance proteins involved in DNA synthesis , transcriptional regulation , protein complex assembly , and cellular signaling were discovered . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
SNP500Cancer provides bi directional sequencing information on a set of control DNA samples derived from anonymized subjects ( 102 Coriell samples representing four self described ethnic groups : African / African American , Caucasian , Hispanic and Pacific Rim ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Two major features of the program are : ( 1 ) a tiling algorithm for the design of short overlapping temperature matched oligonucleotides of variable length , which are useful for the analysis of single nucleotide polymorphisms and ( 2 ) a set of tools for the analysis of multiple alignments of gene families and related short DNA sequences , which allow for the identification of conserved DNA sequences for PCR primer selection and variable DNA sequences for the selection of unique probes for identification . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Microarray analysis offers a set of analytical platforms that provide rapid , affordable and substantial information at the DNA , RNA or protein level . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have investigated how AAG discriminates against normal DNA bases , while accommodating a structurally diverse set of lesioned bases , by measuring the rates of AAG catalyzed ( k ( st ) ) and spontaneous N glycosidic bond hydrolysis ( k ( non ) ) for damaged and undamaged DNA oligonucleotides . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In eukaryotic cells , the latter is accomplished by a series of coordinated actions of a set of structure specific nucleases , which , with the assistance of accessory proteins , recognize branched RNA / DNA configurations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The method uses two terminal tailed primers with a unique 25 nucleotide tail each that are simultaneously annealed to template DNA together with the set of mutagenic primers in between . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
More importantly , we observed that the phenomenon a DNA can be translated into the same type of proteins after a frameshift also occurred in a set of 160 human C2H2 ZNF ESTs and in a set of nine cDNAs of human C2H2 ZNF proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this study , we searched for cis acting sequences for synthesis of HBV RC DNA by analyzing a set of deletion variants that collectively represent most of the HBV genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The data set obtained was also used to test the ability of mitochondrial DNA to detect well historically established admixtures ( admixtures between British / Irish people and native Breton people in our case ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We also detected a DNA PKcs fragment in the high quality EST set of Apis mellifera ligustica ( honey bee ) suggesting that DNA PK is a far older and more important eukaryotic complex than previously thought . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have recently analyzed DNA samples obtained from pemphigus patients and matched controls with a set of microsatellite markers , and found that markers mapped to HLA class 1 region are significantly associated with the disease . ^^^ In this study , a set of 26 SNP markers , which span a chromosomal region of about 600 , 000 bp , were used to screen DNA samples of the patients and their matched controls . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of probes sharing a given allele specific sequence with a single base substitution near the middle of the sequence was immobilized on chips and the chips were then hybridized with fluorescence labeled reference targets produced by asymmetric polymerase chain reaction from patient DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of DNA mutations known to be associated with colorectal carcinoma was tested against resected ACPs to determine the set s potential utility as a marker panel for ACPs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These functions rely , in part , on a complex set of interactions between monomers and dimers of the protein and distinct DNA targets , the direct and inverted repeats ( DRs , IRs ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For the general amplification of BAC clone DNA prior to spotting , we designed a set of three novel degenerate oligonucleotide primed ( DOP ) PCR primers that preferentially amplify mouse genomic sequences while minimizing unwanted amplification of contaminating Escherichia coli DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A data set was used that consists of 119 L . helveticus strains , each of which was studied for its physiological characters , as well as surface protein profiles and hybridization with a species specific DNA probe . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have developed the specific oligonucleotide primer set based on the internal transcribed spacer regions of ribosomal DNA for the rapid identification of this pathogen . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of 40 genes , termed the ' core genes ' , is commonly found in all herpesviruses ; their products include four capsid proteins , six DNA replication proteins , seven DNA packaging / cleavage proteins , four envelope glycoproteins , as well as several others . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
On the basis of this one would predict that DNA polymorphisms that increase TAFI activity would deteriorate the outcome in meningococcal sepsis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To further evaluate this potential , we developed and validated a standard protocol to determine whether fetal DNA sequences could be reproducibly amplified and measured across multiple laboratories in a common set of specimens . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Concentrations based on complete hydrolysis and the older set of values are too low by approximately 4 % for typical RNA and 2 3 % for typical DNA samples . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our approach is based on energy calculations for the full set of base sequences that can be threaded onto the DNA within a protein DNA complex . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Through the control set of DNA fragments equally distributed over the genome , recurrent genomic imbalances were discovered : trisomy of chromosome 19 and gain of the MYCN oncogene correlating with an elevation of MYCN mRNA expression . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For each exposure condition , one set of samples was treated with proteinase K ( 1 mg / ml ) to remove any possible DNA protein crosslinks . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To ensure the removal of PCR inhibitors present in faeces and determine if adequate extraction was achieved , faeces were seeded with internal control DNA ( i . e . , DNA designed to amplify with the Campylobacter genus primer set , but provide a smaller amplicon ) before the extraction procedure . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genomic DNA libraries were prepared from two endemic species of Lake Victoria haplochromine ( cichlid ) fish and used to isolate and characterize a set of short interspersed elements ( SINEs ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In representing the evolutionary history of a set of binary DNA sequences by a connected graph , a set theoretical approach is introduced for studying recombination events . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS AND CONCLUSIONS : After 12 h of treatment , in parallel with the 1 , 25 ( OH ) 2D3 induced G 1 arrest , a particular set of DNA replication genes including a cell division cycle 6 homolog , a DNA polymerase alpha subunit , proliferating cell nuclear antigen , two DNA polymerase delta subunits , and flap structure specific endonuclease 1 , was downregulated at least 2 fold . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The methods developed here should permit the rapid and efficient disruption of any bacterial gene , the computational analysis provides new insight into group 2 intron target site recognition , and the set of E . coli DExH / D box protein and DNA helicase disruptants should be useful for analyzing the function of these proteins . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
SUMMARY : Multiple sequence alignment is the NP hard problem of aligning three or more DNA or amino acid sequences in an optimal way so as to match as many characters as possible from the set of sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The application of modern molecular cytogenetic techniques including a broad set of fluorescence in situ hybridisation ( FISH ) methods and recent developments in comparative genomic hybridisation to DNA microarrays , together with molecular methods such as Southern blotting and RT PCR has greatly improved the detection rate of genetic changes in ALL . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our results show that only a set of six mutations within the RHR of 5 Rel are responsible for its ability to bind to a broad spectrum of kappaB DNA that are normally regulated by distinct NF kappaB dimers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A recently described set of real time PCR assays using LightCycler technology enabled parallel detection of DNA from cytomegalovirus ( CMV ) , Epstein Barr virus ( EBV ) , herpes simplex virus type 1 and 2 ( HSV 1 / 2 ) , and varicella zoster virus ( VZV ) by using a single LightCycler program [ J . ^^^ The set of assays lacked automation of DNA purification and of PCR mixture preparation , and was not furnished with measures to monitor for sample adequacy . ^^^ OBJECTIVES : Development of a set of automated LightCycler PCR assays for the detection CMV , EBV , HSV 1 / 2 and VZV DNA in plasma samples and complementation of the assays with internal amplification controls ( ICs ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Fig relationships based on the internal transcribed spacer region ( ITS ) of nuclear ribosomal DNA and pollinator relationships inferred from mitochondrial cytochrome oxidase 1 ( COI ) sequences enabled the study of correlated evolution based on molecular phylogenies for the largest set of interacting species ever compared . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : Genotyping assignments were successfully performed in a set of 20 human DNA samples , and were validated by comparison with results from direct DNA sequencing and agarose gel electrophoresis of PCR products . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The Aml 10 primer set , which served as an internal control primer , did not interfere with amplification of the Y specific sequence even when a low amount of DNA ( 1 ng ) was used . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In addition , a transient cotransfection replication assay elucidated the set of trans acting factors required for lytic DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We compute the minimum number of oligonucleotides ( generally 15 30 bp in length ) that need to be placed on a DNA chip to capture the variation implied by the training set using a graph search algorithm . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
There are a total of 288 384 well microtiter dishes in the library ( 110 , 592 clones ) and its genomic representation is estimated to encompass > or = 7X coverage based on the amount of DNA presumably cloned in the library as well as via hybridization with probes to a small set of single copy genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This method employs a DNA polymerase with strand displacement activity and a set of four specially designed primers that recognize a total of six distinct sequences on the target DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We describe a method to screen a set of DNA sequences against a precompiled library of motifs , and assess which , if any , of the motifs are statistically over or under represented in the sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A surprising set of recent observations suggests a link between assisted reproductive technology ( ART ) and epigenetic errors that is , errors involving information other than DNA sequence that is heritable during cell division . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The results showed that two expected fragments , one from trnK gene and another from 18S rRNA gene regions , were observed simultaneously only when the set of species specific primers encountered template DNA of the corresponding species . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
From a first set of analogues , structure activity relationships ( SAR ) were established for different substitution patterns , and the 14 hydroxylated , bicyclic core ( 10 ) of 1 seemed to be the structural prerequisite for DNA gyrase inhibitory activity . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this study a complete set of four hybridization probe based real time PCR assays for the specific detection of orthopoxvirus DNA is presented . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
On the basis of the high degree of nucleotide similarity , particularly with eukaryotes , we examined the interactions of a set of 20 bp duplex DNA sequences with the Tn 7 protein TnsD . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This pilot study demonstrates the presence of PAH DNA adducts in archived paraffin embedded endoscopic esophageal biopsy samples that are close to 20 years old , and suggests that an appropriate set of archived samples could be used to prospectively correlate PAH DNA adduct formation with risk of esophageal cancer development . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To assess the applicability of the technique in the screening and diagnosis of subtelomeric imbalances , we describe here a blinded study in which DNA from 20 negative controls and 20 patients with known unbalanced cytogenetic abnormalities involving at least one or more telomeres were analyzed using a novel human subtelomere specific primer set , producing altogether 86 amplicons , in the SYBR green 1 based real time quantitative PCR screening approach . ^^^ Screening of the DNA samples from 20 unrelated controls for copy number polymorphism do not detect any polymorphism in the set of amplicons , but single copy number gains and losses were accurately detected by quantitative PCR in all patients , except the copy number alterations of the subtelomeric p arms of the acrocentric chromosomes in two cases . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The BRCA 1 protein has been implicated in a diverse set of cellular functions , including activation of gene expression by the p 53 tumor suppressor and control of homologous recombination ( HR ) during DNA repair . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Melting temperatures , T ( m ) , were systematically studied for a set of 92 DNA duplex oligomers in a variety of sodium ion concentrations ranging from 69 mM to 1 . 02 M . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A DNA probe that exhibits specificity for the rat Y chromosome was generated by using a set of primers specific to murine sry gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Complete sequencing of the human genome and the development of an array representing a tiling set of tens of thousands of DNA segments spanning the entire human genome has made high resolution copy number analysis throughout the genome possible . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The AMG real time PCR design has been used to quantify a set of 57 DNA samples from 4 5 years old forensic bone remains with improved sensitivity compared with the slot blot hybridization method . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To test whether bacterial DNA is at the origin of inflammation in IBD , we have examined the response of lamina propria ( LPMC ) or peripheral mononuclear cells ( PBMC ) and purified T cells from IBD patients and control patients to stimulations with a set of oligodeoxynucleotides ( ODNs ) characterized by the presence or absence of cytosine guanosine dinucleotides ( CpG ) and / or 3 ' poly guanosine ( poly G ) extension . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The generic microchips containing a complete set of possible hexanucleotides are used to reveal the DNA motifs binding with different proteins and to study the DNA protein interactions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
However , the distinct polymerase binding profiles obtained for DNA duplexes differed by as low as a single mismatch suggest that the SPR data can be used for relative comparison purpose among a set of experiments carried out under identical conditions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of serogroup specific PCR primers amplified a 564 bp product from genomic DNA prepared from bacterial cells or directly from bacterial colonies . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a panel of seven microsatellite markers , we determined allelic variation in a large set of heterozygous lymphocyte DNA samples and examined the use of different statistical analysis techniques . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here we describe simple procedures for a broad set of direct 5 ' end ( 5 ' terminal carbon ) functionalizations of DNA oligonucleotides while they remain on the synthesizer column . 5 ' Iodinated oligonucleotides ( prepared by an automated cycle as previously reported ) are converted directly to 5 ' azides , 5 ' thiocarbamates , and alkyl and aryl 5 ' thioethers in high yields . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of genomic DNA sequences putatively encoding front end desaturases were identified by in silico analysis of the draft genome of the marine microalga Thalassiosira pseudonana . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The method requires a set of two small DNA fragments that flank the region to be copied . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of molecular DNA loci which can be used for grape clone identification has been obtained . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We applied a set of commonly used universal primers ( primers RW 01 and DG 74 ) to amplify partial fragments of 16S ribosomal DNA for bacterial identification and found an unexpected amplicon ( 547 bp ) , in addition to the expected 362 bp product , in samples containing Bacteroides thetaiotaomicron . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The absence of Set 1 leads to a delay of meiotic S phase onset , which reflects a defect in DNA replication initiation . ^^^ The timely induction of meiotic DNA replication does not require the Set 1 HMTase activity , but depends on the SET domain . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We suggest that the differences in expression and function of these two repressors , in combination with their similar DNA binding domains , contribute to the complex regulation of the large set of glucose repressed genes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Each promoter is regulated by a distinct set of regulatory sequences in DNA and transcription factors that bind to these specific sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We provide the FLD 1 selection system in a set of P . pastoris expression vectors that are composed almost entirely of P . pastoris DNA ( except for the recombinant gene ) and are devoid of antibiotic resistance genes or other sequences of bacterial origin . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a separate set of experiments , we studied 12 animals using the same protocol except that we killed all animals at 4 hrs and removed standardized sections of liver for analysis of nuclear factor kappaB DNA binding . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By use of MethyLight analysis of faecal DNA from three independent sets of patients , we identified SFRP 2 methylation as a sensitive single DNA based marker for identification of colorectal cancer in stool samples ( sensitivity 90 % [ CI 56 100 ] and specificity 77 % [ 46 95 ] in the training set [ n=23 ] ; sensitivity 77 % [ 46 95 ] and specificity 77 % [ 46 95 ] in an independent test set [ n=26 ] ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA of ripe sperm nuclei in this species is condensed by a set of five different proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Subtractive approaches like complementary DNA representational difference analysis ( cDNA RDA ) and suppression subtraction polymerase chain reaction identify a focused set of differentially expressed genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of conserved DNA motifs were derived from libraries of potential promoter regions of putative D . vulgaris regulons with the AlignACE program suite . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Each set of specific primers showed no amplification of non specific and non target PCR products from human genomic DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A new primer set improves the efficiency of competitive PCR ELISA for the detection of B 19 DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Pulsed field gel electrophoresis following digestion with the endonuclease 1 CeuI , using DNA from a set of 120 wild type strains of serovar Typhi assembled from several sources , identified eight strains in which the 1 CeuI G fragment , which contains SPI 7 , had a large deletion . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The reproducibility of the assay for detection of rpoB genotypes was initially evaluated on a blinded set of twenty reference DNA samples with known allele types and overall concordant results were obtained . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Raman measurements were carried out on a set of natural DNA 9 mer in order to verify suitability of the model and to obtain reference spectral data . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This review presents the current parameter set available for making accurate DNA structure predictions and also points to future directions for improvement . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this study we have constructed a set of E . coli AB 1157 mutD5 derivatives deleted in genes encoding SOS induced DNA polymerases , pol 2 , pol 4 , and pol 5 , and estimated the frequency and specificity of spontaneous argE 3 > Arg ( + ) reversion in exponentially growing and stationary phase cells of these strains . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our recent mechanistic studies indicated that riddelliine , a tumorigenic retronecine type PA , induced tumors via a genotoxic mechanism mediated by the formation of a set of eight 6 , 7 dihydro 7 hydroxy 1 hydroxymethyl 5H pyrrolizine ( DHP ) derived DNA adducts . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of oligonucleotide primers was designed to specifically amplify A . astaci DNA in the ITS region surrounding the 5 . 8S rDNA gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A second set of primers designed by Shimoji et al . amplifies a 937 bp DNA fragment which is derived from a sequence associated with virulence of E . rhusiopathiae . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The analysis of the set of curves stemming from the DNA microarray may be then performed using a functional analysis which can exhibit the main modes of variations in this set , gather genes with similar variations and extract characteristic parameters of gene profiles . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Activation of a DNA damage checkpoint response in a TAF 1 defective cell line . ^^^ Here we show that a cell line with a temperature sensitive defect in TBP associated factor 1 ( TAF 1 ) , a component of the TFIID general transcription complex , exhibits hallmarks of an ATR mediated DNA damage response . ^^^ These results suggest that a defect in TAF 1 can elicit a DNA damage response . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The geometry of junctions had previously been described in terms of a specific set of parameters that include : ( 1 ) the angle relating the ends of DNA duplexes arms of the junction ( interduplex angle ) ; ( 2 ) the relative rotation of the duplexes about the helix axes of the stacked duplex arms ( J ( roll ) ) ; and ( 3 ) the translation of the duplexes along these helix axes ( J ( slide ) ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
As to the second set of data , DNA repair was also studied in irradiated peripheral blood mononuclear cells ( PBMC ) from ageing humans . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Control region sequences for East Asian individuals in the Scientific Working Group on DNA Analysis Methods forensic mtDNA data set . ^^^ The Scientific Working Group on DNA Analysis Methods ( SWGDAM ) mitochondrial DNA ( mtDNA ) population data set is used to infer the relative rarity of mtDNA profiles obtained from evidence samples and of profiles used to identify missing persons . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This is the first report whereby MALDI TOFMS generated protein profiles from a set of microbes is compared directly with DNA DNA hybridization yielding a positive correlation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A number of studies have examined the problems of tumor classification : class discovery , the problem of defining a number of classes of tumors using the data from a DNA chip , and class prediction , the problem of accurately classifying an unknown tumor , given expression data from the unknown tumor and from a learning set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To assess the value of MLST relative to those of other DNA fingerprinting tools for discriminating among strains of C . albicans , we applied it to a previously well characterized set of 29 C . albicans isolates evaluated by the random amplified polymorphic DNA ( RAPD ) , multilocus enzyme electrophoresis ( MLEE ) , and Ca 3 Southern hybridization probe techniques . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Recognition of DNA by omega protein from the broad host range Streptococcus pyogenes plasmid pSM 19035 : analysis of binding to operator DNA with one to four heptad repeats . pSM 19035 encoded omega protein forms a dimer ( omega 2 ) that binds to a set of 7 bp repeats with sequence 5 ' NATCACN 3 ' . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genomic DNA was amplified with fluorescently labelled primers from the Applied Biosystems PRISM linkage mapping set HD 5 comprising 63 highly polymorphic microsatellite markers with an average spacing of 4 . 5 cM . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Comparison of the cytogenetic subset to the whole data set of tumors revealed that slightly hyperdiploid tumors , that is , with DNA index between 1 . 05 and 1 . 3 , were under represented in tumors for which cytogenetic analysis was successful . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Mitochondrial DNA divergence values for this set of taxa showed a skewed distribution pointing toward relatively young speciation times , in contrast to the pattern presented by Klicka and Zink ( 1997 ) for 35 sister plus non sister species pairs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The potential of the two techniques together is evident , as they represent a set of assays feasible for evaluating damage in human somatic and germ cells after chemical treatment ( 1 ) by direct observation of two different end points , detecting general DNA damage and chromosomal aberrations and ( 2 ) by extrapolation from lymphocytes to sperm , which provides a ' parallelogram ' approach in human cells . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Current protocols to make long synthetic DNA molecules rely on the in vitro assembly of a set of short oligonucleotides , either by ligase chain reaction ( LCR ) or by assembly PCR . ^^^ We have developed Gene2Oligo ( http : / / berry . engin . umich . edu / gene2oligo / ) , a web based tool that divides a long input DNA sequence into a set of adjacent oligonucleotides representing both DNA strands . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Weeder Web is a web interface to Weeder , an algorithm for the automatic discovery of conserved motifs in a set of related regulatory DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analysis of the local conformation of a set of functional DNA sequences may allow for determination of the conservative conformational and physicochemical parameters reflecting molecular mechanisms of interaction . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A phylogenetic tree from representatives found on various hosts was inferred from a combined data set of mitochondrial DNA cytochrome oxidase subunit 1 , mitochondrial cytochrome b , nuclear elongation factor 1alpha , and nuclear phosphoglycerate mutase , used for the first time as a molecular marker . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Considering that those cells should have had a selection advantage during natural evolution that enabled them to fulfil vital functions ( such as growth , defence against toxic compounds , repair of DNA alterations , etc . ) with minimal effort , one may postulate the principle of flux minimization , as follows : given the available external substrates and given a set of functionally important ' target ' fluxes required to accomplish a specific pattern of cellular functions , the stationary metabolic fluxes have to become a minimum . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Combination of orc 2 1 and orc 5 1 alleles with the complete set of haploid deletion mutants revealed synthetic lethal / sick phenotypes with genes involved in DNA replication , chromatin structure , checkpoints , DNA repair and recombination , and other genes that were unexpected on the basis of previous studies of ORC . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Mitochondrial DNA restriction site analyses on natural populations of Drosophila subobscura have proved the existence of two common , coexisting haplotypes ( 1 and 2 ) , as well as a set of less frequent ones derived from them . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have determined the distribution of each of the 65 , 536 DNA sequences that are eight bases long ( 8 mer ) in a set of 13 , 010 human genomic promoter sequences aligned relative to the putative transcription start site ( TSS ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Although length of the telomeric DNA tract varies widely across evolution , a species specific set point is established and maintained by unknown mechanisms . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The method was further tested against a more complex set of 40 DNA sequences and compared with other existing sequence similarity measures ( alignment free ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Unexpectedly , the locked south pseudosugar appears to be trapped in the middle of the flipping pathway via the DNA major groove , held in place primarily through Van der Waals contacts with a set of invariant amino acids . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have screened a set of 95 sporadic gastric cancers for mutations and allele loss of the DNA glycosylase MYH gene , which excises adenine misincorporated opposite unrepaired 8 oxoG . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have performed DNA amplification on a large set of serum samples ( n = 2955 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In vertebrates , telomeric DNA is composed of repetitions of the TTAGGG hexanucleotide , is bound to a set of specific proteins , and is elongated by the reverse transcriptase enzyme telomerase . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : TTV DNA was detected by PCR using the primer set of Takahashi et al ( 1998 ) or a nested PCR specific for genotype 2 , because it had been reported that this subtype might be more pathogenic ( Tagger et al . 1999 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In response to DNA damage , cells engage a complex set of events that together comprise the DNA damage response ( DDR ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
M . mobile has among the lowest DNA GC contents ( 24 . 9 % ) and most reduced set of tRNAs of any organism yet reported ( 28 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here , we use high density oligonucleotide arrays to discover an extremely dense set of SNPs in 13 classical and two wild derived inbred strains in five genomic intervals totaling 4 . 6 Mb of DNA sequence , and then analyze the segmental haplotype structure defined by these high density SNPs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A new set of DNA base nucleic acid codes and their hypercomplex number representation have been introduced for taking the probability of each nucleotide into full account . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The germline chromosomes are fragmented by a DNA elimination process that targets heterochromatin to give a reproducible set of some 200 linear molecules 50 kb to 1 Mb in size . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Insertion sequence ( IS ) elements are a diverse set of specialized DNA segments that can move to new sites in bacterial genomes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Gene expression profiling using the complementary DNA microarray system identified a set of 24 genes differentially expressed between the hybrids and parental cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We then analyzed the same set of larynx tissues for the presence of ( 32 ) P postlabeled aromatic DNA adducts to determine more about the levels and types of adducts formed in the larynx . ^^^ Finally , the amounts of endogenous adducts were found to be comparable to those observed for aromatic DNA adducts in the same set of larynx tissues . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A stutter correction model can be reliably derived from one standard ' training set ' of the same 10 individual DNA samples for each marker , which can also include heterozygous patterns with partially overlapping peaks . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The single end transfer ( SET ) events generate branched DNA molecules that contain a nicked Holliday junction and can be considered as partial transposition products . ^^^ Such resolution depends on the presence of homologous DNA regions neighbouring the cross over point in the SET molecule . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Two stable rice lines with introgression from wild rice , Zizania latifolia , were analyzed for patterns of cytosine DNA methylation and transcription of a set of selected sequences , including cellular genes and transposable element ( TE ) related DNA segments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This is the first report describing the haplotype database for the set of 11 Y STR loci recommended by the Scientific Working Group on DNA Analysis Methods ( SWGDAM ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Hereditary non polyposis colorectal cancer ( HNPCC ) results from inactivating germline mutations in a set of DNA mismatch repair genes , of which the most clinically relevant are hMSH 2 and hMLH 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA methylation polymorphism in a set of elite rice cultivars and its possible contribution to inter cultivar differential gene expression . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The analysis of set of j ( M ) values indicated that CRP induced DNA bending without the helical change like helical twisting or torsional alignment change . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This set consisted of DNA sequences derived from the ribosomal internal transcribed spacer ( ITS ) regions , partial sequences of the ribosomal intergenic spacer ( IGS ) region , the beta tubulin and translation elongation factor 1 alpha ( EF 1alpha ) genes , AFLP fingerprints , chromatographic data on secondary metabolites and morphological data and growth characteristics . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A full set of DNA stacking parameters has been determined for the first time . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These filters have the consequence that our data set includes only a subset of the available SNPs ( in particular excluding large numbers of SNPs that may occur between repetitive DNA alleles ) but increase the likelihood that this subset is useful : Direct sequencing suggests that 79 . 8 % + / 7 . 5 % of the in silico SNPs are real . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We defined the linkage disequilibrium structure of PINK 1 and used this to identify a set of tagging single nucleotide polymorphisms that we estimate will efficiently represent all of the common DNA variation in the entire gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An in vitro miniaturized assay was developed that allows the measurement of cleavage activities of DNA repair enzymes on a set of oligonucleotides ( ODNs ) that contained different lesions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By combinatorial analysis of three independent and complete DNA indexing profiles , each displaying the complete set of expressed transcripts on capillary electrophoresis , the method allows transcripts to be simultaneously quantified and identified . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using CE AFLP , a series of molecular ' fingerprints ' were generated for a set of gastric tumor and normal genomic DNA samples . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Six such NUMTs show insertion polymorphism and provide a useful set of DNA markers for human population genetics . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The availability of a genome wide set of Saccharomyces deletion mutants provides a chance to identify all the yeast genes involved in DNA repair . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Single stranded DNA fragments encoding a personalized set of short tandem repeats ( STR ) were synthesized . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We study the bifurcations of a set of nine nonlinear ordinary differential equations that describe regulation of the cyclin dependent kinase that triggers DNA synthesis and mitosis in the budding yeast , Saccharomyces cerevisiae . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The technique is shown to be effective using E . coli DNA sequences , however , it is applicable to any organism for which a set of promoters has been experimentally defined . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To refine the candidate region , we carried out genetic linkage studies in four pedigrees with a high density set of DNA markers from chromosome 16q22 . 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The SOS response comprises a set of cellular functions aimed at preserving bacterial cell viability in front of DNA injuries . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Although the primer set consisting of ITSF and ITSReub and that of S D Bact 1522 b S 20 and L D Bact 132 a A 18 showed similar sensitivities for the DNA of Allorhizobium undicula mixed with the DNA of other species , the S D Bact 1522 b S 20 and L D Bact 132 a A 18 primer set failed to detect the DNA of Pseudomonas stutzeri . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The amino terminus of p 21 interacts with cyclins and cyclin dependent kinases , while the carboxyl terminus interacts with proliferating cell nuclear antigen ( PCNA ) , growth arrest and DNA damage inducible gene 45 ( GADD 45 ) , calmodulin , SET , and CCAAT / enhancer binding protein alpha ( C / EBP alpha ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of amplifiable probes were prepared by locus specific forward and reverse primers synthesized with the T 7 and T 3 promoter sites at their respective 5 ' ends to the interest DNA fragments and purified by Qiagen PCR products purification kit . ^^^ The set of probes were then hybridized with genome DNA immobilized on the nylon membrane . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These parameters were estimated in the long lived , outcrossing gymnosperm loblolly pine ( Pinus taeda L . ) from a survey of single nucleotide polymorphisms across approximately 18 kb of DNA distributed among 19 loci from a common set of 32 haploid genomes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We used a variety of cytogenetic and molecular approaches , such as , chromosome G banding , fluorescent in situ hybridization , a DNA methylation test , and a set of chromosome 15 DNA polymorphisms to characterize a cohort of 27 PWS patients and 24 suspected AS patients . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An initial screening against a 24 individual genomic DNA diversity panel verified 60 % of a small set of potential single nucleotide polymorphisms from which successful results could be obtained . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A new set of DNA macrochips for the yeast Saccharomyces cerevisiae : features and uses . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In an effort to develop biologically active minor groove agents , we are preparing and exploring the DNA interactions of a systematic set of diamidine derivatives with a powerful array of methods including DNase 1 footprinting , biosensor SPR methods , and 10 ray crystallography . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It is expected that the results of this work would be constituted as a useful set of guidelines to be followed for the successful experimental implementation of various molecular biology techniques , such as quantitative PCR , multiplex PCR and the design of optimal DNA microarrays . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA methylation profiles a mechanism for memorizing the set of genes inherent in individual type of cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this paper , we present a set of statistical procedures for distinguishing between these alternative hypotheses using DNA sequences sampled over the course of infection . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The similarity to a diverse set of bacterial sequences highlights the ability of horizontally transferable DNA elements to acquire and disseminate genetic traits through the bacterial gene pool . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
BACKGROUND AND AIMS : The amount of DNA per chromosome set is known to be a fairly constant characteristic of a species . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A small subset of predicted SNPs was validated on a diverse set of bovine DNA samples using PCR amplification and sequencing . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
ParM is not related to tubulin , so its dynamic instability must have arisen by convergent evolution driven by a set of common constraints on polymer based segregation of DNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
With one primer set , which framed a region within the fowl poxvirus 4b core protein gene , we were able to detect APV specific DNA from 19 tested strains and isolates belonging to five defined Avipoxvirus species and four previously undefined isolated species . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Five of these isolates from four series of outbreaks had patterns similar to the 6 / 85 vaccine strain of M . gallisepticum by random amplified polymorphic DNA ( RAPD ) analysis using three different primer sets , whereas with a fourth primer set ( OPA 13 and OPA 14 ) , only two of the isolates were similar to 6 / 85 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our data set included DNA sequence data from two mitochondrial protein coding genes and a approximately 1 kb nuclear intron for 23 of 26 recognized species , and 59 previously published morphological characters for a complimentary set of 24 species . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genetic experiments link Set 9 to Crb 2 , a homolog of the mammalian checkpoint protein 53BP1 , and the enzyme is required for Crb 2 localization to sites of DNA damage . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To date , crystal structures of 2 DNA : m ( 5 ) C MTases complexed with the substrate DNA have been obtained ; however , for none of these enzymes has the importance of the whole set of DNA binding residues been comprehensively studied . ^^^ HaeIII , and systematically analyzed the effect of alanine substitutions for the complete set of amino acid residues from its TRD predicted to be important for DNA binding and target recognition . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Where and how did the complex genetic instruction set programmed into DNA come into existence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We analyzed a set of multigenic simian / human immunodeficiency virus ( SHIV ) DNA and fowlpox virus priming and boosting vaccines for immunogenicity and protective efficacy in outbred pigtail macaques . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results indicate that the inability to degrade DNA derived from erythroid precursors results in interferon beta production that induces expression of a specific set of interferon responsive genes associated with embryonic lethality in DNase 2 deficient mice . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These results reinforce the practice of preliminary microscopic hair examination in narrowing down a set of hairs for DNA analysis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These observations add beta protein to a set of diverse proteins that appear to promote recognition of homology by a unitary mechanism governed by the intrinsic dynamic properties of base pairs in DNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The second data set contains a collection of DNA microarray data from a breast cancer study utilizing four breast cancer cell lines . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The database stores data about splice sites computed by a custom algorithm using Drosophila cDNA transcripts and genomic DNA and supports a set of procedures for analyzing splice site sequence space . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Although several well proven protocols are available and some factors controlling the precision and reproducibility have been identified , several problems persist : ( 1 ) the need for fresh tissues complicates the transfer of samples from field to the laboratory and / or their storage ; ( 2 ) the role of cytosolic compounds interfering with quantitative DNA staining is not well understood ; and ( 3 ) the use of a set of internationally agreed DNA reference standards still remains an unrealized goal . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A technology was worked out , which is based on the hybridization of a fluorescence labeled amplified fragment of the pol gene of the HIV 1 provirus DNA with a set of specific oligonucleotides immobilized in 3 D hydrogel pads of the biological microchip . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Because an upregulation of many genes was noticed around 3 h , three independent approaches were then used to characterize the host response to a 3 h contact either with bacterial supernatant or with live bacteria : 1 ) a DNA microarray containing 4 , 200 sequence verified probes , 2 ) a semiquantitative RT PCR with a set of 537 pairs of validated primers , or 3 ) ELISA assay of IL 8 , IL 6 , TNFalpha , and PGE ( 2 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This panel of markers incorporates the 9 locus European minimal haplotype ( EMH ) loci recommended by the International Y STR User Group and the 11 locus set recommended by the Scientific Working Group on DNA Analysis Methods ( SWGDAM ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here we employ electrophoresis to investigate DNA amino acid interactions by using a set of amino acids ( Ala , Gln , Gly , Met , Phe , Val , bicine and tricine ) as trailing ions in a discontinuous buffer , and monitoring their interactions with duplex ( from 12 to 3000 bp ) and frayed wire [ a set of self assembled superstructures arising from d ( A ( 15 ) G ( 15 ) ) oligodeoxyribonucleotides ] DNA by the change in their ionic mobility ( in terms of % R ( f ) ) as a function of amino acid concentration in a polyacrylamide matrix . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thermodynamically determined DeltaG degrees values for 111 DNA duplexes , with the number of base pairs ranging from 4 to 16 , were selected in two sets , and the regression equation formed with one set was used to predict the stabilities of the other set , taking the energy components and the stiffness parameter to be independent variables . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A real HIV DNA sequence data set with two demes , semen and blood , is used as an example to demonstrate the method by fitting asymmetric migration rates and different population sizes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The fifth colour was achieved by using two fluorescent dyes in the chemical reaction , resulting in dual labelling of the DNA probe and a fluorescence detectable with a specific filter set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
From an evolutionary point of view , it was interesting that a small DNA stretch at the 3 ' clf R domain sequence and the fnb sequences agreed with the results of MLST for this set of strains . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analyses of a major cluster of upregulated genes in cirrhosis identified a new set of genes involved in DNA repair and damage . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Both processes give biologically plausible root placements in a set of nine primate mitochondrial DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The problem of identifying motifs comprising nucleotides at a set of polymorphic DNA sites , not necessarily contiguous , arises in many human genetic problems . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Unusually large variant alleles were observed in the short tandem repeat ( STR ) systems D3S1358 and D21S11 , both of which are included in the international standard set of loci ( ISSOL ) and routinely typed in National DNA intelligence databases worldwide . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The scientific working group on DNA analysis Methods ( SWGDAM ) mitochondrial DNA ( mtDNA ) population data set is used to infer the relative rarity of control region mtDNA profiles obtained from evidence samples and of profiles used for identification of missing persons . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Furthermore , the community composition of methanogens in water and aquifer material was explored by molecular analyses , i . e . , fluorescence in situ hybridization ( FISH ) , denaturing gradient gel electrophoresis ( DGGE ) of 16S rRNA genes amplified with the Archaea specific primer set ARCH 915 and UNI b rev , and sequencing of DNA from dominant DGGE bands . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
SPR results obtained from a complete set of triheterocyclic polyamides show a dramatic difference in the affinity of f ImPyIm for its cognate DNA ( K ( eq ) = 1 . 9 10 10 ( 8 ) M ( 1 ) ) and f PyPyIm for its cognate DNA ( K ( eq ) = 5 . 9 10 10 ( 5 ) M ( 1 ) ) , which could not have been anticipated prior to characterization of these compounds . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have clustered a large set of protein DNA complexes based on their IAS values . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA amount per basic chromosome set ranged from 1 . 77 to 7 . 70 pg . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : A model is designed where biological and combinatorial reduction rules are applied to a set of DNA chip probes containing all possible sequences of uniform length n , creating probes capable of detecting unknown GMOs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For this set of 46 samples , the PCR assay achieved a diagnostic specificity of 100 % and a sensitivity of approximately 97 % ( being able to specifically detect as little as approximately 0 . 02 fg of Habronema DNA ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here , we report the development of a comprehensive set of human specific , target specific multiplex polymerase chain reaction ( PCR ) assays for DNA quantitation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here we present a set of regulatory proteins that allow to reversibly alter the DNA structure in vivo and in vitro by adding low molecular weight effectors that control their oligomerization and DNA binding . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We describe the completion of the set of four benzo fused expanded DNA ( xDNA ) nucleoside analogues . ^^^ In addition , the completion of the xDNA nucleoside set makes it possible in the future to construct full four base xDNA strands that can target any sequence of natural DNA and RNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Epigenetics refers to a set of self perpetuating , post translational modifications of DNA and nuclear proteins that produce lasting alterations in chromatin structure as a direct consequence , and lasting alterations in patterns of gene expression as an indirect consequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a set of 16 LTNPs , viral dating , DNA viral load , quasispecies heterogeneity and antibody ( Ab ) titres against gp 160 and beta 2 microglobulin ( beta2m ) were determined . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For example , mitochondrial DNA replication and metabolic set points in nematodes may be determined by mitochondrial activity early in life . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a set of degenerate primers based on conserved regions within DNA directed DNA polymerase coding regions , a 463 base pair fragment was isolated from both Japanese and European AnHV . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
CONCLUSIONS : PNA probes are a good alternative to DNA probes in the present set up , since the low temperature required both for binding and destabilization of PNA probes minimizes the loss of signal , and several FISH cycles can therefore be carried out before FISH errors occur . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Ribosomal DNA ( rDNA ) containing small subunit ( SSU ) rDNA and both flanking regions in the entomopathogenic microsporidian Nosema bombycis NIS 001 was amplified from genomic DNA with a primer set based on the sequence of an inverse polymerase chain reaction ( PCR ) derived fragment . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
On a larger test set containing 48 protein DNA complexes with known experimental binding free energies , our potential has achieved a high correlation coefficient of 0 . 800 , when compared with the experimental data . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Two cellular proteins , SET and pp 32 , also associated with viral DNA during early phase . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here we describe VSQual , a set of Perl programs intended to provide simple and powerful tools to check several quality features of the sequencing data generated by automated DNA sequencing machines . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To search for genes involved in early IHR , we performed DNA microarray analysis in a training set of 33 HCCs and selected 46 genes linked to early IHR from approximately 6 , 000 genes by means of a supervised learning method . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A second PCR is performed by using the first step amplification products as DNA templates and the set of five primer combinations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The model only requires the sequence , temperature , and a set of empirical basepair binding and stacking energy parameters , and the good agreement with experiment suggests that pause point locations are primarily determined by the DNA sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Target group specificity of each primer and probe set was empirically verified by testing DNA isolated from 28 archaeal cultures and by analyzing potential false results . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We here report that the formation and breakdown of an intramolecular cytosine thymine ( CT ) motif DNA triple helix can be performed repeatedly , quickly and independently of its local concentration without performance reduction over successive cycles ; as a consequence , we propose that this set of characteristics makes the DNA duplex triplex transition an ideal candidate to power simple nanometer scale devices capable of maintaining effective performance regardless of their local concentration . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We found that SET containing proteins of the SET 1 and SET 2 families contain motifs in the pre SET region or at the pre SET SET and SET post SET boundaries which very tightly bind single stranded DNA ( ssDNA ) and RNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Five barley chloroplast DNA microsatellites ( cpSSRs ) were used to study genetic relationships among a set of 186 barley accessions 34 Hordeum vulgare ssp . spontaneum ( HS accessions ) from Morocco , Ethiopia , Cyprus , Crete , Libya , Iraq , Iran , Turkey , Afghanistan and Israel , 122 H . vulgare ssp . vulgare landraces ( HV landraces ) from Spain , Bolivia ( old Spanish introductions ) , Morocco , Libya and Ethiopia and 20 modern European spring barleys ( HV cultivars ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA from 20 individuals from each origin were screened against 11 recently isolated and characterized S . japonicum microsatellites , and a set of nine loci were selected based on their polymorphic information content . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULT : We present a modification of the Gibbs sampling motif extraction algorithm , SeSiMCMC ( Sequence Similarities by Markov Chain Monte Carlo ) , which finds structured motifs of these types , as well as non structured motifs , in a set of unaligned DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
As a first step in a broad screen of geminivirus and nanovirus intergenic sequences for DNA segments important in controlling viral gene expression , we have ' mined ' a large set of viral intergenic regions for transcriptional enhancers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using a phylogenetic approach based on a large data set including protein coding and 12S DNA sequences as well as morphology , we now have precise information about the number of moa species that once existed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To investigate the molecular basis for the selective utilization of nucleoside triphosphates complementary to templating bases , by RB 69 DNA polymerase ( RB 69 pol ) , we constructed a set of mutants that we predicted would perturb the `` floor ' ' of the nascent base pairing interface in the enzyme . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a separate set of 6 animals , total content of water , DNA , collagen ( and type ) , GAG ( and type ) were also determined . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Accuracy and efficiency of atomic basis set methods versus plane wave calculations with ultrasoft pseudopotentials for DNA base molecules . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : DNA from eighteen families , densely affected by alcoholism , was used to genotype a set of polymorphic microsatellite markers at loci approximately 10 centimorgans apart spanning the short arm and part of the long arm of chromosome 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have investigated recombination mechanisms promoting the completion of replication in the face of unrepaired DNA damage by transforming an isogenic set of uvrA 6 excision defective Escherichia coli strains with pUC based plasmids in which each strand carried , at staggered positions , a single thymine thymine pyrimidine ( 6 4 ) pyrimidinone lesion . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The gene detection package ( SHARKhunt ) runs on a Linux system and requires only a set of raw DNA sequences ( genomic , expressed sequence tag and / or genome survey sequence ) as input . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our approach enables us to study the full combinatorial set of sequences for a variety of DNA binding proteins , make a detailed analysis of non additive effects and exploit this information to improve binding site predictions using either weight matrices or support vector machines . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A second set of acceptor RNAs that could bind to the 25 base hybrid region and to various lengths of additional bases on the DNA was used to displace the donor by hybridizing with the DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sequence analysis tools are needed , however , to decide whether these interpretations are likely , whether a particular set of LCRs represents nearly neutral drift creating junk DNA , or whether the appearance of LCRs reflects assembly error . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Furthermore , a set of the genes involved in DNA repair , replication , and chromatin remodeling was downregulated in MS . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It allows identifying the responsible set of regulators in combination with their corresponding DNA recognition sites ( motifs ) and target genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The in silico analysis allowed identification of a set of species specific restriction endonucleases ( HaeIII , TaqI , and MwoI ) , which generated easily analyzable species specific restriction profiles of the 275 bp cytb DNA fragment . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A series of nonpolar thymidine analogues of increasing size : DNA base pairing and stacking properties . [ reaction : see text ] We describe the properties in DNA of a set of five nonpolar nucleoside mimics in which shape is similar but size is increased gradually . ^^^ The results establish the base pairing properties of a potentially useful new series of biochemical probes for DNA protein interactions and also identify a set of new , stable hydrophobic base pairs for designed genetic pairing systems . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Evaluation of a multi parameter biomarker set for oxidative damage in man : increased urinary excretion of lipid , protein and DNA oxidation products after one hour of exercise . ^^^ The objective of the present study was to evaluate a comprehensive set of urinary biomarkers for oxidative damage to lipids , proteins and DNA , in man . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A simple fitting routine was developed using a basis set ( lipid , protein , DNA , RNA ) to estimate the relative amounts of biochemical components in cells and nuclei . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We genotyped 93 hybrid morphotypes and samples from four parental reference populations from within and outside the zone of sympatry for a genome wide set of 20 nuclear microsatellites and eight plastid DNA restriction site polymorphisms . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In response to cold shock , Y . pestis has evolved complex adaptive mechanisms by elevating the transcription of a specific set of genes whose protein products are designed to prevent or eliminate cold induced DNA or RNA structuring , to remodel cell membrane components for maintenance of normal functions , to elevate the energy generation for ensuring ATP dependent responses during cold adaptation and to synthesize or transport compatible solutes such as cryoprotectants , and at the same time , by repressing the mRNA level of certain genes whose protein products are not needed for bacterial growth at low temperatures , such as the MHSPs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
HPV DNA was detected by the Digene HC 2 assay using the high risk probes only and by PCR with the SPF 10 primer set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Despite unexpected heterogeneity and diversity in their DNA sequences , many studies have revealed that most of the Crystallin genes are regulated by a relatively small set of developmentally important transcription factors . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The phylogenetic analysis of the combined DNA set was confronted with characters derived from ITS 2 secondary structures . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
There are a variety of nonspecific surface action treatments which stimulate the same set of reactions as the growth factors do , of which protein synthesis is most directly related to the onset of DNA synthesis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An animal was considered infected if MAP DNA was detected in at least two separate tissues using the IS 900 primer set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It was found that the new parameter set performs as well as the previous parameter sets in terms of protein ( 45A3 ) and DNA ( 45A4 ) stability and that it is better at describing the folding unfolding balance of the peptide . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
All the CAPS markers in a set were used to test for polymorphism among 10 additional pea DNA samples extracted from different marker lines and cultivars . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A 17 base pair oligonucleotide d ( GGAAAATCTCTAGCAGT ) , d ( ACTGCTAGAGATTTTCC ) reproducing the U 5 LTR extremity of viral DNA that contains the IN attachment site was analysed by NMR using the classical NOEs and scalar coupling constants in conjunction with a small set of residual dipolar coupling constants ( RDCs ) measured at the 13C / 15N natural abundance . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The genomes encode highly conserved proteins required for DNA replication and mRNA transcription as well as a variable set of virulence factors ; transcription takes place within the cytoplasm of the host cell . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These assemblies contain characteristic stretches of DNA that flank particular regions of silent chromatin , as well as five distinctively modified histones and a set of protein complexes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Both S . domuncula and G . cydonium possess a surprisingly large genome of approximately 1 . 7 pg DNA per haploid set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A primer set of 12 primers was used for screening the DNA of CeHV 1 , HHV 1 , and HHV 2 by detailed PCR . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : We used a set of 10 fluorescent in situ hybridisation ( FISH ) DNA probes , capable of detecting all reported and hypothetical deletions between the LCR 22 , and analysed 350 patients . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
SET , PHD and bromodomain ) and / or DNA binding ( HMG box and AT hook ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have investigated the influence of flanking sequence on the catalytic activity of the Dnmt3a and Dnmt3b de novo DNA methyltransferases using a set of synthetic oligonucleotide substrates that covers all possible + / 1 flanks in quantitative terms . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We demonstrate the specificity , reproducibility and flexibility of this process by performing a 96 plex amplification of an arbitrary set of specific DNA sequences , followed by hybridization to a cDNA microarray . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of immunoprecipitation tests was conducted with the antibody and chromatin from the sugarcane genome to reveal CENH 3 associated DNA sequences in sugarcane . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The framework model has three main elements : ( 1 ) a set of four key variables that describe the important motions within the protein DNA nucleotide complex , ( 2 ) a complete set of conformational states for the protein DNA nucleotide system , and ( 3 ) an approximate potential energy surface that controls the motions and transition rates between states . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To enhance the credibility of future studies and assist in discarding false positive results , we propose a rigorous set of authentication criteria for work with geologically ancient DNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In an analysis of DNA microarray gene expression data from 295 previously published breast carcinomas , we found that expression of this gene set defined two groups of breast carcinomas with significant differences in overall survival . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When combined with previous work , we have assembled a data set of 37 single crystal structures from 29 of the sequences in this motif , representing three structural classes of DNA ( B DNA , A DNA , and four stranded Holliday junctions ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One characteristic of sex chromosomes is the accumulation of a set of different types of repetitive DNA sequences in the Y chromosomes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The LAMP method amplifies DNA with high specificity , efficiency , and rapidity under isothermal conditions using a set of four specially designed primers and a DNA polymerase with strand displacement activity . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The results provide evidence that hairpin conjugates of achiral seco CI Bf gamma polyamides could be tailored to target specific DNA sequences according to a set of general rules : the achiral CI moiety selectively reacts with adenine N 3 , a stacked pair of imidazole / benzofuran prefers a G / C base pair , and a pyrrole / benzofuran prefers an A / T or T / A base pair . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
From analysis of a diverse set of 23 natural and unnatural bases , it appears that stacking free energies and stacking conformations play an important role in pairing of DNA nucleotides . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : Forty eight SNPs showed allele associations ( P < 0 . 05 ) in the first set of DNA samples ( 380 RA cases and 380 non RA controls ; first stage analysis ) . ^^^ For 4 of the SNPs in the SEC8L1 gene , the association was replicated ( P < 0 . 05 ) in the second , independent set of DNA samples ( an additional 380 RA cases and 380 non RA controls ; second stage analysis ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of primers was developed to detect by polymerase chain reaction ( PCR ) the proviral DNA of bovine immunodeficiency virus ( BIV ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The aim of this study was to identify differentially expressed genes in old and young kidneys of Fisher 344 male rats during the aging process using complementary DNA representational difference analysis ( cDNA RDA ) . cDNA RDA is a subtractive technique for identifying a focused set of differentially expressed genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
OBJECTIVE : The current study was designed to test the possible release and bioavailability of polycyclic aromatic hydrocarbons ( PAHs ) from a set of commercial carbon blacks ( CBs ) as well as the ability of these PAHs to form bulky DNA adducts . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Despite the different lengths of DNA in the pseudo dodecamers and pseudo tridecamer , all three structures form A DNA duplexes that share a common set of crystal contacts , including a T * ( G . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Genome stability requires a set of RecQ Top 3 DNA helicase topoisomerase complexes whose sole budding yeast homolog is encoded by SGS 1 TOP3 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RECQ 1 stably bound to a variety of DNA structures , enabling it to unwind a diverse set of DNA substrates . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The differences of TTV DNA positivity rates between study groups were found statistically insignificant , when data from each set of primer were compared ( p > 0 . 05 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA microarray experiments showed that FhuR targets are restricted to this set of 18 genes clustered in seven transcriptional units , while cysteine starvation modifies the transcription level of several other genes potentially involved in oxidoreduction processes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Spatial fluctuations of guanine and cytosine base content ( GC % ) are studied by spectral analysis for the complete set of human genomic DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Shannon information ( SI ) and its special case , divergence , are defined for a DNA sequence in terms of probabilities of chemical words in the sequence and are computed for a set of complete genomes highly diverse in length and composition . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The complete set of primers was developed with an emphasis on discrimination between plant and fungal sequences and should be particularly useful for studies of fungi where samples also contain high levels of background plant DNA , such as verifying ectomycorrhizal morphotypes or characterizing phylosphere communities . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The dried blood spots from each set were detected for the HIV DNA every 2 weeks for 14 weeks . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Quantitative structure activity relationship ( QSAR ) model has been formulated for a set of DNA binding topoisomerase ( topo ) ( substituted bis [ ( acridine 4 carboxamide ) propyl ] methylamines ) on murine Lewis lung carcinoma ( LL ( c ) ) cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Repair of DNA double strand breaks by homologous recombination requires an extensive set of proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A standard curve for DNA quantification was created for each primer probe set based on colony forming units equivalents . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
SUMMARY : MeSHer uses a simple statistical approach to identify biological concepts in the form of Medical Subject Headings ( MeSH terms ) obtained from the PubMed database that are significantly overrepresented within the identified gene set relative to those associated with the overall collection of genes on the underlying DNA microarray platform . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To address this problem and further complete the snoRNA assignment to Psi sites , we identified the complete set of RNAs associated with the H / ACA snoRNP specific proteins Gar1p and Nhp2p by coupling TAP tag purifications with genomic DNA microarrays experiments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the matched data set , eight men ( 15 % ) who developed PSA recurrence were positive for DNA with GSTP 1 CpG hypermethylation , whereas no patient who was free of disease was positive for GSTP 1 CpG island hypermethylation ( McNemar test , chi ( 2 ) = 6 . 1 , P = 0 . 01 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a first set of experiments , gene 4 from octopine plasmid pTiAch 5 and nopaline plasmid pTiC 58 was expressed in Escherichia coli , and the gene products were identified by reaction with antiserum raised against a decapeptide derived from the DNA sequence of the gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
T cell immunity plays a critical role in controlling HIV 1 viremia , and encoding a limited set of HIV 1 genes within DNA and poxvirus vectors can , when used sequentially , induce high levels of T cell immunity in primates . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA microarray analysis of gene expression changes in exercise induced cardiac hypertrophy suggests that a set of genes involved in fatty acid and glucose metabolism could be fundamental to the beneficial phenotype of exercise induced hypertrophy , as these changes are absent or reversed in maladaptive hypertrophy . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The malignant cell has a different DNA methylation pattern and a set of DNA methyltransferase activities expressed as compared with normal cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The set was used to screen DNA from limb girdle muscular dystrophy ( LGMD ) patients for the presence of pathogenic deletion or duplication mutations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our approach relies on novel probabilistic models for DNA binding sites and modules of binding sites , on algorithms to study them from the data and on a support vector machine that uses the models studied to classify a set of sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : In a set of human DNA sequences with experimentally characterized TSSs , the placement of 791 octonucleotide words was unusually consistent ( multiple test corrected P < 0 . 05 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To our knowledge these results are the only comparison of adducts in MNCs with lung tissue , and the only data set indicating that blood MNCs are a valid surrogate for lung adduct DNA burden . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In silico motif detection strategies search for DNA patterns that are present more frequently in a set of related sequences than in a set of unrelated sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The mRNA levels of invasion related genes were evaluated based on a DNA microarray data set , and we found two gene abnormalities most relevant for the invasion of malignant germ cells : matrix metalloproteinase 9 ( MMP 9 ) and plasminogen activator , urokinase ( PLAU ) genes were up regulated in a study comparing tissue samples of TGCT and IGCN . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
As a set of comparative benchmarks derived from six protein coding genes for mammals shows , the strategy implemented in transAlign always improves the speed and usually the apparent accuracy of the alignment of protein coding DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The eukaryotic cell has evolved a sophisticated set of cell signaling pathways that respond to DNA damage and efficiently repair that damage , protecting the cell from deleterious mutations , genomic instability , and transformation into a cancerous state . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An archaeal SET domain protein exhibits distinct lysine methyltransferase activity towards DNA associated protein MC 1 alpha . ^^^ Particularly , G1 SET exhibits selective methyltransferase activity towards one of the major archaeal DNA interacting protein MC 1 alpha at lysine 37 . ^^^ Our findings suggest that SET domain proteins such as G1 SET may restructure archaeal chromatin that is composed of MC 1 DNA complexes , and that modulation of chromatin structure by lysine methylation may have arisen before the divergence of the archaeal and eukaryotic lineages . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The restriction enzyme that could potentially produce the most restriction fragment length polymorphisms ( RFLPs ) was determined from all available ISR DNA sequences in GenBank to produce a novel data set of RFLPs for 31 slowly growing Mycobacterium species . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sequence logos have become a popular way to graphically represent DNA and amino acid sequence patterns from a set of aligned sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
With MuPlex , users specify a set of DNA sequences along with primer selection criteria , interaction parameters and the target multiplexing level . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The full set of such changes is specific for each individual enzyme and is a very important for effective adjustment of reacting orbitals of enzyme and specific DNA atoms with accuracy up to 10 15 degrees . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The triggering and biological activity of the naturally occurring enediyne dynemicin A ( 1 ) was investigated , both inside and outside the minor groove of the duplex 10 mer B DNA sequence d ( CTACTACTGG ) . d ( CCAGTAGTAG ) , using density functional theory ( B3LYP with the 3 21G and 6 31G ( d ) basis set ) , BD ( T ) / cc pVDZ ( Brueckner doubles with a perturbative treatment of triple excitations ) , and the ONIOM approach . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Messenger RNA was extracted , and the samples were labeled with two different fluorescent dyes and hybridized to the RIKEN set of 18 , 816 full length enriched mouse complementary DNA microarrays . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We analysed a set of multigenic HIV and SHIV DNA and Fowlpoxvirus ( FPV ) prime and boost vaccines for immunogenicity and protective efficacy in outbred pigtail macaques when delivered via mucosal surfaces ( intranasally or intrarectally ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Sample division comparisons based on PhiST genetic distance measures revealed no significant population differentiation in the distribution of mtDNA sequence variations between the present data set and a database in The Scientific Working Group on DNA Analysis Methods ( SWGDAM ) , but did indicate differences from other sets of data . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Although a set of four hexanucleotide ( H ) sequences to the right of the palindrome ( organized in two tandem repeats : the proximal H1 / H2 and the distal H3 / H4 ) are binding sites for the viral Rep associated proteins in vitro , only a proximal tandem ( H / H or h like / H ) is essential for PCV 1 DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thus , Hwaeomputkong and the six North American mapping parents provide a diverse set of soybean genotypes that can be successfully used for SNP discovery in coding DNA and closely associated introns and untranslated regions . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In addition , we also describe a set of control gene primers designed to amplify amplicons of 100 , 200 , 300 , 400 , and 600 bp for the assessment of the integrity and amplifiability of DNA . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The new primer set was shown to be highly selective for Sphingomonas sp . strain EPA 505 as it only amplified DNA from strain EPA 505 and not from other tested Sphingomonas strains or soil bacteria not belonging to the Sphingomonas genus . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Previously , we have identified a set of DHP derived DNA adducts from DHP modified calf thymus DNA by ( 32 ) P post labeling / HPLC analysis . ^^^ Metabolism of monocrotaline in the presence of calf thymus DNA resulted in a similar set of DHP DNA adducts . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We constructed a set of Escherichia coli strains containing deletions in genes encoding three SOS polymerases , and defective in MutS and DNA polymerase 1 ( PolI ) mismatch repair , and estimated the rate and specificity of spontaneous endogenous tonB ( + ) > tonB mutations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To determine how this epigenetic modification is distributed in the genomes of primary and transformed cells , we used an immunocapturing approach followed by DNA microarray analysis to generate methylation profiles of all human chromosomes at 80 kb resolution and for a large set of CpG islands . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A small scale DNA microarray containing a set of oligonucleotide probes targeting the 16S rRNAs of several groups of nitrifying bacteria was developed for the monitoring of wastewater treatment plant samples . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Hence , in the analyses of molecular evolution process on the DNA sequence set of length N , the Z ( 64 ) algebra will help us explain the quantitative relationships between genes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of products created for mouse housekeeping genes from MPrime designed primer pairs has been validated using both PCR amplification and DNA sequencing . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For each protein and DNA alone we find that additive models are good approximations , but over the combined set of data there are context effects that limit their accuracy . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The Arabidopsis CBF proteins activate expression of a set of genes whose upstream regulatory sequences typically harbor one or more copies of the CRT / DRE low temperature cis acting DNA regulatory element . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this study , for the detection and typing of human papillomavirus isolated from Korean patients with flat warts , polymerase chain reaction ( PCR ) and restriction endonuclease digestion were carried out with a set of restriction endonucleases , using the cloned HPV DNA and DNA from clinical specimens . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Microarray analysis with a DNA chip representing 21500 genes and subsequent comparison with other PCD related expression studies revealed a set of new H ( 2 ) O ( 2 ) responsive genes that were highly regulated in a common fashion during different types of PCD . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Of the incident CVD cases , 507 had DNA samples ; 2 controls / case were selected by risk set sampling ( matched on age and birth year ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To understand the roles of these residues in helicase function , we obtained a set of mutants and examined various activities , including oligomerization , ATPase , DNA binding , and helicase activities . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In conclusion , from a single set of AFM experiments , it is possible to determine the binding affinity , specificity and stoichiometry , as well as the conformational properties of the protein DNA complexes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When evaluated as a marker for colon cancer detection in fecal DNA from another set of colon cancer patients , aberrant vimentin methylation was detected in fecal DNA from 43 of 94 patients , for a sensitivity of 46 % ( 95 % confidence interval [ CI ] = 35 % to 56 % ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Ionizing radiation ( IR ) and reactive oxygen species cause a diverse set of double strand DNA end configurations . ^^^ Non homologous DNA end joining ( NHEJ ) is an optimal DNA repair pathway for dealing with such a diverse set of DNA lesions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : Thirty individual DNA samples were sequenced to search for SNPs , and the function of the SNPs was examined by a set of biochemical assays . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Codons refer to those parts in a DNA complex encoded towards forming a desired set of proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this paper we present and discuss a strategy based on simulated annealing , which makes use of these models to infer a phylogenetic tree for a set of DNA or protein sequences together with the sequences ' indel history , i . e . , their multiple alignment augmented with information about the positioning of insertion and deletion events in the tree . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The Neurospora crassa genome includes nine SET domain genes ( set 1 through set 9 ) in addition to dim 5 , which encodes a histone H 3 lysine 9 HMT required for DNA methylation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Macronuclear deoxyribonucleic acid ( DNA ) in hypotrichous ciliates consists of a set of linear molecules ranging in size from 0 . 5 to several tens of kilobases and typically carrying a single gene . ^^^ In analyzing the encystment excystment cycle of Sterkiella histriomuscorum , we have characterized a set of 21 macronuclear molecules both at the DNA and complementary DNA ( cDNA ) levels . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of condensed matrices was constructed to represent DNA sequences based on the sieve ratios of trinucleotide in sequence . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
AIMS : Two different strain characterization techniques , random amplified polymorphic DNA ( RAPD ) and killer toxin sensitivity ( KTS ) , were compared to assess their typing performance using a set of 30 certified Saccharomyces cerevisiae strains . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The second internal transcribed spacer of ribosomal DNA is PCR amplified from any of the seven species using a single set of oligonucleotide primers ( one of which is fluorescently labelled ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To maintain chromosomal integrity and to protect the ends of chromosomes against recognition as damaged DNA , end to end fusion , or recombination , a coordinated set of genes is required to stabilize the telomere . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Electrophoretic mobility shift assays using specific DNA fragments from the 258 bp region detect in embryonic nuclear extracts a complex set of DNA binding proteins that are largely absent in adults . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
MLPA was performed on DNA of normal and dysplastic oral mucosa as well as of OSCC with the intention to select a specific probe set for accurate detection of precursor lesions in the oral cavity . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Single and multiplex PCR amplification of DNA from Lawsonia intracellularis , Salmonella typhimurium and Brachyspira hyodysenteriae with each primer set produced fragments of the predicted size without any nonspecific amplification , 210 bp , 298 bp and 403 bp bands , respectively . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To elucidate the point in HSV 1 replication where arrest occurred , a set of key regulatory events leading to the viral multiplication was examined , including HSV 1 DNA synthesis and viral immediate early gene expressions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Phylogenetic analysis of intestinal bacterium using the distribution of intestinal bacterium in cyprinidate fishes and 16S DNA sequence data set ] . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The laryngeal biopsies were taken and investigated for HPV DNA presence using real time polymerase chain reaction ( PCR ) with a set of consensus primers ( MY09 / 11 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In response to ionizing radiation , p 53 regulates the transcription of genes in a diverse set of pathways including DNA repair , cell cycle arrest , and apoptosis . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Three different DNA fingerprinting techniques , the mobile genetic element ( MGE ) PCR , simple sequence repeat ( SSR ) PCR and random amplified polymorphic DNA ( RAPD ) PCR , were used to define a large set of genetic markers to study genetic similarity within and among Trypanosoma brucei , Trypanosoma equiperdum and Trypanosoma evansi strains ( n=18 ) from China , Africa and South America and to investigate their genetic relationships . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The Q PCR was used quantitatively by incorporating a set of external M . gallisepticum DNA standards , derived from a M . gallisepticum log phase culture of a known concentration . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This panel of markers incorporates the 9 locus European minimal haplotype ( EMH ) loci recommended by the International Y STR User Group and the 11 locus set recommended by the Scientific Working Group on DNA Analysis Methods ( SWGDAM ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This remarkable set of attributes makes sensors based on ss DNA decorated nanotubes very promising for `` electronic nose ' ' and `` electronic tongue ' ' applications ranging from homeland security to disease diagnosis . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We also found that hnRNPA 2 has much higher affinity for single standed DNA than for SET . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We estimated error rates with the Affymetrix GeneChip SNP platform in samples from a family with a mixed set of monozygotic ( MZ ) and dizygotic ( DZ ) triplets using lymphocyte , buccal DNA and samples from whole genome amplification using the multiple displacement amplification ( MDA ) technique . ^^^ Our results demonstrate highly accurate and reproducible genotyping for the Affymetrix GeneChip Human Mapping Set in lymphocyte and buccal DNA samples . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
CONCLUSIONS : Although the effect sizes of the five SNP associations are very small , behavioural genomic analyses using a ' g ' SNP set illustrate how developmental , multivariate and GE questions can be addressed as more DNA associations are identified for complex traits such as ' g ' . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The extraction of DNA from archaeological or forensic skeletal remains can provide quite powerful data for analysis , but is plagued by a unique set of methodological problems . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Although the majority of fluoroquinolone target gene sequences in this set of isolates can be explained on the basis of clonal dissemination , a significant number are more parsimoniously explained by intraspecific lateral DNA transfer , and in situations of high S . pneumoniae population density , such events could be an important means of resistance spread . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For this study , a panel of 199 widely distributed AIMs was used to examine a diverse set of 796 DNA samples including self identified European Americans , West Africans , East Asians , Amerindians , African Americans , Mexicans , Mexican Americans , Puerto Ricans and South Asians . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This algorithm was validated through comparison of allele frequencies from a set of 10 individually genotyped DNA ' s and frequencies estimated from pools of these 10 DNAs using GeneChip 10K Mapping Xba 131 arrays . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of four primers was designed by targeting the IHHNV genome DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Currently only a small number protein mimics of DNA are known or suspected , including Ugi , HI 1450 , Ocr , TAF 1 , MfpA , and Dinl . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A library of ZFPs fused to a C terminal peptide tag is encoded by a set of DNA cassettes that are prepared wholly in vitro . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Cells grown on phenol comprised a third subpopulation with a single DNA set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We analyzed a set of ocular adnexal lymphomas and benign ( non neoplastic ) lesions for evidence of C . psittaci DNA in patients from New York State . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A general approach is the joining , by T 4 DNA ligase mediated splinted ligation , of two or more RNA fragments , each of which may contain its own set of modified nucleotides . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The assay was optimized to amplify parasitic DNA by incubation with Bst DNA polymerase and a set of six specially constructed primers at 65 degrees C for 60 min . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This approach was applied to a large data set of 55 , 630 patients who underwent clinical BRCA 1 screening by whole gene direct DNA sequencing . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : In this paper , we apply a sparse Bayesian learning algorithm to identify a small set of class specific features in the DNA sequences bound by different classes of TFs ; the algorithm simultaneously learns a true multi class classifier that uses these features to predict the DNA binding domain of the TF that recognizes a particular set of DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A rapid and versatile combined DNA / RNA extraction protocol and its application to the analysis of a novel DNA marker set polymorphic between Arabidopsis thaliana ecotypes Col 0 and Landsberg erecta . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We applied multitude multicolor banding ( mMCB ) in combination with a novel FISH DNA probe set including subcentromeric , subtelomeric and whole chromosome painting probes ( subCTM ) to characterize a Pan paniscus ( PPA ) cell line . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : Here we explore the phylogenetic signal present in molecular data by genomic signatures , defined as the set of frequencies of short oligonucleotides present in DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Overall DNA methylation in Dictyostelium is approximately 0 . 2 % of the cytosine residues , which indicates its restriction to a limited set of genomic loci . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By amplifying DNA from hemolymph of infected pea aphids , we obtained a set of genomic sequences of H . defensa and an associated bacteriophage . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In order to select a critical set of TFBMs from genomic DNA information and an array derived data , an efficient algorithm to solve a combinatorial optimization problem is required . ^^^ Applying SVD to a promoter matrix defined from regulatory DNA sequences , we derived a novel method to predict the critical set of TFBMs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A recently validated bovine species specific PCR primer set targeting the ATPase 8 subunit gene in bovine mitochondrial DNA was suitable for detection of bovine material in gelatin . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA samples were amplified by PCR for DNA typing using a set of 15 STRs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The multiplex amplification reaction includes six STR loci from the European standard set of loci ( ESS ) for DNA databases ( D3S1358 , D8S1179 , D21S11 , THO 1 , FGA and VWA ) as well as four additional STR systems selected for their robustness ( D2S1338 , D12S391 , TPOX and D5S818 ) together with the sex specific locus amelogenin . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A group specific primer set was developed using nodC as a target gene for the amplification of rhizobial sequence diversity from nodule isolates and total soil DNA preparations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have designed and tested a new set of pufM specific primers and revealed several new AAnP variants in environmental DNA samples and genomic libraries . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The SET domain protein Metnase mediates foreign DNA integration and links integration to nonhomologous end joining repair . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We developed a microplate based KSHV POL8 / PF8 mediated DNA synthesis inhibition assay suitable for HTS and screened the NCI Diversity Set that comprised 1992 synthetic compounds . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Generally , a single PCR tube containing the DNA sequence of interest is run as a positive control with each set of reactions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The computationally challenging problem of reconstructing the phylogeny of a set of contemporary data , such as DNA sequences or morphological attributes , was treated by an extended version of the neighbor joining ( NJ ) algorithm . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A P . euphratica DNA microarray with a uni gene set of ESTs representing approximately 6 , 340 different genes was constructed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
ApoE genotyping also was performed on a larger set of data ( n=1 , 211 from 271 families , ages 3 85 years ) from the cohort with available DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Global phylogeny of Mycobacterium tuberculosis based on single nucleotide polymorphism ( SNP ) analysis : insights into tuberculosis evolution , phylogenetic accuracy of other DNA fingerprinting systems , and recommendations for a minimal standard SNP set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have recently reported that TAF 1 binds to major core protein 7 and forms DNA protein 7 TAF 1 ternary complexes in vitro and in vivo . ^^^ Further to understand the mechanism of remodeling of the Ad core , we characterized the interaction mode between the precursor of protein 7 ( pre 7 ) and either DNA or TAF 1 by means of biochemical and biophysicochemical methods . ^^^ We found that a major binding region of pre 7 with both DNA and the acidic carboxyl terminal region of TAF 1 lies in the arginine rich region of pre 7 . ^^^ Thus , DNA interacted with the entire region of pre 7 , while TAF 1 bound preferentially to the carboxyl terminal region of pre 7 . ^^^ This binding mode suggests the formation of the ternary complexes among DNA , protein 7 , and TAF 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Both soil and bait communities arising from DNA amplified with a Peronosporomycetidae biased primer set ( Oom 1 ) were dominated by Pythium species . ^^^ In contrast , communities arising from DNA amplified with a Saprolegniomycetidae biased primer set ( Sap 2 ) were dominated by Aphanomyces species . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The results support a new , multifactorial model that describes how genotoxic stress enables BRCA 1 to execute a diverse set of DNA damage response functions . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Not only the information in DNA , but also smaller molecules responsible for the transcription and translation of DNA into amino acids , are adaptively changed during evolution , which optimizes the fundamental mapping from binary substrings in DNA ( genotype ) to real values for a parameter set ( phenotype ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA intercalator 9 aminoachridine was used for obtaining high resolution DAPI patterns of chromosomes of Pisum sativum L . with more than 300 bands per haploid chromosome set . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For three of these five genes [ PGR ( coding for the progesterone receptor ) , HSD17B4 ( coding for type 4 17 beta hydroxysteroid dehydrogenase , an enzyme that mainly degrades active 17 beta estradiol into inactive metabolites ) , and CDH 13 ( coding for H cadherin ) ] a higher prevalence of DNA methylation in HER 2 / neu positive cancers was confirmed in an independent set of microdissected primary breast cancers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA obtained from the bone marrow aspirate sample and from the blood buffy coat was submitted to polymerase chain reaction ( PCR ) with a set of rDNA based primers S4 / S12 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A novel set of 1 domain specific antibodies was obtained by a DNA vaccination / V gene repertoire cloning approach . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An additional primer probe set based on plant cytochrome oxidase ( COX ) was used as a positive internal control to assess the quality of the DNA extracts . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have used principal component analysis to identify a relatively small set of independent parameters , with which to characterize each DNA helix . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This article presents a set of key events whereby DNA reactivity initiates the process of carcinogenicity that leads to the subsequent mutation induction and enhanced cell proliferation that ultimately results in tumor development . ^^^ This set of key events for DNA reactive chemicals was applied to two case studies ( aflatoxin B 1 and dichloromethane ) with the aim of assessing the utility of the Human Relevance Framework ( HRF ) for this class of chemicals . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To discover novel compounds for the inhibition of human DNA methyltransferases , we have screened a set of small molecules available from the NCI database . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Base stacking energies in ten unique B DNA base pair steps and some other arrangements were evaluated by the second order Mller Plesset ( MP 2 ) method , complete basis set ( CBS ) extrapolation , and correction for triple ( T ) electron correlation contributions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA sequencing of the amplicon showed 100 % homology with F . hepatica , and 75 89 % homology with other trematodes on regions that did not include the entire set of primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA damage may not be the principal cause of high sensitivity to IR , considering that MR 1 carries genes encoding a complex set of DNA repair systems and 40 Gy IR induces less than one double strand break in its genome . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Several of the TRalpha HCC mutations also altered the DNA recognition properties of the encoded receptors , indicating that these HCC TR mutants may regulate a distinct set of target genes from those regulated by wild type TRs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The two ' forms ' of Achtheres differed in the DNA sequence amplified by one set of primers . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
However , the automatic extraction of regulatory motifs from a given data set of the upstream non coding DNA sequences of a family of co regulated genes is difficult because regulatory motifs are often subtle and inexact . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We examined a kit fox scat data set ( 353 scats ; 80 genotypes ) for genotyping errors using both genetic and GIS analyses , and evaluated the feasibility of combining both approaches to assess reliability of the faecal DNA results . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this paper , we present algorithms to locate a given set of immuno modulatory motifs in the DNA expression vectors corresponding to a given amino acid sequence and maximize or minimize the number and the context of the immuno modulatory motifs in the DNA expression vectors . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To better understand the specificity of specialized DNA polymerases to bypass lesions , we have constructed a set of derivatives of Salmonella typhimurium TA 1538 harboring plasmids carrying the polB , dinB or mucAB genes encoding Escherichia coli DNA polymerase 2 , DNA polymerase 4 or DNA polymerase RI , respectively , and examined the mutability to 30 chemicals . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In healthy males and carriers , the second set of primers would amplify the unmethylated DNA sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Predicted NatB substrates were dramatically overrepresented in a distinct set of biological processes , mainly related to DNA processing and cell cycle progression . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Primer extension is carried out with an extension primer positioned immediately upstream of the SNP that is to be genotyped , a complete set of four ribonucleotides and a ribonucleotide incorporating DNA polymerase . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A minimal set of DNA repair genes is sufficient for survival of Coxiella burnetii under oxidative stress . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We report here the release of a web based tool ( MDDNA ) to study and model the fine structural details of DNA on the basis of data extracted from a set of molecular dynamics ( MD ) trajectories of DNA sequences involving all the unique tetranucleotides . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : We have developed an algorithm that classifies all observed units of ASTI into an extendable set of distinct types ( e . g . cassette type ) by converting a collection of alignments between a genomic DNA sequence and cDNA sequences into binary description . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These advances were followed by a set of interconnected discoveries in my laboratory that revealed the biology of the ubiquitin system , i . e . , its necessity for the protein degradation in vivo , its specific physiological functions ( in the cell cycle , DNA repair , protein synthesis , transcriptional regulation , and stress responses ) , the source of its selectivity ( specific degradation signals in short lived proteins ) , and its key mechanistic attributes , such as the polyubiquitin chain and the subunit selectivity of protein degradation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A set of specific and universal primers based on 16S rDNA sequences was designed and validated for specific detection and quantification of DNA isolated from representative strains of Acidianus brierleyi , Sulfolobus sp . , Sulfobacillus thermosulfidooxidans , Sulfobacillus acidophilus , Acidithiobacillus caldus , and Leptospirillum ferrooxidans . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We validate this approach on a set of DNA microarrays with cytochrome p 450 family genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A multiplex PCR with a set of the 6 designed primers showed that they did not interfere with each other and bound specifically to the DNA target . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The results suggest that while Fis is able to recognize a minimal common set of DNA sequence determinants at different binding sites , it is also equipped with a number of residues that contribute to the binding strength , some of which play variable roles . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It has become clear that there is no simple ' code ' for protein DNA recognition and that selecting an optimal binding sequence along the DNA double helix corresponds to more than simply forming a set of specific hydrogen bonds or steric interactions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We develop a bioinformatics scoring and prediction method on the basis of a set of 1 , 184 DNA attributes , which refer to sequence , repeats , predicted structure , CpG islands , genes , predicted binding sites , conservation , and single nucleotide polymorphisms . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA based switches to deactivate / reactivate the sticky end . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our results show that , on a test set biased toward alignments of noncoding DNA , transition information significantly improves seed performance , while finer distinctions between different types of mismatches do not . ^^^ These results depend on properties of our test set that are not shared by EST based test sets with a strong bias toward coding DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Polintons from all these species are characterized by a unique set of proteins necessary for their transposition , including a protein primed DNA polymerase B , retroviral integrase , cysteine protease , and ATPase . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA samples from various tissues were analyzed by use of a set of orthopox virus specific , real time polymerase chain reaction assays . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Mitochondrial DNA ( mtDNA ) is maternally inherited and we observed an excess of maternal transmission of schizophrenia in a set of parent offspring affected pairs . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To further localize the point in the HSV 1 replication cycle where arrest occurred , a set of key regulatory events leading to the viral multiplication was examined , including viral immediate early ( alpha ) and late ( gamma ) gene expression and DNA replication . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The common set primers for type A influenza virus were able to amplify a 244 bp DNA band for any of the other subtypes of AIV . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
RESULTS : Here we present a protocol to amplify the set of Gene Ontology annotations associated to Affymetrix DNA microarray probe sets using information from related databases . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have successfully isolated a set of 25 unique DNA sequences that specifically bind to F . tularensis subspecies japonica . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The genomic DNA of mushrooms were extracted and 3 nuclear LSU rDNA fragments were amplified : set 1 for the 1 . 1 kb DNA fragment in the upstream region , set 2 for the 1 . 2 kb fragment in the middle , and set 3 for the 1 . 3 kb fragment downstream . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Structural DNA profiles use the structural properties of the constituent octamers either to observe any characteristics of a single sequence that are unusual ( a single sequence query ) or to visualize a pattern common to a set of sequences ( a multiple sequence query ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Over the past decade , the human identity testing community has settled on a set of core short tandem repeat ( STR ) loci that are widely used for DNA typing applications . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analysis of evidentiary materials from rape kits where semen or sperm cells are commonly found represents a unique set of challenges for on chip cell lysis and DNA extraction that must be addressed for successful application . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A new set of multiplexed PCR primers has been applied to the analysis of human skeletal remains to determine their efficacy in analyzing degraded DNA . ^^^ In this study , a set of 31 different human remains were exposed to a variety of environmental conditions , extracted , and amplified with commercial and Miniplex DNA typing kits . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The motivation for designing this set of DNA nanostructures originated from the desire to produce DNA lattices containing periodic cavities of programmable dimensions and to investigate the mechanism of DNA tube formation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using long range polymerase chain reaction ( PCR ) protocols , generating either one or two PCR products depending on the locus , amplified genomic DNA was directly sequenced to completion using a set of about 30 primers over each locus to yield contiguous sequence data from both strands . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Initially , these studies were performed with a limited set of B ZIP proteins , sequence specific DNA binding proteins that dimerize using the leucine zipper domain to bind DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The indices of mean heterozygosity , Hs = 0 . 455 , and interpopulation differentiation , FST = 0 . 0024 , for the Mari gene pool were obtained using a set of DNA markers analyzed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : The participating laboratories received a 4 sample set comprising 2 DNA plasmids , a PCR product , and a finished sequencing reaction to be analyzed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Another set of algorithms performs regression based ( Haseman Elston ) identical bydescent linkage analysis and genetic association analysis of DNA polymorphisms in relation to neural traits of interest in the same 3D population based brain atlas format . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this study we used sex linked ( mitochondrial DNA sequence and Y chromosome microsatellite ) markers from the same set of individuals to estimate the magnitude of difference in effective dispersal between the sexes and to investigate the long term demographic history of bonobos . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Histone and DNA methylation defects at Hox genes in mice expressing a SET domain truncated form of Mll . ^^^ These observations provide previously undescribed evidence for the in vivo relationship and SET domain dependence between histone methylation and DNA methylation on MLL target genes during embryonic development . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The phi 29 polymerase generated accurately , in a short time and from a single cell , sufficient DNA for a large set of tests , whereas the Bst enzyme showed a low efficiency and a high error rate . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For the real data set , we evaluated the role of two tagging single nucleotide polymorphisms ( tSNPs ) in the DNA repair gene , NBS 1 , and their association with female breast cancer in 462 cases and 572 controls selected to be BRCA1 / 2 mutation negative from 139 high risk Utah breast cancer families . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Benchmark database of accurate ( MP 2 and CCSD ( T ) complete basis set limit ) interaction energies of small model complexes , DNA base pairs , and amino acid pairs . ^^^ MP 2 and CCSD ( T ) complete basis set ( CBS ) limit interaction energies and geometries for more than 100 DNA base pairs , amino acid pairs and model complexes are for the first time presented together . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
To identify novel AAV isolates , we screened a diverse set of virus isolates for the presence of AAV DNA . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The development of noradrenergic sympathetic ganglion neurons depends upon expression of a core set of DNA regulatory molecules , including the Phox 2 homeodomain proteins and the basic helix loop helix proteins , HAND 2 and MASH 1 whose expression is dependent upon cell extrinsic cues . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The Scientific Working Group on DNA Analysis Methods ( SWGDAM ) Hispanic data set was analyzed to determine the diversity , phylogeny , and relevant single nucleotide polymorphisms ( SNPs ) that describe haplogroup patterns for Hispanic Americans ( N=686 ) , and to assess the degree of admixture regarding mitochondrial DNA ( mtDNA ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The 1 , 552 , 076 base pair long chromosome does not exhibit the colinearity observed between other rickettsia genomes , and encodes a complete set of putative conjugal DNA transfer genes most similar to homologues found in Protochlamydia amoebophila UWE 25 , an obligate symbiont of amoebae . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Southern blot analysis using diverse sequences , including two cellular genes ( S 2 and S 3 ) , a set of retrotransposons ( Osr 7 , Osr 36 , Tos 19 and more ) , and a MITE transposon family ( mPing and Pong ) , confirmed the results , and indicated that changes in DNA methylation pattern , genomic structure , and possible activation of some transposons indeed occurred in the mutant lines . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The use of DNA microarrays as a hypothesis generation tool for determining gene expression differences across thousands of genes in a data set is increasing . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Therefore , we examined the DNA copy number and protein expression profiles for CDK 2 , CDK 4 and GADD 153 , three genes that map to 12q12 14 , in a set of 44 paired FL / DLBCL samples from 22 patients . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
When rat liver microsomal metabolism of retrorsine occurred in the presence of calf thymus DNA , a set of DHP derived DNA adducts was formed ; these adducts were detected and quantified by using a previously developed 32P postlabeling / HPLC method . ^^^ Since DHP derived DNA adducts are suggested to be potential biomarkers of riddelliine induced tumorigenicity , our results indicate that ( 1 ) similar to the metabolic activation of riddelliine , the mechanism of retrorsine induced carcinogenicity in rats is also through a genotoxic mechanism involving DHP ; and ( 2 ) the set of DHP derived DNA adducts found in liver DNA of rats gavaged with retrorsine or riddelliine can serve as biomarkers for the tumorigenicity induced by retronecine type pyrrolizidine alkaloids . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Exact and approximation algorithms for DNA tag set design . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
It is to be expected that the new array based genotyping methods will not only greatly expand the scope of genetic studies , but , as further content is added to arrays , will also form part of an integrated set of DNA , RNA and proteomic analyses enabling the detailed , multilayered study of complex disease linked phenotypes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The sequence of the largest DNA segment , named ExoU island A , revealed many plasmid and genomic island associated genes , most of which have been conserved across a broad set of beta and gamma Proteobacteria . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A new set of highly specific primers for CK 19 , which avoids amplification of contaminating genomic DNA , was designed and evaluated to improve the specificity and sensitivity of the previously described methodology . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
By applying the core set approach to 38 partial env sequences of HIV 1 in a single patient and also 198 mitochondrial COI and COII DNA sequences of Anopheles dirus , we demonstrate how consistently this approach constructs the tree . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Here , we show that replication of a highly structured DNA in the presence of a unique set of dNTP analogues leads to synthesis of daughter DNA with a significantly reduced level of secondary structure . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Zinc finger proteins most likely also influence epigenetic regulatory systems , such as the complex set of chemical histone and DNA modifications , which control chromatin compaction and nuclear organization . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
PCR was also performed with genomic DNA from the mothers and affected children using a set of 22 microsatellite PCR primers on chromosomes 14 and 19 to establish linkage to the paternal allele . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : The EQUAL quant reagent set was developed to assess the technical execution of a standard TaqMan assay , including RNA extraction , reverse transcription , and real time PCR quantification of target DNA copy number . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA Sequencing Research Group ( DSRG ) of the ABRF conducted a study to assess the ability of DNA sequencing core facilities to successfully sequence a set of well defined templates containing difficult repeats . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Analysis of nuclear DNA from ten ground squirrels ( from a set of karyologically examined animals ) by RAPD PCR with eight oligonucleotide primers ( OPA 10 , OPA 12 , OPC 02 , OPC 5 , OPC 08 , OPC 09 , OPC 12 , and OPD 05 ) revealed four hybrids in two sites . with one of the hybrid being F 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Based on this phylogeny , we defined precisely a set of genomes , in which the protein activity is likely to be involved in DNA maintenance functions , the ' resident ' dam genomes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA was extracted and a set of broad range PCR primers that targeted a part of the 16S rDNA gene was used for pan bacterial PCR . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An important set of maternal regulations , such as DNA stability , transcriptional regulation and protection against oxidative stress , are impaired by age . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have reported previously that introgression by Zizania latifolia resulted in extensive DNA methylation changes in the recipient rice genome , as detected by a set of pre selected DNA segments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA was extracted from a set of isolates visually recognized as Penicillium , and the internal transcribed spacer region and partial LSU rDNA was amplified and sequenced . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this letter , we report studies on a different set of ethidium DNA conjugates . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
One set of genes , activated by the competence specific response regulator ComE , is involved in initiating competence , whereas a second set is activated by the competence specific alternative sigma factor ComX and functions in DNA uptake and recombination . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The exonuclease TREX 1 is in the SET complex and acts in concert with NM 23 H1 to degrade DNA during granzyme A mediated cell death . ^^^ Single stranded DNA damage is initiated when the endonuclease NM 23 H1 becomes activated to nick DNA after granzyme A cleaves its inhibitor , SET . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The DNA sequence of the positive clone , which was isolated from genomic DNA library of Amphidinium sp . ( strain Y 42 ) by PCR detection using the specific primer set , was analyzed by shotgun sequencing . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
For Q < 2Ne , characteristic of complexes of KWK 6 with this set of dT mers , the distribution of binding free energies deltaG ( o ) obs = RT ln Ki for sites along the DNA oligomer is parabolic , and Kobs and Sa Kobs are strongly dependent on absolute value ( ZD ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA was extracted from water samples and a set of eukaryotic universal primers directed to the small subunit rRNA genes ( rDNA ) was used . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A DNA microarray platform for the characterization of bacterial communities in freshwater sediments based on a heterogeneous set of 70 16S rRNA targeted oligonucleotide probes and directly labeled environmental RNA was developed and evaluated . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In order to elucidate the mechanism of DNA replication fork arrest by the replication terminator protein ( RTP ) DNA complex , a set of RTP fusion proteins were constructed in which peptides of various sizes were fused to the C terminus ; this placed the peptides at a surface location that was predicted to come into contact with the DNA replication machinery during fork arrest . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The gene set was further clustered on the basis of increased sensitivity to DNA damaging cancer drugs cisplatin and camptothecin . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We develop a web server for the recognition of DNA binding sites based on variable order Markov models and variable order Bayesian trees offering the following functionality : ( 1 ) given datasets with annotated binding sites and genomic background sequences , variable order Markov models and variable order Bayesian trees can be trained ; ( 2 ) given a set of trained models , putative DNA binding sites can be predicted in a given set of genomic sequences and ( 3 ) given a dataset with annotated binding sites and a dataset with genomic background sequences , cross validation experiments for different model combinations with different parameter settings can be performed . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
There is an increasing need to automatically annotate a set of genes or proteins ( from genome sequencing , DNA microarray analysis or protein 2D gel experiments ) using controlled vocabularies and identify the pathways involved , especially the statistically enriched pathways . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These capacities and a unique set of antioxidant enzymes and DNA repair mechanisms as well as oxygen insensitive enzymes provide RC 1 with a selective advantage over other methanogens in its habitats , thereby explaining the prevalence of RC 1 methanogens in the rice rhizosphere . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Transcriptional repression and DNA hypermethylation of a small set of ES cell marker genes in male germline stem cells . ^^^ CONCLUSION : Our results suggest that DNA hypermethylation and transcriptional repression of a small set of ECATs , together with post transcriptional repression of Oct3 / 4 and Sox 2 , contribute to the loss of pluripotency in male germ cells . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
OBJECTIVE / DESIGN : The objectives of the study were : 1 ) use the transmission / disequilibrium test ( TDT ) to assess linkage and association between PCOS and D19S884 ( and nearby markers ) in a third set of families ; and 2 ) test D19S884 and surrounding DNA sequence for in vitro regulatory activity in lymphoblastoid cell lines ( LCLs ) and granulosa cells . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
MOTIVATION : An important problem in molecular biology is to identify the locations at which a transcription factor ( TF ) binds to DNA , given a set of DNA sequences believed to be bound by that TF . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These products include : ( 1 ) multiple DNA methyltransferases and DNA site specific endonucleases , ( 2 ) the enzymes required to glycosylate their proteins and synthesize polysaccharides such as hyaluronan and chitin , ( 3 ) a virus encoded K ( + ) channel ( called Kcv ) located in the internal membrane of the virions , ( 4 ) a SET domain containing protein ( referred to as vSET ) that dimethylates Lys 27 in histone 3 , and ( 5 ) PBCV 1 has three types of introns ; a self splicing intron , a spliceosomal processed intron , and a small tRNA intron . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This information is now used for the selection of a non redundant set of clones for producing DNA micro arrays in order to examine global gene expression . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
An AM toxin 1 primer set , which could recognize Alternaria DNA only , was designed by using primers complementary to the AM toxin 1 gene . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
DNA was extracted from microdissected archival breast tissue containing ALH or LCIS , lacking adjacent invasive carcinoma , and subjected to whole genome tiling path microarray CGH using the submegabase resolution tiling set ( SMRT ) array platform . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The protocol was optimized and validated by testing a set of 16 SNP markers on 95 DNA samples from bovine sires of different breeds . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The paired end nature of short PET sequences derived from long DNA fragments raised a new set of bioinformatics challenges , including how to extract PETs from raw sequence reads , and correctly yet efficiently map PETs to reference genome sequences . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We developed a unique version of ant algorithms to select a set of binding motifs by considering a potential contribution of each of all random DNA sequences of 4 to 7 bp in length . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
They also provide a rare set of structural views of a ligand responsive transcription factor in the unbound , ligand induced , and DNA bound states , establishing a model system for the study of ligand mediated effects on transcription factor function . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This repressed set of genes significantly overlaps with miRNA 1 regulated genes that have been identified with DNA array technology and are predicted by computational methods . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A novel closed tube method for distinguishing thermophilic Naegleria species is presented , using a single primer set and the DNA intercalating dye SYTO 9 for real time PCR and melting curve analysis of the 5 . 8S ribosomal DNA gene and flanking noncoding spacers ( ITS 1 , ITS 2 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We attempt to classify protein DNA complexes by using a set of 11 descriptors , mainly characterizing protein DNA interactions , including the number of atomic contacts at major and minor grooves , conformational deviations from standard B and A DNA forms , widths of DNA grooves , GC content , specificity measures of direct and indirect readouts , and buried surface area at the complex interface . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Using one primer set , which framed a region within the APV 4b core protein gene , it was possible to detect APV specific DNA from all four tested isolates . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In addition , we examined the gene expression profile in another set of 30 gastric samples , but no significant over expression of either the beta PIX gene or the alpha PIX gene was found . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The more sensitive ' 1183 ' was also able to respond to drought by activating its whole set of APX genes . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Thus , all studied tissues of the amphibian early gastrula contain similar set of con A binding proteins ; however , only APE is capable of neutralization in response to con A action . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
As a demonstration of the feasibility of this method , we have used APE to speciate a known set of cultured mycobacteria . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Five of the Alu elements are shared by the whole set of primates studied , indicating insertion and fixation prior to the split of the ape and Old World monkey lineages . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our results indicate that the body structure of this Miocene ape closely resembles that of extant hominoids and differs from the pronograde pattern of Miocene proconsulids in a set of important morphological characters . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a second set of experiments , CD34+ cells were infected using this optimized protocol with pseudotyped retroviral particles carrying the gibbon ape leukemia virus ( GALV ) envelope protein . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These data reveal a common set of alleles shared among world populations , presumed to have arisen from a great ape ancestral allele prior to the divergence of the major geographical subdivisions of the human population , a subset of alleles specific to populations of African ancestry and a second set of alleles that arose by tandem duplication of the core repeat unit following the separation of African and non African populations . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The objective of this study was to define a set of clinically relevant outcome measures for future out of hospital trials in APE . ^^^ The use of this set of APE outcome measures may improve the design and comparability of future out of hospital trials . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Granzyme A ( GzmA ) triggers cell death with apoptotic features by targeting the endoplasmic reticulum associated SET complex , which contains the GzmA activated DNase NM 23 H1 , its inhibitor SET , and Ape 1 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In this analysis , 4 out of 5 members of the SET complex , SET , APE 1 , NM 23 and HMGB 2 , were highly expressed in invasive grade 3 tumors . ^^^ When combining all tumors , overexpression of Nm 23 ( p = 0 . 04 ) , Set ( p = 0 . 004 ) and Ape 1 ( p = 0 . 004 ) was associated with the clinical stage of the disease . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The findings of our study indicate that the prostate mainly drains through 3 sets of lymphatics : 1 ) the main and important set of lymphatics starts from the superolateral angle of the prostate and courses along the lateral pelvic wall to drain into the internal iliac lymph nodes , 2 ) some lymphatics drain into the lymph nodes in the presacral area and 3 ) in 45 % of the patients lymphatics from the apex of the prostate travel along the course of the internal pudendal vessels to the internal iliac lymph nodes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In a recent set of experiments in vivo , subthreshold stimulation ( STS ) was delivered to simulate electrotonic potentials to the His bundle region , and right ventricular apex , using multipolar electrode catheters . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Report of the observation of a female newborn presenting a complex malformative set : distal anorectal malformation without fistula ; bladder exstrophy without epispadias , with cutaneous bridge ; congenital urethrovaginal fistula ; malformative sexual ambiguity with bulky genital tubercle , whole urethra , urethral meatus on the apex of the genital tubercle , associated with a mid labial genital joint and a high genital orifice ; unilateral multicystic kidney ; vertebral abnormalities with supernumerary thoracolumbar vertebrae ; no karyotype abnormalities and no familial pathological history ; no endocrine abnormalities . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Tracer microspheres were injected into the left ventricular cavity at the apex for the measurement of regional flows , the chest was opened , another set of microspheres was injected , and the heart was frozen rapidly in situ with liquid nitrogen cooled Freon 22 . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Apex locators : the Set Locator ] . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Crosslinks were seen between stereocilia of the vestibular hair cells , similar to those previously demonstrated in the guinea pig , although an additional set of crosslinks was displayed : first , horizontal crosslinks were seen between adjacent stereocilia , occupying most of the length of the hair bundle ; secondly , a single upward pointing link ran from the apex of each shorter stereocilium into the shaft of the adjacent taller stereocilium ; thirdly , an extensive array of horizontal links were demonstrated between stereocilia close to their insertion into the cuticular plate . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The alternative set of apex triads represented transitions between truly planar segments . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A normative set of BI 3 CLT measures was calculated and compared with the corresponding measures of simultaneously recorded , single channel vertex left mastoid and vertex neck derivations of BI and of ABEP L + R and B . 3 CLT measures included : apex latency , amplitude and orientation , as well as planar segment duration and orientation . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
CONCLUSION : These data suggest that antibodies reactive with a larger set of V 3 apex peptides ( i . e . , cross reactive antibodies ) could play a role in the prevention of heterosexual transmission . . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
A normative set of BI 3 CLT measures was calculated and compared with the corresponding measures of simultaneously recorded , single channel vertex left mastoid and vertex neck derivations of BI and of AMLEP to binaural stimulation ( B ) . 3 CLT measures included : apex latency , amplitude and orientation , as well as planar segment duration , orientation , size and shape . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Acquisition and measurement of left ventricular ( LV ) volumes with a three dimensional data set of cine magnetic resonance ( MR ) images from apex to base is a time consuming process . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
These mechanisms were perforation of the aortic root and adjacent right atrium by sliding up of the transseptal set ( 2 ) , apical tears by straight tip balloon catheters driven distally during mitral valve dilatation ( 3 ) , apical perforations by guidewires introduced through catheters wedged in the apex ( 2 ) , tear of the posterior right atrial wall by dilatation of the track produced by very low septal punctures ( 2 ) , and right ventricular perforation by a pacing catheter ( 1 ) . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The FDACL is the flattest lens in the standardized CLEK trial lens set that vaults the apex of the cone . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
AIM : The aim of the present in vitro study was to combine directly the Canal Leader handpiece ( SET , Olching , Germany ) with the electronic apex locators ROOT ZX ( Morita , Kyoto , Japan ) and JUSTY ( Yoshida , Tokyo , Japan ) to find out whether the working length values thus obtained were identical to those resulting from the combination of the same electronic devices with hand files . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In the present study , the accuracy and operator dependency of four electronic canal length measuring devices ( Apex Finder AFA Model 7005 , Apex Finder , Neosono Ultima EZ and Apit 2 ) were compared under a set of specified conditions . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The N3O donor atom set of the tetradentate ligand defines the basal plane and the oxygen atom of the M = O core occupies the apex of the pyramid . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
This report describes recent progress on APEX , a free , open source , cross platform set of EXAFS data analysis software . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
With an automated computerized program , Holter recordings from 15 LQT 1 and 15 LQT 2 patients and 43 healthy subjects ( training set ) were reviewed to select the best criteria using QT duration and rate dependence as well as the difference between QT end and QT apex to separate the 3 groups . ^^^ In the training set , the RR interval ( 100 ms ) , a slope value for median QT / RR curves of 0 . 016 separated 25 of 30 ( 83 % ) and a minimal QT end QT apex value of 80 ms , separated 26 of 30 ( 87 % ) LQT 1 patients from LQT 2 patients . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
In short day conditions mimicking natural bud set , the expression of a chimeric PtABI 3 : : beta glucuronidase ( GUS ) gene occurred in those organs and cells of the apex that grow actively but will undergo arrest : the young embryonic leaves , the subapical meristem , and the procambial strands . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
METHODS : Twenty patients ( 18 men , 2 women ; mean age + / SD , 59 + / 12 y ) underwent electrocardiography gated cardiac PET and MRI to acquire a set of systolic and diastolic short axis images covering the heart from apex to base . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The aims of the current study were to ( 1 ) examine the respiratory and hemodynamic effects of setting P ( aw ) during HFOV according to the static P 5 curve , ( 2 ) assess the effect of increasing and decreasing P ( aw ) on slice volumes and aeration patterns at the lung apex and base using computed tomography , and ( 3 ) study the suitability of the P 5 curve to set P ( aw ) by comparing computed tomography findings during HFOV with those obtained during recording of the static P 5 curve at comparable pressures . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The identification of pharmacophore and three dimensional quantitative structure activity studies have been performed on a set of N ( 2 Benzoylphenyl ) L tyrosine for their PPARgamma agonist activity by using the logico structural based software Apex 3D which describes the properties and distribution of primary and secondary biophore sites in the three dimensional space . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The EMG activity on both sides of the spine was measured in a set of standardized postures using bipolar surface electrodes at the apex and two end vertebrae of the scoliotic curve . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The image set extended from 1 . 0 cm superior to the base to 1 . 0 cm inferior to the apex . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Our new technique involved obtaining a set of multi slice cine acquisition FIESTA images in a plane perpendicular to a line from the centre of the pulmonary valve to the apex of the RV . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
All major salivary glands were affected , as well as a set of previously undescribed buccal accessory salivary glands located on the apex of the masseter muscle , close to the oral angle . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Morphological and gene expression studies indicate the presence of a distinct set of cells that define the boundaries in the plant shoot apex . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
Although consensus sequences were noted among some of the proteins , such as the rod , hook and HAP 1 , no consensus extended to the entire set of axial proteins . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
We have analyzed CPO activity and HEM 13 mRNA levels in a set of isogenic strains carrying single or double deletions of the CYP 1 ( HAP 1 ) , ROX 1 , SSN 6 , or TUP 1 genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
The heme Hap 1 complex activates transcription of the ROX 1 gene that encodes a repressor of one set of hypoxic genes . ^^^
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA
Interacting proteins: P27695 and Q01105 Pubmed SVM Score :0.0
NA