Pubmed abstracts for Protein-Protein Interaction search result :

Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.61480733
Functional analysis using the reconstituted simian virus 40 in vitro DNA replication system demonstrated that Drosophila PCNA could substitute , albeit with reduced efficiency , for human PCNA in stimulating simian virus 40 DNA synthesis . 0.61480733^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.59748809
PCNA , in conjunction with activator 1 , acts as a processivity factor for eukaryotic DNA polymerase ( pol ) delta , and these three proteins constitute the pol delta holoenzyme . 0.59748809^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.82006559
Thus , while p 37 binds DNA at the primer end and has a specific affinity for pol epsilon , p 40 , which binds ATP , interacts with PCNA and pol delta . 0.82006559^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.78313097
A comparative study of DNA replication reactions on circular versus linear model substrates shows that PCNA can only interact productively with DNA polymerase delta if the substrate is linear . 0.78313097^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.79533651
Here we find that human PCNA , the processivity factor for eukaryotic polymerases , physically associates with human FEN 1 and stimulates its endonucleolytic activity at branched DNA structures and its exonucleolytic activity at nick and gap structures . 0.79533651^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.50011045
The PCNA labelling index was corresponded with both DNA index and MFC ( r = 0 . 61 , P < 0 . 001 ; r = 0 . 76 , P < 0 . 001 ) . 0.50011045^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.56778407
The crystal structure of the human DNA polymerase delta processivity factor PCNA ( proliferating cell nuclear antigen ) complexed with a 22 residue peptide derived from the C terminus of the cell cycle checkpoint protein p 21 ( WAF1 / CIP1 ) has been determined at 2 . 6 angstrom resolution . p 21 binds to PCNA in a 1 : 1 stoichiometry with an extensive array of interactions that include the formation of a beta sheet with the interdomain connector loop of PCNA . 0.56778407^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.6737948
By using radiolabeled murine cyclin D 3 cDNA as a probe , two cyclin D 3 genomic clones , MCD3P 117 and MCD3P 327 , were isolated from a murine genomic library constructed with murine liver DNA . 0.6737948^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :1.2624664
A PCNA binding peptide from p21Cip1 competes with Fen 1 peptides for binding to PCNA , disrupts the Fen 1 PCNA complex in replicating cell extracts , and concomitantly inhibits DNA synthesis . 1.2624664^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :1.0825752
The purified p40 . p37 . p36 complex , like the five subunit RFC , contained DNA dependent ATPase activity that was stimulated by PCNA , preferentially bound to primed DNA templates , interacted with PCNA , and was capable of unloading PCNA from singly nicked circular DNA . 1.0825752^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.98919092
In addition , the B . napus PCNA expressed as a fusion polypeptide with glutathione S transferase ( GST ) was shown to stimulate the activity and processivity of two delta like DNA polymerases from wheat in vitro . 0.98919092^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.56337467
The DNA repair endonuclease XPG binds to proliferating cell nuclear antigen ( PCNA ) and shares sequence elements with the PCNA binding regions of FEN 1 and cyclin dependent kinase inhibitor p 21 . 0.56337467^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.64939393
The importance of the interdomain connector loop and of the carboxy terminal domain of Saccharomyces cerevisiae proliferating cell nuclear antigen ( PCNA ) for functional interaction with DNA polymerases delta ( Poldelta ) and epsilon ( Pol epsilon ) was investigated by site directed mutagenesis . 0.64939393^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.70201808
Addition of p 21 did not inhibit RFC dependent PCNA loading ; rather , p 21 formed a stable complex with PCNA on the DNA . 0.70201808^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.87772278
As p 21 blocks association of DNA polymerases with PCNA but does not prevent loading of PCNA onto DNA , repair gap filling can occur rapidly as soon as p 21 dissociates from PCNA . 0.87772278^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.7946645
Recent studies have revealed a striking feature of PCNA in its ability to interact with multiple partners , involved , for example , in Okazaki fragment joining , DNA repair , DNA methylation and chromatin assembly . 0.7946645^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.89813341
However , PCNA remained associated with DNA for a longer period in p 21 / than in p21+ / + cells . 0.89813341^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.58164113
We found that cyclin A is a potent transcriptional repressor and cyclin E is a potent transcriptional activator when bound to DNA via a heterologous DNA binding domain . 0.58164113^^^ These results suggest that cyclin A and cyclin E intrinsically differ with respect to their ability to modulate transcription when tethered to DNA . . 0.56085388^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.64875657
Physical and functional interactions of human DNA polymerase eta with PCNA . 0.64875657^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.85614374
In Eukarya , PCNA is known to interact with more than a dozen different proteins , including a human major nuclear uracil DNA glycosylase ( hUNG 2 ) involved in immediate postreplicative repair . 0.85614374^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.77935521
We found that PCNA co immunoprecipitated with human p 50 , as well as calf thymus DNA polymerase delta heterodimer , but not with p 125 alone , suggesting that PCNA directly interacts with p 50 but not with p 125 . 0.77935521^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.66833831
Proliferating cell nuclear antigen ( PCNA ) plays an essential role in eukaryotic DNA replication , and numerous DNA replication proteins have been found to interact with PCNA through a conserved eight amino acid motif called the PIP box . 0.66833831^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.60569291
CONCLUSION : These results provide the first biochemical evidence that physical interactions between PCNA and Dnmt 1 facilitate the methylation of newly neplicated DNA , on which PCNA remains associated as a functional clamp . . 0.60569291^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.68131655
This normal cell line DNA demethylase activity associates with PCNA immune complex that is inhibited by CDKI proteins p 21 ( waf 1 ) / Gadd45alpha and Gadd45beta . 0.68131655^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.62218884
The amount of cellular PCNA associated with viral DNA replication sites was greater in cells infected with pcna defective AcMNPV mutants than in cells infected with wild type AcMNPV . 0.62218884^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.57084514
A single domain in human DNA polymerase iota mediates interaction with PCNA : implications for translesion DNA synthesis . 0.57084514^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.54875619
The N terminus of PCNA interacts directly with the DNA binding domain of RAR , and PCNA is recruited to a retinoid regulated promoter in intact cells . 0.54875619^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.59291399
The central hole of the PCNA homo trimeric ring encircles doublestranded DNA , so that DNA polymerases can operate for DNA synthesis with PCNA along a DNA template . 0.59291399^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.5879481
Numerous proteins that function in DNA metabolic pathways are known to interact with the proliferating cell nuclear antigen ( PCNA ) . 0.5879481^^^ The important function of PCNA in stimulating various cellular activities requires its topological linkage with DNA . 0.54745595^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.52654456
Conversely , overexpressed Rad 18 induces PCNA ubiquitination and association between PCNA and Polkappa in a DNA damage independent manner . 0.52654456^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :1.0128352
Moreover , PCNA binds to both APE 1 and MPG at different sites , and loading PCNA onto a nicked , closed circular substrate with a unique Hx residue enhances MPG catalyzed excision . 1.0128352^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Interaction of human AP endonuclease 1 with flap endonuclease 1 and proliferating cell nuclear antigen involved in long patch base excision repair . ^^^ We find that human AP endonuclease 1 ( APE 1 ) physically interacts with flap endonuclease 1 ( FEN 1 ) and with proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The monoclonal antibodies 19A2 and PC 10 detect the proliferating cell nuclear antigen ( PCNA / Cyclin ) , an auxiliary protein to DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It is important to examine the proliferative activity of cells in the laryngeal carcinoma and dysplasia for the decision of the clinical treatment and the presumption of the prognosis . 1 studied here the proliferative activity with three indications , such as the measurement of nuclear DNA contents by flow cytometry , immunohistochemistry of Proliferating Cell Nuclear Antigen ( PCNA ) and intake of bromodeoxyuridine ( BrdU ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A cyclin A protein kinase complex possesses sequence specific DNA binding activity : p33cdk2 is a component of the E2F cyclin A complex . ^^^ These results thus define a cyclin A cdk 2 kinase complex that possesses sequence specific DNA binding activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The synthesis of small RNAs was unaffected by the addition of activator 1 , proliferating cell nuclear antigen , and DNA polymerase delta , proteins that can support extensive leading strand synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have now found that DNA synthesis and entry into mitosis are inhibited in human cells microinjected with anti cyclin A antibodies at distinct times . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The involvement of active DNA synthesis in camptothecin induced G 2 arrest : altered regulation of p34cdc2 / cyclin B . ^^^ Furthermore , our results suggest that the interaction of the replication fork with DNA damage may ultimately trigger altered regulation of p34cdc2 / cyclin B , leading to cell cycle arrest at the G 2 phase . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using a strand displacement assay we have followed DNA helicase activities during the simultaneous isolation of several enzymes from calf thymus such as DNA polymerases alpha , delta , and epsilon , proliferating cell nuclear antigen , and replication factor A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Activator 1 ( A 1 ; also called replication factor C ) , in conjunction with proliferating cell nuclear antigen ( PCNA ) , is essential for the elongation of primed DNA templates by DNA polymerases delta and epsilon . ^^^ In addition , antibodies raised against the 40 kDa subunit abolished the A 1 and PCNA dependent synthesis of DNA catalyzed by polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Tyrosine phosphorylation of p34cdc2 when complexed to cyclin B provides an inhibitory check on the activation of the M phase inducing protein kinase , allowing the coupling of processes such as DNA replication to the onset of metaphase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Thus , one or more members of the cyclin cdc 2 kinase family may be required for the initiation and maintenance of S phase , in part due to their ability to phosphorylate and activate a cellular DNA replication factor , RPA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen was induced in the differentiated suprabasal cells in the productive cyst growth , which also exhibited high copy viral DNA and abundant E 6 E7 RNAs . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Modification of cyclin A expression by hepatitis B virus DNA integration in a hepatocellular carcinoma . ^^^ We have previously reported the identification of a hepatitis B virus ( HBV ) DNA integration in an intron of the cyclin A gene in an early hepatocellular carcinoma ( HCC ) and the isolation of human cyclin A cDNA . ^^^ Thus , HBV DNA integration in the cyclin A gene resulted in a strong expression of hybrid HBV cyclin A transcripts encoding a stabilized cyclin A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A functional role for the binding of the cyclin A p33cdk2 complex to cellular gene promoters has yet to be demonstrated ; however , HCMV infection causes the induction of both cellular DNA replication and transcription of growth related genes containing E2F sites in their promoters . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Therefore , SIT 4 is required for at least two late G 1 or G1 / S functions : the normal accumulation of G 1 cyclin RNAs ( which is required for DNA synthesis ) and some additional function that is required for bud emergence or cell cycle progression through late G 1 or G1 / S . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our results can be summarized as follows : ( 1 ) the activation of the IGF 1 receptor by its ligand , IGF 1 , is an obligatory step in the proliferation of fibroblasts and hemopoietic cells ; and ( 2 ) the expression of DNA synthesis genes , such as PCNA , DNA polymerase alpha , and cdc 2 , is dependent on the expression of previous genes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
One such protein , replication factor C ( RFC ) , functions with the proliferating cell nuclear antigen ( PCNA ) , replication protein A ( RPA ) , and DNA polymerase delta to synthesize the leading strand at a replication fork . ^^^ RFC from S . cerevisiae was purified by its ability to stimulate yeast DNA polymerase delta on a primed single stranded DNA template in the presence of yeast PCNA and RPA . ^^^ By analogy with the phage T 4 and SV 40 DNA replication in vitro systems , the yeast RFC , PCNA , RPA , and DNA polymerase delta activities function together as a leading strand DNA replication complex . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In chondrocytes synchronized in S phase by a thymidine block , we investigated here the time course incorporation of [ 3H ] thymidine into DNA , the cell cycle traverse by flow cytofluorometric study of DNA content , the expression of PCNA ( Proliferating Cell Nuclear Antigen ) , and cAMP levels . ^^^ The data demonstrate that TGF beta provoked a decrease of cAMP content ( 0 . 5 1 h ) followed by an enhancement of the DNA synthesis rate ( 4 h ) which was detectable through cytofluorometric analysis and [ 3H ] thymidine labeling and correlated with the PCNA expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Accumulated evidence indicates that proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein of DNA polymerase delta and forms tight association with DNA replication sites during DNA replication or DNA repair synthesis . ^^^ These observations indicate a close correlation of PCNA complex formation and unscheduled DNA synthesis ( UDS ) . ^^^ Thus , it was concluded that PCNA complex formation was commonly induced in at least three conditions to produce UDS in spite of different types of DNA damages and DNA repair mechanisms . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) plays a key role in the control of eukaryotic DNA replication . ^^^ The presence of the second putative PCNA may provide new insight into studies on the mechanism of DNA replication in eukaryotes . . ^^^ Identification of carrot cDNA clones encoding a second putative proliferating cell nuclear antigen , DNA polymerase delta auxiliary protein . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferative activity of bone marrow leukemia cells was determined by DNA flow cytometric ( FCM ) analysis and labeling index ( LI ) of Ki 67 monoclonal antibodies and proliferating cell nuclear antigen ( PCNA ) autoantibodies in 73 children with acute leukemia . ^^^ Comparison of Ki 67 and proliferating cell nuclear antigen immunocytochemical and DNA flow cytometric analysis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA fragments of similar size ( approximately 35 nucleotides ) were previously observed in SV 40 replication reactions carried out with crude extracts of HeLa cells in the presence of antibodies directed against PCNA ( Bullock , P . ^^^ We examined whether PCNA , the T 4 phage encoded gene product 45 ( T 4 gp45 ) , and the Escherichia coli beta subunit of DNA polymerase 3 ( dnaN gene product ) supported SV 40 DNA replication and the elongation of single stranded DNA binding protein coated singly primed DNA in reactions catalyzed by pol delta , T 4 DNA pol , and E . coli DNA pol III * , respectively . ^^^ In the presence of T 4 gp44 / 62 and T 4 gp32 ( but not human single stranded DNA binding protein isolated from HeLa cells ) , T 4 DNA pol was weakly activated by PCNA and the beta subunit in lieu of T 4 gp45 in the elongation of singly primed phi X 174 DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) , highly conserved among eukaryotes , is an auxiliary factor for DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) is required for the DNA synthesis that converts the nicked intermediates to completed repair events . ^^^ This need for PCNA implies that repair synthesis is carried out by DNA polymerase delta or epsilon . ^^^ The ability to visualize repair intermediates in the absence of PCNA facilitates dissection of the multiprotein reaction that leads to incision of damaged DNA in a major pathway of cellular defense against mutagens . . ^^^ Proliferating cell nuclear antigen is required for DNA excision repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression of proliferating cell nuclear antigen ( PCNA ) , an auxiliary factor for the DNA polymerase delta , is closely related to cell proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A potential structural relationship is suggested between the beta subunit and proliferating cell nuclear antigen ( PCNA , the eukaryotic polymerase delta [ and epsilon ] processivity factor ) , and the gene 45 protein of the bacteriophage T 4 DNA polymerase . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA is a nuclear antigen which is essential for DNA synthesis , two commercially available antibodies to PCNA work in paraffin embedded tissue , but may have different staining characteristics under different conditions of fixation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The concentration of PCNA , a cofactor for delta DNA dependent DNA polymerase , is indicative of the proliferative state of the cell . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferation activity was determined by DNA flow cytometry and by immunohistochemical detection of proliferative cell nuclear antigen ( PCNA ) using a monoclonal PC 10 antibody . ^^^ High level p 53 accumulation was associated with high histologic grade ( P less than . 001 ) , DNA aneuploidy ( P less than . 05 ) , and high cell proliferation rate as defined by flow cytometric S phase analysis ( P less than . 01 ) or PCNA expression ( P less than . 01 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We show here that stimulation of DNA synthesis in bone marrow derived macrophages ( BMM ) by macrophage CSF 1 is preceded by G 1 expression of three genes which encode proteins associated with the DNA synthesis machinery the M 1 and M 2 subunits of ribonucleotide reductase and proliferating cell nuclear Ag ( PCNA ) . ^^^ Decreased expression of M 1 , M 2 , and PCNA was not merely a consequence of DNA synthesis inhibition because the S phase inhibitor , hydroxyurea , did not suppress CSF 1 induced gene expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The elongation of primed DNA templates by DNA polymerase delta and DNA polymerase epsilon requires the action of two accessory proteins , proliferating cell nuclear antigen and activator 1 ( A 1 , also called replication factor C ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Ki 67 monoclonal antibody reactive antigen and proliferating cell nuclear antigen ( PCNA ) were measured by the simultaneous flow cytometric analysis of DNA and nuclear antigens . ^^^ Accordingly , most of the cells in the proliferative compartments ( greater than 2C DNA ) showed a high expression of PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , also known as cyclin , is synthesized in proliferative cells and recently was identified as DNA polymerase delta auxiliary protein . ^^^ Proliferating cell nuclear antigen ( PCNA ) , also known as cyclin , is synthesized in proliferative cells and recently was identified as DNA polymerase delta auxiliary protein . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have analyzed the localization of four nuclear antigens in different growth conditions : two replicative proteins , DNA polymerase alpha and proliferating cell nuclear antigen ( PCNA ) , and two oncogenic regulatory proteins , c Myc and c Fos . ^^^ DNA polymerase alpha is the first protein to leave the nucleus , with the PCNA protein , c Fos , and c Myc leaving the nucleus later . ^^^ We also noticed that in sparse cell cultures , 10 % of the cells exhibit a perinuclear staining for the DNA polymerase alpha , PCNA , and c Myc proteins but not for c Fos . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Amino acid sequence analysis , amino acid composition and immunoblotting with PCNA antibodies revealed that the 37 kDa protein is the proliferating cell nuclear antigen ( PCNA ) known to stimulate DNA Polymerases delta and epsilon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using an antibody to PCNA and a standard immunohistochemical system , the authors examined normal epidermis and cutaneous neoplasias for expression of PCNA , a protein associated with DNA polymerase delta and DNA replication . ^^^ Because SCCI can be associated with the presence of human papillomavirus ( HPV ) DNA , the authors evaluated PCNA expression in verruca vulgaris and found a pattern similar to that in SCCI . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The fraction of PCNA / cyclin positive nuclei was related to T category ( P = 0 . 008 ) , papillary status , WHO grade , DNA ploidy , S phase fraction , M / V index ( volume corrected mitotic index ) and AgNORs ( silver stained nucleolar organiser regions ) ( for all P less than 0 . 001 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We examined the relationship between the formation of proliferating cell nuclear antigen ( PCNA ) complex with DNA and nucleotide excision repair in human fibroblasts following ultraviolet light ( uv ) irradiation . ^^^ PCNA complex formation was detected by the immunofluorescence method after methanol fixation and nucleotide excision repair activity was detected as the unscheduled DNA synthesis ( UDS ) by autoradiography labeled with [ 3H ] thymidine . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In order to evaluate more objective laboratory methods that may help practicing pathologists to discern malignancy in human adrenocortical neoplasms , we have examined cellular DNA content by flow cytometry and immunohistochemical distribution of c myc , vimentin , proliferating cell nuclear antigen ( PCNA ) , and epidermal growth factor receptor ( EGFR ) in 15 cases of human adrenocortical neoplasms ( nine carcinomas and six adenomas ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Uneven PCNA staining of the irregular nuclear segments of the bizarre giant cells may result in abnormal DNA synthesis , possibly contributing to the marked diversity of nuclear morphology in MFH . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The immunocytological distribution of the proliferating cell nuclear antigen ( PCNA ) , a protein involved in DNA replication , has been examined during the early development of Xenopus laevis . ^^^ PCNA associates with typical karyomeric structures , suggesting that DNA replication starts before the nuclear compartment is entirely formed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To compare fresh lymphoma deoxyribonucleic acid ( DNA ) analysis with PCNA activity on fixed , paraffin embedded sections , prospective flow cytometric studies of cell cycle analysis were performed on lymph nodes removed from 10 patients for diagnosis . ^^^ Our study is unique in that it compared fresh lymphoma DNA analysis data with paraffin PCNA data . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The activity of nuclear DNA polymerases alpha , beta and delta / epsilon , uracil DNA glycosylase , thymidine kinase and the presence of Proliferating Cell Nuclear Antigen ( PCNA ) have been examined in developing rat glial cells , in rat and human glioma , in human neuroblastoma and in differentiated neuroblastoma cell lines in vitro . ^^^ DNA synthesis enzymes and proliferating cell nuclear antigen in normal and neoplastic nerve cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , an essential component for DNA replication in eukaryotes , is a highly conserved nonhistone nuclear protein of 261 amino acids . ^^^ Proliferating cell nuclear antigen ( PCNA ) , an essential component for DNA replication in eukaryotes , is a highly conserved nonhistone nuclear protein of 261 amino acids . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We examined the role of the factor deficient in xeroderma pigmentosum group A ( XP A ) cells in the formation of proliferating cell nuclear antigen ( PCNA ) complex with DNA in the DNA repair process in human fibroblasts following cis diamminedichloroplatinum ( CDDP ) treatment . ^^^ These results suggest that the PCNA complex formation may play a role in the DNA repair process after the step where the factor deficient in XP A cells is involved following CDDP treatment as well as following UV irradiation . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
By using a complementation assay that enabled DNA polymerase delta and DNA polymerase epsilon to replicate a singly DNA primed M 13 DNA in the presence of proliferating cell nuclear antigen ( PCNA ) and Escherichia coli single stranded DNA binding protein ( SSB ) , we have purified from calf thymus in a five step procedure a multipolypeptide complex with molecular masses of polypeptides of 155 , 70 , 60 , 58 , 39 ( doublet ) , 38 ( doublet ) and 36 kDa . ^^^ This conclusion is based on biochemical and physicochemical data and the finding that it contains a DNA stimulated ATPase which is under certain conditions stimulated by PCNA . ^^^ Together RF C , PCNA and ATP convert DNA polymerases delta and epsilon to holoenzyme forms , which were able to replicate efficiently SSB covered singly DNA primed M 13 DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunostaining of cell cycle related antigens , especially Ki 67 , DNA polymerase alpha , and proliferating cell nuclear antigen , has become an important method to assess the proliferative activity of tumors . ^^^ For these three antigens , proliferating cell nuclear antigen demonstrated a much higher percentage of positive cells than either Ki 67 or DNA polymerase alpha , in both the smears and the tissue sections . ^^^ In summary , Ki 67 , DNA polymerase alpha , and proliferating cell nuclear antigen can be immunolocalized successfully in cytology smears and may become another parameter to assess the proliferative activity of tumors in the field of diagnostic pathology . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA scores were significantly higher ( P less than 0 . 005 ) in DNA aneuploid ( n = 22 ) than in DNA diploid ( n = 18 ) tumors and correlated significantly with the SPF of DNA aneuploid tumors ( r = 0 . 825 , P less than 0 . 0001 ) , but not with diploid tumors ( r = 0 . 002 , P = 0 . 9 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The authors developed radioimmunoassay ( RIA ) for proliferating cell nuclear antigen ( PCNA / cyclin ) , which a protein synthesizes in phase with DNA , as a marker for cell replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Comparative studies of ploidy and proliferative activity of spindle cells in sections of 20 ( skin , 17 ; lymph node , 3 ) biopsy specimens from African patients , 10 with endemic Kaposi ' s sarcoma ( EKS ) and 10 with AIDS associated Kaposi ' s sarcoma ( AKS ) were performed by histopathology , feulgen based DNA measurement and proliferating cell nuclear antigen ( PCNA ) / cyclin immunohistochemistry , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The percent PCNA positive tumor cells ( 12 . 5 % mean , range 1 28 % ) was significantly greater in aneuploid tumors ( 14 . 2 % mean , N = 35 ) compared to diploid range tumors ( 10 . 7 % mean , N = 35 ) ( p less than 0 . 05 ) , and was correlated with SPF derived from ungated DNA histograms ( 12 . 5 % mean + / 5 . 5 % , r = 0 . 45 , p less than 0 . 001 ) . ^^^ Marginally stronger statistical correlations were observed between the PCNA index and SPF values calculated from cytokeratin gated ( 15 . 8 % mean , r = 0 . 53 , p less than 0 . 001 ) DNA histograms or from SPF values obtained following linear baseline debris subtraction ( mean = 8 . 1 % , r = 0 . 48 , p less than 0 . 001 ) . ^^^ We conclude : 1 ) PCNA index is comparable to FCM SPF and correlates with factors of known prognostic importance in carcinoma of the breast ; 2 ) baseline debris and contaminating events derived from non epithelial cells both represent significant artifacts in proliferative fraction estimates derived from FCM DNA histograms ; and 3 ) multiparametric analysis may represent one means of improving the specificity and clinical value of FCM SPF determinations . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The positive PCNA staining of cardiac myocytes probably reflects DNA synthesis that occurs with the shift toward polyploidy in hypertrophy . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A study of DNA ploidy pattern , proliferation index and PCNA in duodenal carcinoma ] . 12 cases of duodenal carcinoma were studied for nuclear DNA ploidy patterns , the proliferation index ( PI ) , proliferating cell nuclear antigen ( PCNA ) positive score ( 1 = 0 25 % , 2 = 26 50 % , 3 = 51 75 % , 4 = 76 100 % ) and PCNA positive rate . ^^^ DNA aneuploidy was observed in 9 cases ( 75 % ) and PCNA staining was positive in 11 cases ( 91 . 6 % ) . ^^^ DNA ploidy patterns , PI , PCNA positive scores and positive rates were not related to each other . ^^^ No relationship DNA ploidy patterns for PCNA positive scores and PCNA positive rates could be found . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Monoclonal anti proliferating cell nuclear antigen ( PCNA PC 10 ) , which is directed against a 36 kDa auxiliary protein for DNA polymerase delta specific for the S phase of cell cycle , was used to measure tumour cell proliferation in 4 lactating breasts and 98 benign and malignant breast tumours . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The present study revealed that astrocytes are able to reactively express PCNA , an intrinsic marker of DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These findings link a human putative G 1 cyclin that is associated with oncogenesis with a well characterized DNA replication and repair factor . . ^^^ D type cyclins associate with multiple protein kinases and the DNA replication and repair factor PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Intranuclear co location of newly replicated DNA and PCNA by simultaneous immunofluorescent labelling and confocal microscopy in MCF 7 cells . ^^^ The intranuclear distribution of newly replicated DNA and of the proliferating cell nuclear antigen ( PCNA ) was mapped by confocal laser scanning microscopy after simultaneous immunofluorescent labelling of incorporated bromodeoxyuridine ( BrdUrd ) and PCNA . ^^^ A mild hydrolysis with HCl followed by an enzymic digestion of DNA was used to produce single stranded DNA required for BrdUrd immunorevelation , since this procedure preserves PCNA antigenicity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The inhibition of DNA synthesis by antisense oligomers to the IGF 1 receptor RNA is accompanied by an inhibition of the expression of the mRNA for a DNA synthesis gene , proliferating cell nuclear antigen ( PCNA ) , the co factor of DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA induced DNA synthesis past cis syn and trans syn 1 thymine dimers by calf thymus DNA polymerase delta in vitro . ^^^ Calf thymus proliferating cell nuclear antigen ( PCNA ) promoted DNA synthesis past cis syn and trans syn 1 cyclobutane thymine dimers by calf thymus DNA polymerase delta ( Pol delta ) in vitro . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Under these conditions , the RNA levels of late growth regulated genes ( such as DNA polymerase alpha , PCNA , thymidine kinase , and core histones ) are markedly decreased or even undetectable , while early growth regulated genes ( for instance , c myc ) are normally expressed , and certain promoters are actually super induced . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein to DNA polymerase delta and is an absolute requirement for cellular proliferation . ^^^ Proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein to DNA polymerase delta and is an absolute requirement for cellular proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferative activity determined by DNA flow cytometry and proliferating cell nuclear antigen ( PCNA ) immunohistochemistry as a prognostic factor in prostatic carcinoma . ^^^ Proliferative activity was measured in 165 paraffin embedded prostatic carcinomas using DNA flow cytometric analysis of the S phase ( SPF ) and G2 / M phase fractions and CAS 200 image analysis of the proliferating cell nuclear antigen ( PCNA ) expression defined immunohistochemically by PC 10 and 19A2 monoclonal antibodies . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Two types of DNA polymerase , DNA polymerase delta and DNA polymerase alpha , were distinguished by : 1 . copurification of DNA primase or 3 ' 5 ' exonuclease activities ; 2 . immunoblot analysis with alpha specific polyclonal antisera ; 3 . sensitivity to aphidicolin and BuPdGTP ; and 4 . processivity measurements with and without Proliferating Cell Nuclear Antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA dependent DNA polymerase delta from rabbit bone marrow . ^^^ Proliferating cell nuclear antigen ( PCNA ) and PCNA dependent DNA polymerase delta were partially purified and characterized from rabbit bone marrow . ^^^ Similar to calf thymus PCNA dependent DNA polymerase delta , a 125 123 kDa doublet and 48 kDa polypeptides correlate with DNA polymerase activity . ^^^ Western blotting of rabbit DNA polymerase delta with polyclonal antibody to calf thymus PCNA dependent DNA polymerase delta gives the same results as calf thymus delta ; the 125 123 kDa doublet is recognized . ^^^ PCNA dependent DNA polymerase delta is resistant to inhibition by dideoxynucleotides and is relatively insensitive to inhibition by N 2 [ p ( n butyl ) phenyl ] dGTP . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Pcn 1 has a region near the C terminus of particularly high homology to higher eukaryotic PCNA proteins . pcn1+ is essential for viability and delta pcn 1 cells undergo aberrant DNA replication before cell cycle arrest . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Results generated by the immunohistochemical staining with PC 10 , a new monoclonal antibody recognizing PCNA ( a nuclear protein associated with cell proliferation ) in formalin fixed and paraffin embedded tissue were compared with those of Ki 67 labeling and DNA flow cytometry in 47 consecutive non small cell lung cancer ( NSCLC ) . ^^^ Its frequency ranged from 0 to 80 % ( 37 . 7 + / 23 . 6 ) and larger sized , early staged and DNA aneuploid tumors expressed a significant higher number of PCNA reactive cells . ^^^ Growth fraction in non small cell lung cancer estimated by proliferating cell nuclear antigen and comparison with Ki 67 labeling and DNA flow cytometry data . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
No significant association was observed between PCNA and node status , grading , DNA ploidy , progesterone receptor or menopausal status . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication of singly DNA primed M 13 DNA by DNA polymerase ( pol ) delta completely relies on the simultaneous addition of proliferating cell nuclear antigen ( PCNA ) , replication factor C ( RF C ) and replication protein A ( RP A ) ( or E . coli single strand DNA binding protein , SSB ) . ^^^ However , DNA synthesis by pol epsilon was stimulated up to 10 fold upon addition of the three auxiliary proteins PCNA , RF C and SSB . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The decline in the expression of the PCNA gene would contribute to the inability of older cells to initiate replicative DNA synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The bivariate DNA / PCNA , DNA / p120 , and DNA / p145 histograms for mitotic cells indicated that both p 120 and p 145 expression were elevated ( percent positive and MCF ) while PCNA levels were near controls ( MCF ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear Ag ( PCNA ) is an intranuclear protein involved in DNA replication directed by DNA polymerase delta and is the target Ag of autoantibodies in some patients with SLE . ^^^ It has been shown that the human autoantibody defined epitope is related to the function of PCNA because autoantibodies are able to inhibit DNA polymerase delta directed DNA replication , whereas experimentally induced antibodies are not . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results highlight the differential expression of various cell cycle associated genes and demonstrates that non coordinate regulation of CYL 1 cyclin and DNA synthesis gene expression can occur . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A 13 kb wild type genomic DNA containing the Cyclin A transcription units rescued the mutant phenotype when introduced into the mutant fly . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , cells synchronized in late G 1 by exposure to the drug mimosine contain active cyclin A / p34 CDC 2 kinase , indicating that p 34 CDC2 activation can occur before DNA synthesis begins . ^^^ Thus , the cyclin A / CDC2 complex , which previously has been shown to be sufficient to start SV 40 DNA synthesis in vitro , assembles and is activated at the start of S phase in vivo . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Through Southern blot analyses of DNA from backcross and cogenic mice , recombinant inbred strains , and somatic cell hybrids , the genetic loci that produce the cyclin B 1 related sequences ( designated loci Cycb 1 rs1 to Cycb 1 rs9 ) were mapped on mouse chromosomes 5 , 1 , 17 , 4 , 14 , 13 , 7 , 10 , and 8 , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin ( CLN 1 and CLN 2 ) and HO genes are another subset of genes that are expressed with the same timing as the DNA replication genes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The disruption of this E2F Rb interaction , as well as a complex involving E2F in association with the cell cycle regulated cyclin A cdk 2 kinase complex , may be a common mechanism of action for the oncoproteins encoded by the DNA tumor viruses . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Liver regeneration was assessed by [ 3H ] thymidine incorporation into hepatic DNA and by immunohistochemical evidence of proliferating cell nuclear antigen ( PCNA ) expression . ^^^ Anti TNF pretreatment also inhibited [ 3H ] thymidine incorporation into DNA , as well as expression of PCNA by both hepatocytes and liver nonparenchymal cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin / PCNA ( proliferating cell nuclear antigen ) is a nuclear protein strongly associated with DNA replication sites . ^^^ Cyclin / PCNA ( proliferating cell nuclear antigen ) is a nuclear protein strongly associated with DNA replication sites . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
By isolating genomic DNA clones that encompass the mouse Cyl 1 ( cyclin D 1 ) locus , we have identified a putative CpG island close to the 5 ' end of the gene . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have evaluated a recurrence of Lhermitte Duclos disease by immunohistochemistry for Purkinje cell markers and proliferative activity ( proliferating cell nuclear antigen ) , by electron microscopy and for DNA ploidy ( image analysis ) . ^^^ Staining with monoclonal antibodies to proliferating cell nuclear antigen and measuring cell DNA index and ploidy with a cell image analyzer revealed no proliferative activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunohistochemical identification of cells in S phase through uptake of bromodeoxyuridine is the method of choice for detailed compartmental mapping of proliferation , while immunohistochemical detection of proliferation associated antigens ( Ki 67 , PCNA , DNA polymerase alpha ) provides information in advanced tumor cases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this group , mutants lacking residues between 124 and 138 bound p 107 and cyclin A at much reduced levels and induced cells to overreplicate their DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It contains p 107 , a nuclear `` pocket ' ' protein with similarities in structure and protein binding properties to RB , and cyclin A , a cyclin believed to play a role in facilitating DNA replication . ^^^ The presence of cyclin A and a pocket protein , a possible cell growth regulator , in the same S phase associated complex suggests a link between the function of E2F and the regulation of the DNA replication process . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In cell free extracts derived from Xenopus eggs which oscillate between S phase and mitosis , incompletely replicated DNA blocks the activation of p34cdc2 cyclin by maintaining p34cdc2 in a tyrosine phosphorylated form . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To investigate the potential implication of cyclin A accumulation at S phase , we microinjected anti sense DNA constructs for cyclin A , resulting in effective inhibition of S phase entry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferative response was assessed by determining against time the rate of DNA synthesis by [ 3H ] thymidine incorporation in DNA , the labeling index , the expression of cyclin A , the amount of DNA , and the number of cells . ^^^ The maximum expression of cyclin A coincided with the maximum of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using a counterimmunoelectrophoresis method , the dogs ' sera were tested for antibodies against the nuclear antigens single stranded DNA , Sm , Ro , La , ribonucleoprotein , Scl , and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Role for cyclin A in the dependence of mitosis on completion of DNA replication . ^^^ Although cyclin A ablated extracts could initiate DNA synthesis during interphase , S phase was not completed before entry into mitosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We therefore compared the ability of MAb to three nucleus associated proliferation markers ( MAb 19A2 to PCNA / cyclin ; Ki 67 to an undefined proliferation related marker ; BU 1 to 5 ' bromodeoxyuridine ( BrdU ) incorporated into DNA ) to identify the proliferating cell fraction of various cells in vitro . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Activator 1 ( A 1 ) is a multiprotein complex which is essential for proliferating cell nuclear antigen ( PCNA ) dependent DNA polymerase delta ( pol delta ) activity and efficient in vitro DNA synthesis in the SV 40 dipolymerase replication system . ^^^ A 1 stimulated pol delta activity in singly primed phi X 174 DNA or ( dA ) 4500 . oligo ( dT ) 12 18 in reactions containing PCNA , single stranded DNA binding protein ( SSB ) , and ATP . ^^^ The DNA dependent hydrolysis of ATP can be stimulated by PCNA and further activated by PCNA plus the human single stranded DNA binding protein . ^^^ Data are also presented which indicate that A 1 , in conjunction with PCNA , functions as a primer recognition factor for pol delta , increasing its ability to utilize low levels of primer ends , but it does not increase the size of the DNA products . ^^^ A 1 also markedly reduced the amount of PCNA required for pol delta activity on a multiply primed DNA suggesting that PCNA interacts with A 1 at the primer end . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA replication from the SV 40 origin can be reconstituted in vitro using purified SV 40 large T antigen , cellular topoisomerases 1 and 2 , replication factor A ( RF A ) , proliferating cell nuclear antigen ( PCNA ) , replication factor C ( RF C ) , and a phosphocellulose fraction ( IIA ) made from human cell extracts ( S 100 ) . ^^^ This factor is required for complete reconstitution of SV 40 DNA replication and co purifies with a PCNA stimulated DNA polymerase activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Another replication factor , proliferating cell nuclear antigen ( PCNA ) binds to RF C and the primer template DNA forming a primer recognition complex and extends the protected region on the duplex DNA . ^^^ PCNA complex has significant single stranded DNA binding activity in addition to binding to a primer template junction . ^^^ In the absence of RF C , DNA polymerase delta ( pol delta ) and PCNA form a complex at the primer template junction , protecting exactly the same site as the primer recognition complex . ^^^ These results suggest that the sequential binding of RF C , PCNA , and pol delta to a primer template junction might directly account for the initiation of leading strand DNA synthesis at a replication origin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factors A and C ( RF A and RF C ) and the proliferating cell nuclear antigen ( PCNA ) differentially augment the activities of DNA polymerases alpha and delta . ^^^ Reconstitution of DNA replication with purified factors and a plasmid containing the SV 40 origin sequences directly demonstrated DNA polymerase alpha dependent synthesis of lagging strands and DNA polymerase delta / PCNA / RF C dependent synthesis of leading strands . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The inhibition of leading strand synthesis by PARP can be effectively reversed by supplementing the monopolymerase system with the multimeric activator 1 protein ( A 1 ) , the proliferating cell nuclear antigen ( PCNA ) and PCNA dependent DNA polymerase delta ( the dipolymerase system ) . ^^^ In contrast , PARP only partly competed with the elongation of primed DNA templates by the pol delta elongation system which required SSB , A 1 , and PCNA . ^^^ These results suggest that the binding of PARP at the ends of nascent DNA chains can be displaced by the binding of A 1 and PCNA to primer ends . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In contrast , the mRNAs for late growth regulated genes [ such as histones , proliferating cell nuclear antigen ( PCNA ) , and DNA polymerase alpha ] are not detectable at the restrictive temperature , although they are normally induced by serum at the permissive temperature . ^^^ Despite the absence of their mRNAs at the restrictive temperature , transcription rates for DNA polymerase alpha , PCNA , and histone H 3 are the same in serum deprived cells and in cells that are serum stimulated at either the permissive or the restrictive temperature . ^^^ Transcription rates in T neo cells are increased for histone H 3 ( in comparison to tk ts 13 cells ) but not for PCNA and DNA polymerase alpha . ^^^ The conclusion is that the presence of the SV 40 T antigen in tk ts 13 cells promotes the appearance of mature mRNAs for DNA polymerase alpha and PCNA . ^^^ Effect of the SV 40 T antigen on the posttranscriptional regulation of the proliferating cell nuclear antigen and DNA polymerase alpha genes . tk ts 13 cells are G 1 specific temperature sensitive mutants of the cell cycle that arrest in G 1 at the restrictive temperature . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
USA 86 , 3189 3193 ] , we demonstrated the presence of a rice genomic DNA fragment which hybridized with a rat proliferating cell nuclear antigen ( PCNA ) cDNA probe , and proposed that plants possess the homolog of the PCNA gene which plays an essential role in DNA replication in mammals . ^^^ The structural similarity between PCNA from plants and animals , despite the distant evolutionary relationship , indicates a strong selection pressure for conservation of this structure and suggests the presence of conserved DNA replication mechanisms throughout the eukaryotes . . ^^^ Highly conserved structure of proliferating cell nuclear antigen ( DNA polymerase delta auxiliary protein ) gene in plants . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We present evidence that antibodies which neutralize proliferating cell nuclear antigen ( PCNA ) inhibit but do not abolish pulse labeling of nascent DNA . ^^^ The lengths of DNA products formed after a 5 s pulse in the absence and presence of anti PCNA serum averaged 150 and 34 nucleotides , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study the topologic distribution of proliferating cell nuclear antigen ( PCNA ) , an auxiliary protein of DNA polymerase delta , as recognized by human autoantiserum ( AK ) and two recently developed MAbs ( 19A2 and 19F4 ) , was evaluated . ^^^ Treatment of MCF 7 cells with 10 ( 6 ) mol / l methotrexate resulted in a rapid accumulation of cells with an early S phase DNA content ; PCNA replication patterns showing a frequency distribution reflecting this DNA content were observed up to 48 hours after treatment . ^^^ It is concluded that , providing nuclear non S phase PCNA staining is faint relative to staining of replicon clusters , anti PCNA antibodies may be excellent markers to detect in situ cells with S phase DNA contents . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The product of the proliferating cell nuclear antigen ( PCNA ) gene is the co factor of DNA polymerase delta , which is required for cellular and viral DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The following differences of DNA polymerase delta to DNA polymerase epsilon were evident : ( 1 ) the independence of DNA polymerase epsilon to proliferating cell nuclear antigen for processivity , ( 2 ) utilization of deoxy and ribonucleotide primers , ( 3 ) template requirements in the absence of proliferating cell nuclear antigen , ( 4 ) mode of elution from hydroxylapatite , and ( 5 ) sensitivity to d2TTP and to dimethyl sulfoxide . ^^^ DNA polymerase delta is 100 150 fold dependent on proliferating cell nuclear antigen for activity and processivity on poly ( dA ) / oligo ( dT 12 18 ) at base ratios between 1 : 1 to 100 : 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA / cyclin ) is described as a nuclear protein and plays a key role in the initiation of cellular DNA synthesis and regulation of cell cycle progression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Although 12 day old chick embryo retinal pigment epithelial ( RPE ) cells in situ do not express the proliferating cell nuclear antigen ( PCNA ) which is known to function as an auxiliary protein of DNA polymerase delta , they do so when cultured on glass . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The levels of DNA polymerase alpha , DNA polymerase delta , and its accessory protein , proliferating cell nuclear antigen ( PCNA ) were examined in the regenerating rat liver . ^^^ Immunoblots and inhibition studies using specific antibodies showed that DNA polymerase delta and epsilon and PCNA were concomitantly induced after partial hepatectomy . ^^^ The levels of both DNA polymerase delta and epsilon and PCNA reached their maxima at 24 36 h post hepatectomy , i . e . , at the same time that in vivo DNA synthesis reached its peak . ^^^ These observations suggest that the variation of DNA polymerase delta and epsilon and PCNA during liver regeneration is closely related to DNA synthesis and is consistent with their involvement in DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a 36 kDa DNA polymerase delta auxiliary protein which accumulates in the nucleus during S phase of the cell cycle . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a 36 kDa DNA polymerase delta auxiliary protein which accumulates in the nucleus during S phase of the cell cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To elucidate whether this lengthening involves specific cycle phases to differing extents , the expression of two cycle related protein , PCNA and statin , was studied by dual parameter flow cytometry of indirect immunofluorescence protein labelling and DNA content . ^^^ In isotonic medium , most cells , in all the cycle phases , were PCNA positive ; in contrast , PCNA negative cells and statin positive cells were very few in number and only fell in the G0 / 1 range of DNA contents . ^^^ In hypertonic medium , the frequency of PCNA positive cells was lower , and that of statin positive cells higher , than in isotonic medium , particularly in the G0 / 1 range of DNA contents : this suggests that a G 0 block occurs under long term hypertonic stress . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This DNA was poorly replicated by yeast DNA polymerase delta with or without its cofactor proliferating cell nuclear antigen ( PCNA ) . ^^^ Formation of this replication proficient complex of DNA polymerase delta required an input of one to two molecules of PCNA per replicated DNA molecule . ^^^ DNA polymerase epsilon also formed an ATP dependent complex with PCNA and RF C . ^^^ Addition of PCNA stimulated the ATPase of RF C on primed but not on unprimed DNA , indicating that the increase in ATPase was due to PCNA enhanced binding of RF C to the primer terminus . ^^^ Calf thymus PCNA also stimulated the ATPase activity of yeast RF C and participated in holoenzyme formation with DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Lag times in DNA synthesis by DNA polymerase delta holoenzyme were due to ATP mediated formation of an initiation complex on the primed DNA by the polymerase with the proliferating cell nuclear antigen ( PCNA ) and replication factor C ( RF C ) . ^^^ A stable complex of RF C and PCNA on primed single stranded mp 18 DNA was isolated when these factors were preincubated with the DNA and with ATP , or , less efficiently with ATP gamma S . ^^^ DNA polymerase epsilon did not associate stably with RF C and PCNA onto the DNA , but its transient participation with these cofactors into a holoenzyme like initiation complex was inferred from its kinetic properties and replication product analysis . ^^^ Formation and activity of complexes with the proliferating cell nuclear antigen and with DNA polymerases delta and epsilon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Yeast Pol epsilon required the presence of a DNA binding protein ( SSB ) whereas human Pol epsilon required the addition of SSB , Activator 1 and proliferating cell nuclear antigen ( PCNA ) for maximal activity . ^^^ Both enzymes were totally unable to elongate primed DNA templates in the presence of salt ; however , activity could be restored by the addition of Activator 1 and PCNA . ^^^ Like Pol delta , Pol epsilon formed complexes with SSB coated primed DNA templates in the presence of Activator 1 and PCNA which could be isolated by filtration through Bio Gel A 5m columns . ^^^ The bearing of this observation on the requirement for a PCNA dependent DNA polymerase in the synthesis and maturation of Okazaki fragments is discussed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Bivariate flow cytometric analysis of the cell proliferation associated nuclear protein , identified as the `` proliferating cell nuclear antigen ' ' ( PCNA ) / cyclin and of nuclear DNA content , was performed in quiescent and mitogen stimulated human peripheral blood lymphocytes , in EUE ( human embryonic epithelium ) cells , before and after a long term exposure to a hypertonic ( HT ) medium , in 4 human leukemic cell lines and in fresh bone marrow ( BM ) cells from 10 patients with untreated acute non lymphoblastic leukemia ( ANLL ) . ^^^ The percentage of PCNA positive cells ( both with the autoantibody and the 19F4 MoAb ) was always higher than that of S phase cells by DNA FCM and of BUDR labeled cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , also called DNA polymerase delta associated protein , is found in the cells of the proliferative compartment of normal tissues and is essential for DNA replication . ^^^ Proliferating cell nuclear antigen ( PCNA ) , also called DNA polymerase delta associated protein , is found in the cells of the proliferative compartment of normal tissues and is essential for DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The sites of nascent DNA synthesis were compared with the distribution of the proliferating cell nuclear antigen ( PCNA ) in S phase nuclei of human diploid fibroblasts ( HDF ) by two in vitro techniques . ^^^ The sites of DNA synthesis were detected by biotin 11 dUTP incorporation and compared with the distribution of PCNA by indirect immunofluorescence . ^^^ When biotin incorporation did occur , LSCM revealed almost complete coincidence between the sites of DNA synthesis and the sites at which PCNA was localised . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA is essential for cellular DNA synthesis and is also required for the in vitro replication of simian virus 40 ( SV 40 ) DNA where it acts to coordinate leading and lagging strand synthesis at the replication fork . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Insights into native epitopes of proliferating cell nuclear antigen using recombinant DNA protein products . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To determine the mechanism ( s ) by which down regulation of human c myb protein ( MYB ) synthesis interferes with DNA synthesis , we analyzed mRNA levels of DNA polymerase alpha and proliferating cell nuclear antigen ( PCNA ) , transcripts of two genes required for DNA synthesis , in normal and leukemic T lymphocytes exposed to MYB antisense oligodeoxynucleotides . ^^^ Expression of DNA polymerase alpha was inhibited both in normal T lymphocytes progressing from G 0 to S phase and in exponentially growing CCRF CEM leukemic cells , whereas expression of PCNA was inhibited only in mitogen stimulated PBMC and remained essentially unaffected in the leukemia T cell line . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein required for leading strand DNA synthesis by polymerase delta . ^^^ Proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein required for leading strand DNA synthesis by polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen gene encodes a nuclear protein that is an auxiliary factor of DNA polymerase delta and part of the DNA replication machinery of the cell . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results show that , as it is synthesized , cyclin B binds and recruits p34cdc2 for tyrosine phosphorylation ; this inactive complex then requires the completion of DNA replication before it can be turned into fully active MPF . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The transgenic tobacco plants have been generated that express the E . coli beta glucuronidase ( GUS ) gene under control of the promoter from the rice proliferating cell nuclear antigen ( PCNA , DNA polymerase auxiliary protein ) gene . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
At the permissive temperature of 34 degrees , the mRNA levels for PCNA and histone H 3 increase markedly after serum stimulation in both cell lines , reaching a peak at the time of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The homology is likely to be related to the fundamental role of PCNA as an auxiliary protein for DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Exonuclease containing calf thymus DNA polymerase delta , which requires proliferating cell nuclear antigen for efficient synthesis , is significantly less accurate than pol epsilon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Other cyclin genes may be present because , on Southern blot analysis of soybean genomic DNA , the isolated soybean cDNA probe hybridized with additional genes under low stringency . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using multiparameter flow cytometry we have measured the nuclear DNA content of exponentially growing HL 60 cells in conjunction with protein content , nuclear forward light scatter , DNA in situ sensitivity to denaturation , DNA accessibility to 7 aminoactinomycin D ( 7 AMD ) , and content of the proliferation associated proteins : cyclin ( PCNA ) , p 105 , p 34 , and Ki 67 . ^^^ The ratio of cyclin ( PCNA ) / DNA remained rather constant whereas the contents of p 105 and p 34 proteins , when expressed per unit of DNA , both decreased during S phase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These data show that DRTF 1 is a group of transcription factors that share common DNA binding polypeptides and which complex with other non DNA binding proteins , such as the Rb protein and cyclin A , in a developmentally regulated and tissue dependent fashion . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA sequence analysis reveals that although this gene has cyclin homology , it is a new member of the cyclin gene family . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A is required for the onset of DNA replication in mammalian fibroblasts . ^^^ Inhibition of cyclin A synthesis or activity through microinjection of plasmids encoding antisense cyclin A cDNA or affinity purified anti cyclin A antibodies during G 1 phase was shown to abolish the nuclear staining for cyclin A in plasmid injected cells , and both procedures led to inhibition of DNA synthesis . ^^^ No similar effect was observed with injection of other antisense vectors including antisense cyclin B , and reinjection of purified human cyclin A protein into cyclin A antisense injected cells effectively relieved this inhibition of DNA synthesis . ^^^ Taken together , these data suggest that cyclin A plays a major role in the control of DNA replication in mammalian cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
When an inhibitor of DNA synthesis , aphidicolin , was added to the cells at the G 1 phase , an increase in the level of PCNA mRNA was observed . ^^^ These results indicate that the induction of mRNA for periwinkle PCNA occurred independently of the initiation of DNA replication , but that synthesis of certain proteins at the G 1 phase was required for the induction of periwinkle PCNA mRNA at the S phase . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This feature of the expression is similar to that of the proliferating cell nuclear antigen ( an auxiliary protein of DNA polymerase delta ) and seems to coincide with the proportions of proliferating cells in various developmental stages . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
For the in vitro studies , two cultured human glioma cell lines were investigated using MAb against DNA polymerase alpha , the MAb Ki 67 , a serum against proliferating cell nuclear antigen ( PCNA / cyclin ) , bromodeoxyuridine ( BUdR ) , and an anti BUdR MAb . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In some experiments the PCNA / Ki 67 staining was combined with a DNA stain , 7 amino actinomycin D , and simultaneous detection of the three stains was performed by a single laser flow cytometer . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) and the replication factors A and C ( RF A and RF C ) are cellular proteins essential for complete elongation of DNA during synthesis from the simian virus 40 origin of DNA replication in vitro . ^^^ Biochemical analyses with highly purified RF C and PCNA have demonstrated functions that are completely analogous to the functions of bacteriophage T 4 DNA polymerase accessory proteins . ^^^ Functions of replication factor C and proliferating cell nuclear antigen : functional similarity of DNA polymerase accessory proteins from human cells and bacteriophage T 4 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Recently , proliferating cell nuclear antigen ( PCNA ) , which in mammalian cells is an auxiliary subunit of DNA polymerase delta and is essential for in vitro leading strand SV 40 DNA replication , was purified from yeast . ^^^ Cell cycle expression studies , using synchronized cells , show that expression of both the PCNA ( POL 30 ) and the DNA polymerase delta ( POL 3 , or CDC 2 ) genes of yeast are regulated in an identical fashion to that of the DNA polymerase alpha ( POL 1 ) gene . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) gene codes for a protein that is necessary for cellular DNA synthesis and cell cycle progression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the presence of a single stranded DNA binding protein ( SSB ) , the elongation of primed DNA templates by DNA polymerase delta ( pol delta ) is dependent on ATP and two protein factors , activator 1 ( A 1 ) and proliferating cell nuclear antigen ( PCNA ) . ^^^ In the presence of ATP , A 1 , PCNA , and pol delta formed a stable complex with DNA that could be isolated by gel filtration . ^^^ The binding of PCNA to the A 1 SSB coated primed DNA occurred with adenosine 5 ' [ gamma thio ] triphosphate as well as ATP . ^^^ Mechanism of elongation of primed DNA by DNA polymerase delta , proliferating cell nuclear antigen , and activator 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a 36 Kd nuclear protein , identified as the auxiliary protein of DNA polymerase delta , that is upregulated in activated proliferating cells from a variety of tissues and species , including human lymphocytes . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a 36 Kd nuclear protein , identified as the auxiliary protein of DNA polymerase delta , that is upregulated in activated proliferating cells from a variety of tissues and species , including human lymphocytes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
HeLa DNA polymerase delta is processive only when HeLa proliferating cell nuclear antigen is present , whereas DNA polymerase epsilon is quite processive in its absence . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The levels of the mRNA for the proliferating cell nuclear antigen ( PCNA ) , a DNA replication factor , increase upon growth stimulation of quiescent cells . ^^^ To study the transcriptional aspect of this response , we have cloned a PCNA gene fragment from size fractionated human placental DNA . ^^^ The PCNA genomic DNA promotes transcription of a linked heterologous reporter gene in HeLa and 293 cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It also resembles the DNA polymerase delta of Lee et al . in being stimulated by proliferating cell nuclear antigen ( PCNA ) . ^^^ The major difference between the mouse DNA polymerase delta and the calf thymus enzyme of Lee et al . is that , under specific conditions , the mouse enzyme is active with poly ( dA ) . oligo ( dT ) in the absence of PCNA , whereas the activity of the calf thymus enzyme with this template is reported to be completely dependent on PCNA . ^^^ The p 125 does not respond to PCNA , suggesting that the 50 kDa polypeptide is required for the stimulation of DNA polymerase delta by PCNA . ^^^ The presence of the p 125 in cell extracts would explain reports that DNA polymerase delta consists of a single polypeptide of approximately 125 kDa and / or thast it has a smaller molecular mass than DNA polymerase delta of Lee et al . and is not affected by PCNA ( this does not apply to PCNA independent DNA polymerase delta like enzymes with higher molecular mass than the polymerase delta of Lee et al . , which have recently been named DNA polymerases epsilon ) . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results indicate that the expression of PCNA / cyclin correlates with DNA synthesis in cultured keratinocytes , but is not associated with their differentiation process . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This increase of the PCNA protein suggests that the PCNA protein is involved in CDDP resistance of P388 / CDDP through enhanced DNA repair synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This suggests that proliferating cell nuclear antigen enhances the processivity of pol delta by increasing both the residence time of pol delta on the DNA template primer and the rate at which individual nucleotides are incorporated . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The most striking difference between the two DNA polymerases is that processive DNA synthesis by DNA polymerase delta is dependent on proliferating cell nuclear antigen ( PCNA ) , a replication factor , while DNA polymerase epsilon is inherently processive . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The examples of oncogene products analyzed by FCM are ras , myc , p 53 , myb and fos ; those of cell proliferation related proteins are Ki 67 , PCNA and DNA polymerase alpha . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Some proteins not coded by oncogenes ( such as cyclin , the Ki 67 reactive antigen and DNA polymerase alpha ) are expressed in cycling , but not in G 0 cells and are of special interest for the kineticist , since they could identify cells which are able to initiate DNA synthesis , i . e . those representing the `` growth fraction ' ' of the population . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The limiting step in activation of the p 34 kinase at the G 1 to S transition may be its association with a cyclin since addition of cyclin A to a G 1 extract was sufficient to start DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Efficient elongation of nascent chains additionally requires proliferating cell nuclear antigen , replication factor C , DNA topoisomerase 1 , and DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Circumstantial evidence suggests that DNA polymerase alpha and at least one form of DNA polymerase delta , that which is stimulated by Proliferating Cell Nuclear Antigen , catalyze mammalian cell replicative DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA polymerase 2 is similar to the proliferating cell nuclear antigen ( PCNA ) independent form of mammalian DNA polymerase delta in its resistance to butylpheny dGTP , template specificity , stimulation of polymerase and exonuclease activity by KCl , and high processivity . ^^^ Although calf thymus PCNA does not stimulate the activity of DNA polymerase 2 on poly ( dA ) : oligo ( dT ) , possibly due to the limited length of the template , the high processivity of yeast DNA polymerase 2 on this template can be further increased by the addition of PCNA , suggesting that conditions may exist for interactions between PCNA and yeast DNA polymerase II . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
S phase patterns of cyclin ( PCNA ) antigen staining resemble topographical patterns of DNA synthesis . ^^^ A role for cyclin in DNA replication . ^^^ Patterns of cyclin staining observed between the beginning of S phase and maximum DNA synthesis are similar to those reported in human AMA cells [ ( 1985 ) Proc . ^^^ Using [ 3H ] thymidine autoradiography and indirect immunofluorescence of the same cells we show a remarkable correlation between cyclin antigen distribution and topographical patterns of DNA synthesis . ^^^ Taken together the above observations argue for a role of cyclin in some aspect of DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Increased nuclear cyclin / PCNA antigen staining of non S phase transformed human amnion cells engaged in nucleotide excision DNA repair . ^^^ PCNA autoantibodies specific for cyclin / PCNA were used to determine the nuclear distribution of this protein in transformed human amnion cells ( AMA ) irradiated with ultraviolet light ( 254 nm ) under conditions that induced nucleotide excision DNA repair synthesis . ^^^ These observations raise the possibility that cyclin / PCNA may play a role in nucleotide excision DNA repair synthesis in addition to its putative role in replicative DNA synthesis . . ^^^ PCNA autoantibodies specific for cyclin / PCNA were used to determine the nuclear distribution of this protein in transformed human amnion cells ( AMA ) irradiated with ultraviolet light ( 254 nm ) under conditions that induced nucleotide excision DNA repair synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The kinetics of PCNA expression suggest that it is associated with a phase preceding active DNA synthesis . ^^^ We now report that a human antibody preparation monospecific for PCNA , but not two monoclonal antibodies directed against different epitopes on PCNA , can inhibit the ability of ADR to induce DNA synthesis in isolated quiescent nuclei . ^^^ Inhibition of nuclear DNA synthesis by an autoantibody to proliferating cell nuclear antigen / cyclin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The structural relationship between the proliferating cell nuclear antigen ( PCNA ) dependent calf DNA polymerase delta and DNA polymerase alpha from human and calf was analyzed by two dimensional tryptic peptide mapping of the catalytic polypeptides . ^^^ The results demonstrate that the catalytic polypeptides of the PCNA dependent calf polymerase delta and DNA polymerase alpha are distinct , unrelated , and do not share any common structural determinants . ^^^ The immunological and structural relationship between a recently identified PCNA independent form of DNA polymerase delta from HeLa cells was also assessed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Human autoimmune sera specific for proliferating cell nuclear antigen ( PCNA ) / cyclin ( auxiliary protein for DNA polymerase delta ) demonstrated the presence of epitopes within the macro and micronuclei of the hypotrichous ciliated protozoa Euplotes eurystomus . ^^^ Tightly bound PCNA / cyclin was localized at the site of DNA synthesis in macronuclei , the rear zone of the replication band . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These include : ( 1 ) two partially purified fractions , CF IC and CF IIA , and ( 2 ) four proteins that have been purified to near homogeneity , replication protein A , proliferating cell nuclear antigen , DNA polymerase alpha primase complex , and topoisomerase ( 1 and 2 ) . ^^^ Proliferating cell nuclear antigen , DNA polymerase alpha primase , and CF IIA all appear to be involved in elongation of nascent chains . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Complete DNA replication in this system required the proliferating cell nuclear antigen and another cellular replication factor , RF C , during the elongation stage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , the portion of ICP 8 needed for a nuclear function ( s ) distinct from DNA binding is the part of ICP 8 showing sequence similarity to that of the cellular protein cyclin or proliferating cell nuclear antigen . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Twenty three pyrophosphate analogues were screened as inhibitors of proliferating cell nuclear antigen independent DNA polymerase delta ( pol delta ) derived from calf thymus . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Characterization of a large form of DNA polymerase delta from HeLa cells that is insensitive to proliferating cell nuclear antigen . ^^^ Proliferating cell nuclear antigen , also characterized as a DNA polymerase delta auxiliary protein , does not increase the activity of this preparation of the enzyme . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Involvement of proliferating cell nuclear antigen ( cyclin ) in DNA replication in living cells . ^^^ Proliferating cell nuclear antigen ( PCNA ) ( also called cyclin ) is known to stimulate the activity of DNA polymerase delta but not the other DNA polymerases in vitro . ^^^ We injected a human autoimmune antibody against PCNA into unfertilized eggs of Xenopus laevis and examined the effects of this antibody on the replication of injected plasmid DNA as well as egg chromosomes . ^^^ Anti PCNA antibody alone did not block plasmid replication completely , but the residual replication was abolished by coinjection of a monoclonal antibody against DNA polymerase alpha . ^^^ In similar studies on the replication of egg chromosomes , the inhibition by anti PCNA antibody was only 30 % , while anti DNA polymerase alpha antibody blocked 73 % of replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Calf thymus DNA polymerase delta independent of proliferating cell nuclear antigen ( PCNA ) . ^^^ Calf thymus proliferating cell nuclear antigen ( PCNA ) could not stimulated this DNA polymerase delta in any step of the isolation procedure . ^^^ If tested on poly ( dA ) / oligo ( dT ) 12 18 ( base ratio 10 : 1 ) , PCNA had no stimulatory effect on DNA polymerase delta when tested with low enzyme DNA ratio nor did it change the kinetic behaviour of the enzyme . ^^^ DNA polymerase delta itself did not contain PCNA . ^^^ This supports that a PCNA independent DNA polymerase delta exists in calf thymus in addition to a PCNA dependent enzyme ( Lee , M . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It is now known to be a co factor of DNA polymerase delta and to be necessary for DNA synthesis and cell cycle progression . cDNA clones of human PCNA have been isolated and , using one of these cDNA , we have now obtained from a lambda phage library a clone containing the entire human PCNA gene and flanking sequences . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ; also called cyclin ) was originally described in proliferating mammalian cells as a nuclear protein with an apparent Mr of 33 , 000 36 , 000 and recently was found to be a DNA polymerase delta auxiliary protein . ^^^ A PCNA / cyclin related molecular clone ( pCJ 1 ) was isolated from rice DNA and was partially sequenced . ^^^ The highly homologous nature of the gene for PCNA / cyclin throughout the animal and plant kingdoms suggests that the product of the gene plays an essential role in DNA replication in eukaryotes . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Studies on the DNA elongation inhibitor and its proliferating cell nuclear antigen dependent control in simian virus 40 DNA replication in vitro . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA / cyclin ) is a nuclear protein that can stimulate purified DNA polymerase delta in vitro , and its synthesis correlates with the proliferation rate of cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) , also known as cyclin and DNA polymerase delta auxiliary factor , is present in reduced amounts in nongrowing cells and is synthesized at a greater rate in the S phase of growing cells . ^^^ The recently discovered involvement of PCNA in DNA replication suggested that this pattern of expression functions to regulate DNA synthesis . ^^^ We conclude that the cyclic synthesis of PCNA in cycling HeLa cells maintains PCNA in excess of the amount involved directly in DNA replication and the amount of the protein neither fluctuates significantly with the cell cycle nor is limiting for DNA synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Previous immunofluorescent studies demonstrated that the DNA replication sites correspond to the localization of bound cyclin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) mediates the replication of simian virus 40 ( SV 40 ) DNA by reversing the effects of a protein that inhibits the elongation reaction . ^^^ We report that activator 2 isolated from HeLa cell extracts is a PCNA dependent DNA polymerase delta that is required for efficient replication of DNA containing the SV 40 origin of replication . ^^^ PCNA dependent DNA polymerase delta on a DNA singly primed phi X 174 single stranded circular DNA template required PCNA , a complex of the elongation inhibitor and activator 1 , and the single stranded DNA binding protein essential for SV 40 DNA replication . ^^^ These results indicate that both DNA polymerase alpha and delta are involved in SV 40 DNA replication in vitro and their activity depends on PCNA , the elongation inhibitor , and activator I . . ^^^ Proliferating cell nuclear antigen ( PCNA ) mediates the replication of simian virus 40 ( SV 40 ) DNA by reversing the effects of a protein that inhibits the elongation reaction . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In cells treated with EGF , elevation of c H ras expression was detected at the 22nd , 34th , 44th , and 54th h after plating , PCNA expression and DNA synthesis were detected at the 44th and 54th h . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Addition of replication factors RF A , PCNA and RF C , which were previously shown to be required for SV 40 DNA replication in vitro , differentially stimulated the activity of both DNA polymerases . ^^^ RF A and RF C independently stimulated DNA polymerase alpha activity 4 to 6 fold , yielding relatively short DNA strands ( less than 1 kb ) and PCNA had no effect . ^^^ In contrast , polymerase delta activity was stimulated co operatively by PCNA , RF A and RF C approximately 25 to 30 fold , yielding relatively long DNA strands ( up to 4 kb ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Unusual restriction fragments were detected by DNA blot hybridization with PCNA ( DNA polymerase delta auxiliary protein ) probe in one of seven cases of congenital malformations . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
S phase nuclei are typified by the co distribution of both anti DNA polymerase alpha and anti PCNA antibodies as discrete spots of fluorescence which align the chromatin . ^^^ However , as DNA replication is terminated , PCNA fluorescence fades and DNA polymerase alpha dissociates from the chromatin and is redistributed throughout the nucleoplasm . ^^^ By inhibiting DNA replication with aphidicolin , both DNA polymerase alpha and PCNA remain associated with the chromatin throughout prolonged incubation . ^^^ Upon nuclear envelope breakdown and lamin dispersal , cyclins degrade ; however , no chromosomes are formed , and both PCNA and DNA polymerase alpha remain associated with the chromatin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The present authors identified protein 7 as cyclin / proliferating cell nuclear antigen ( PCNA ) , the auxiliary protein of DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Induction of the nuclear protein cyclin in serum stimulated quiescent 3T3 cells is independent of DNA synthesis . ^^^ Inhibition of DNA synthesis and cell proliferation of mouse 3T3 cells by aphidicolin did not affect the expression of cyclin , a nuclear protein whose synthesis correlates with cell proliferation , as determined by quantitative two dimensional gel electrophoresis analysis . ^^^ Serum stimulation of quiescent 3T3 cells revealed that cyclin synthesis increases shortly before DNA synthesis . ^^^ Inhibition of DNA synthesis by aphidicolin in serum stimulated quiescent cells did not affect the increase of cyclin following stimulation . ^^^ These results demonstrate that cyclin synthesis is not coupled to DNA synthesis and that it is one of the latest events before DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
At a later stage , before maximum DNA synthesis , cyclin redistributes to reveal a punctuated pattern with foci of staining throughout the nucleus . ^^^ These results are consistent with the idea that cyclin is a central component of the pathway ( s ) leading to DNA replication and cell division . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Changes in the nuclear distribution of cyclin ( PCNA ) but not its synthesis depend on DNA replication . ^^^ Synthesis of cyclin in serum stimulated quiescent 3T3 cells increases shortly before DNA synthesis after 10 h of stimulation , reaching a maximum after 16 h . ^^^ Inhibition of DNA synthesis by hydroxyurea does not affect the increase of cyclin following stimulation , as determined by quantitative two dimensional gel electrophoresis . ^^^ They also reveal that there are dramatic changes in the nuclear distribution of cyclin and that these depend on DNA synthesis or events occurring during the S phase . ^^^ These results strengthen the notion that cyclin is an important component of the events leading to DNA replication and cell division . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Individual nuclei in polykaryons can control cyclin distribution and DNA synthesis . ^^^ These results are taken to imply that individual nuclei in these polykaryons can control cyclin distribution and DNA synthesis in spite of the fact that they share a common cytoplasm . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Synthesis of the nuclear protein cyclin ( PCNA ) and its relationship with DNA replication . ^^^ Synthesis of the nuclear protein cyclin ( MW 36 000 ) and DNA in quiescent mouse fibroblasts is coordinately induced by serum and purified growth factors . ^^^ Inhibition of DNA synthesis by hydroxyurea or aphidicolin in serum stimulated quiescent cells does not affect the induction of cyclin . ^^^ Immunofluorescence studies reveal that there are dramatic changes in the nuclear distribution of cyclin during S phase and that these depend on DNA synthesis or events during S phase . ^^^ These observations strengthen the notion that cyclin is an important component of the events leading to DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cells were then analysed by flow cytometry for PCNA and DNA content . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Monoclonal antibodies to a nuclear protein ( PCNA / cyclin ) associated with DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Studies with deletion mutants that in combination removed all but the N terminal 85 amino acids common to both the 12S and 13S proteins suggest that this region may be sufficient for the induction of synthesis of proliferating cell nuclear antigen and the stimulation of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cell cycle regulated proliferating cell nuclear antigen is required for SV 40 DNA replication in vitro . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin / PCNA is the auxiliary protein of DNA polymerase delta . ^^^ The rate of cyclin synthesis is very low in quiescent cells and increases several fold after serum stimulation shortly before DNA synthesis . ^^^ Immunofluorescence and autoradiography studies have shown that the nuclear staining patterns of cyclin during S phase have a sequential order of appearance and a clear correlation can be found between DNA synthesis and cyclin positive nuclei . ^^^ We report here that cyclin and the auxiliary protein of DNA polymerase delta are identical . . ^^^ Cyclin / PCNA is the auxiliary protein of DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using this system , a cellular protein of relative molecular mass 36 , 000 ( Mr = 36K ) that is required for the elongation stage of SV 40 DNA replication in vitro has been purified and identified as a known cell cycle regulated protein , alternatively called the proliferating cell nuclear antigen ( PCNA ) or cyclin . ^^^ It was noticed that , in its physical characteristics , PCNA closely resembles a protein that regulates the activity of calf thymus DNA polymerase delta . ^^^ Functional identity of proliferating cell nuclear antigen and a DNA polymerase delta auxiliary protein . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cloning and sequence of the human nuclear protein cyclin : homology with DNA binding proteins . ^^^ Inhibition of DNA synthesis by hydroxyurea in serum stimulated cells did not affect the increase in cyclin mRNA but inhibited 90 % the expression of H 3 mRNA . ^^^ A region of the cyclin sequence shows a significant homology with the putative DNA binding site of several proteins , specially with the transcriptional regulator cAMP binding protein of Escherichia coli , suggesting that cyclin could play a similar role in eukaryotic cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Southern blot analysis of total human genomic DNA suggests that there is a single gene coding for PCNA / cyclin . ^^^ The deduced amino acid sequence of rat PCNA / cyclin has a similarity with that of herpes simplex virus type 1 DNA binding protein . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Thus , the onset of PCNA expression is a phase in cell proliferation that follows transferrin receptor expression but preceded DNA synthesis . ^^^ Drugs like dexamethasone and cyclosporin , which affect the early part of G 1 , inhibited PCNA expression ; whereas cytarabine ( ara C ) and hydroxyurea , which affect the S phase and prevent DNA synthesis , did not block PCNA expression . ^^^ The results show that PCNA expression is regulated by a signal after IL 2 binding and that PCNA labeling is a precise indicator for human T cells that are committed to DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin ( PCNA , auxiliary protein of DNA polymerase delta ) is a central component of the pathway ( s ) leading to DNA replication and cell division . ^^^ Cyclin , also known as PCNA or the auxiliary protein of mammalian DNA polymerase delta , is a stable cell cycle regulated ( synthesized mainly in S phase ) nuclear protein of apparent Mr 36 , 000 whose rate of synthesis correlates directly with the proliferative state of normal cultured cells and tissues . ^^^ Cyclin ( PCNA , auxiliary protein of DNA polymerase delta ) is a central component of the pathway ( s ) leading to DNA replication and cell division . ^^^ Cyclin , also known as PCNA or the auxiliary protein of mammalian DNA polymerase delta , is a stable cell cycle regulated ( synthesized mainly in S phase ) nuclear protein of apparent Mr 36 , 000 whose rate of synthesis correlates directly with the proliferative state of normal cultured cells and tissues . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA / cyclin : a lupus antigen connected with DNA replication . ^^^ PCNA is expressed in the nucleus immediately preceding S phase and , during S phase is colocalized with sites of active DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Existence of two populations of cyclin / proliferating cell nuclear antigen during the cell cycle : association with DNA replication sites . ^^^ Pulse chase experiments have revealed that cyclin , the auxiliary protein of DNA polymerase delta , is stable during the transition from growth to quiescence in 3T3 cells . ^^^ By using antibromodeoxyuridine immunofluorescence to detect the sites of DNA synthesis , it was shown that the staining patterns of the replicon clusters and their order of appearance throughout the S phase are identical to those observed for cyclin . ^^^ This demonstrates that cyclin is tightly associated to the sites of DNA replication and that it must have a fundamental role in DNA synthesis in eukaryotic cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Two murine monoclonal antibodies to the proliferating cell nuclear antigen ( PCNA ) , a rabbit anti N terminal peptide antibody and human auto antibody to PCNA reacted with the auxiliary protein for DNA polymerase delta from fetal calf thymus following SDS polyacrylamide gel electrophoresis , confirming the identity of PCNA and the auxiliary protein . ^^^ The human anti PCNA autoantibody neutralized the activity of the auxiliary protein for DNA polymerase delta , but did not inhibit the activity of pol delta itself . ^^^ The ability of PCNA , a cell cycle regulated protein , to regulate the activity of pol delta suggests a central role for pol delta in cellular DNA replication . . ^^^ Autoantibody to the proliferating cell nuclear antigen neutralizes the activity of the auxiliary protein for DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Coordinated leading and lagging strand synthesis during SV 40 DNA replication in vitro requires PCNA . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a cell cycle and growth regulated protein required for replication of SV 40 DNA in vitro . ^^^ In the completely reconstituted replication system that contains PCNA , DNA synthesis initiates at the origin and proceeds bidirectionally on both leading and lagging strands around the template DNA to yield duplex , circular daughter molecules . ^^^ Thus two stages of DNA synthesis have been defined , with the second stage requiring PCNA for coordinated leading and lagging strand synthesis at the replication fork . ^^^ We suggest that during eukaryotic chromosome replication there is a switch to a PCNA dependent elongation stage that requires two distinct DNA polymerases . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , this fixation technique permits simultaneous labeling of DNA by propidium iodide and PCNA by monoclonal antibodies . ^^^ Simultaneous labeling of PCNA and DNA showed that the PCNA signal increased during the G 1 phase of the cell cycle , reached its maximum in the S phase , and declined during the G2 / M phase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA or cyclin ) is a nuclear protein recently identified as a cofactor of DNA polymerase delta . ^^^ These experiments indicate that PCNA ( cyclin ) is important in cellular DNA synthesis and in cell cycle progression . . ^^^ When exponentially growing Balb / c3T3 cells are exposed to antisense oligodeoxynucleotides to PCNA , both DNA synthesis and mitosis are completely suppressed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Calf thymus DNA polymerase delta : purification , biochemical and functional properties of the enzyme after its separation from DNA polymerase alpha , a DNA dependent ATPase and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Human cyclin / PCNA ( proliferating cell nuclear antigen ) is structurally , functionally , and immunologically homologous to the calf thymus auxiliary protein for DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The yeast analog of mammalian cyclin / proliferating cell nuclear antigen interacts with mammalian DNA polymerase delta . ^^^ DNA polymerase 3 from Saccharomyces cerevisiae is analogous to the mammalian DNA polymerase delta by several criteria , including an increased synthetic activity on poly ( dA ) . oligo ( dT ) ( 40 : 1 nucleotide ratio ) in the presence of calf thymus proliferating cell nuclear antigen ( PCNA ) , or cyclin . ^^^ On a molar basis yPCNA and calf thymus PCNA / cyclin are equally active in stimulating DNA synthesis by DNA polymerase 3 . ^^^ About 10 times more yPCNA than calf thymus PCNA / cyclin is needed , however , to stimulate calf thymus DNA polymerase delta , and the degree of stimulation obtained at saturating levels of yPCNA is a factor of 2 3 less than with calf thymus PCNA / cyclin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The intensity of the immunofluorescent staining of cyclin / PCNA observed in UV irradiated cells corresponded with the UV dose used and with the DNA repair synthesis detected by autoradiography . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
One of these polypeptides was cyclin ( proliferating cell nuclear antigen ) , a cell cycle specific DNA polymerase delta auxiliary factor . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In contrast , PCNA has been reported to stimulate SV 40 DNA synthesis carried out with crude fractions [ Prelich , G . , Kostura , M . , Marshak , D . ^^^ In the presence of PCNA , crude fractions containing this elongation inhibition factor can extend DNA chains . ^^^ We describe the partial purification of this inhibitor and show that its addition limited SV 40 DNA replication to the synthesis of short chains , an effect reversed by the addition of PCNA . ^^^ These results suggest that the PCNA mediated effect on SV 40 DNA replication may be indirect . ^^^ Such an interplay between negative and positive regulatory functions including PCNA may contribute to the control of DNA synthesis characteristic of the eukaryotic cell cycle . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Protein protein interactions of yeast DNA polymerase 3 with mammalian and yeast proliferating cell nuclear antigen ( PCNA ) / cyclin . ^^^ We have previously reported the purification of yeast analogs to mammalian DNA polymerase delta and proliferating cell nuclear antigen ( PCNA ) / cyclin : DNA polymerase 3 and yeast PCNA , respectively . ^^^ Yeast DNA polymerase 3 binds to the DNA in the absence of yeast PCNA / cyclin , but comigration of either yeast or calf thymus PCNA / cyclin with the DNA requires the additional presence of yeast DNA polymerase 3 . ^^^ We could also isolate a DNA calf thymus DNA polymerase delta calf thymus PCNA / cyclin complex . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
As PCNA has been identified as a processivity factor for DNA polymerase delta , we suggest that both polymerases alpha and delta are involved in this system . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
FITC labeled antibodies against Trf r , PCNA , and the Ki 67 reactive antigen , as well as propidium iodide DNA distribution , were simultaneously measured on human leukemia HL 60 and K 562 , and breast carcinoma MCF 7 cell lines and on fresh human leukemic and glioblastoma cells . ^^^ The 70 % ethanol fixation for Trf r and PCNA and the 95 % acetone fixation for Ki 67 plus permeabilization ( with 0 . 1 % and 1 % Triton X 100 , respectively , for the surface and the nuclear antigens ) produced cell suspensions with negligible cell clumping , high quality DNA profiles , and bright specific immunofluorescent staining . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In situ hybridization was used to examine the spatial distributions of three translationally controlled maternal RNAs in oocytes and two cell embryos of the clam Spisula . 3H labeled single stranded RNA probes were generated from SP 6 recombinant clones containing DNA inserts encoding portions of histone H 3 ( the DNA sequence which is presented here ) , cyclin A , and the small subunit of ribonucleotide reductase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The prevalence of antibodies to the following antigens was as follows : double stranded ( ds ) DNA ( 43 % ) , histone ( 81 % ) , Sm ( 26 % ) , nuclear ribonuclear protein ( nRNP ) ( 32 % ) , SS A ( Ro ) ( 63 % ) , SS B ( La ) ( 12 % ) , SL / Ki ( 9 % ) , ribosomal RNP ( rRNP ) ( 16 % ) , p70 / p80 ( 5 % ) , proliferating cell nuclear antigen ( PCNA ) ( 3 % ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Some of this new knowledge includes the identification of the Sm and RNP antigens as ribonucleoprotein particles involved in splicing of precursor messenger RNA , Scl 70 as DNA topoisomerase 1 , proliferating cell nuclear antigen as auxiliary protein of DNA polymerase delta , and certain antigens in myositis as aminoacyl transfer RNA synthetases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Additional information has been entered for the cell cycle regulated and DNA replication protein cyclin ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Together with the previously identified nuclear protein cyclin , these phosphoproteins are likely candidates for proteins that may play a role in the regulation of the onset of DNA synthesis and cell division . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This preparation was devoid of previously identified nuclear antigens including ribonucleoprotein ( U 1 RNP ) , proliferating cell nuclear antigen ( PCNA ) , Sjgren ' s syndrome antigen A ( SS A / Ro ) , Sjgren ' s syndrome antigen B ( SS B / La ) , Sjgren ' s lupus antigen ( SL ) , scleroderma antigen 70 ( Scl 70 ) , DNA and histones . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Coordinated synthesis of the nuclear protein cyclin and DNA in serum stimulated quiescent 3T3 cells . ^^^ Quantitative two dimensional gel electrophoretic analysis ( IEF ) of the nuclear polypeptide cyclin together with autoradiographic studies have revealed a coordinate synthesis of cyclin and DNA after serum stimulation of quiescent 3T3 cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The effect of serum and growth factors [ platelet derived growth factor ( PDGF ) , fibroblast growth factor ( FGF ) ] on the synthesis of the nuclear protein cyclin and its correlation with DNA synthesis has been studied in quiescent mouse 3T3 cells by means of quantitative two dimensional gel electrophoresis . ^^^ The stimulation of cyclin synthesis is dose dependent and correlates directly with DNA synthesis . ^^^ In addition , partially purified PDGF and FGF also induce cyclin and DNA synthesis in a coordinate way . ^^^ Both growth factors , like serum , exhibit a similar lag phase to induce maximal cyclin ( 6 to 7 fold ) and DNA synthesis ( 90 % of the cells ) . ^^^ The coordinate induction of cyclin and DNA synthesis can only be observed with growth factors that induce DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
During mitogen induced blast transformation of lymphocytes , PCNA was noticed in the nucleolus before the initiation of DNA synthesis and later became nucleoplasmic with disappearance of nucleolar staining . ^^^ These studies demonstrate that the relationship of PCNA to proliferation and blast transformation may be associated with events related to DNA synthesis in these cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we show that leflunomide blocked 1 ) increases in nucleolar size and number , 2 ) upregulation of the nuclear protein antigens ( PCNA and Ki 67 ) , 3 ) increases in uridine incorporation and total RNA and DNA content , 4 ) cell cycle progression and 5 ) proliferation in mitogen stimulated rat spleen mononuclear cells and human peripheral blood mononuclear cells ( HPBMC ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using anti PCNA antibody ( PC 10 ) , an immunohistochemical study of the expression of PCNA in formalin fixed and paraffin embedded materials of colorectal cancer patients was performed and correlation of PCNA expression with clinicopathological findings and DNA ploidy pattern was studied . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have previously shown ( Smith et al . , 1994 ) that antibodies raised against the growth arrest and DNA damage inducible protein Gadd 45 co precipitate proliferating cell nuclear antigen ( PCNA ) , a protein involved in DNA replication and repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It is postulated that the interactions of Gadd 45 with both p21Cip1 and PCNA are important for the modulation of cell cycles , and for the inhibition of DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Gadd 45 was found to bind to PCNA , a normal component of Cdk complexes and a protein involved in DNA replication and repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
By these purification steps , DNA polymerase and proliferating cell nuclear antigen ( PCNA ) were completely separated at the step of heparin Sepharose CL 6B column chromatography . ^^^ After the separation of DNA polymerase gamma and PCNA , the two fractions were remixed and DNA polymerase gamma activity was measured . ^^^ DNA polymerase gamma activity was stimulated about three fold or more in the presence of the PCNA fraction . ^^^ In addition , highly purified human recombinant PCNA stimulated the DNA polymerase gamma activity . ^^^ These results indicate that DNA polymerase gamma , like DNA polymerase delta , is activated by PCNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Hepatic regenerative activity was documented 24 hours post PHx by 3H thymidine incorporation into hepatic DNA ( DNA synthesis ) , proliferating cell nuclear antigen staining , and hepatic tissue putrescine levels . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The latter step is accomplished in vitro by proteins that include the DNA polymerase accessory factor PCNA , which binds to DNA ends to initiate repair synthesis . ^^^ An increased association of PCNA with nuclei occurs after UV irradiation of nonreplicating DNA in normal human fibroblasts , probably following incision of damaged DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Papillomavirus DNA replication is also dependent on the cellular factors replication protein A , replication factor C , and proliferating cell nuclear antigen as well as a phosphocellulose column fraction ( IIA ) . ^^^ Interestingly , replication factor C and proliferating cell nuclear antigen are more stringently required for DNA synthesis in the papillomavirus system than in the simian virus 40 in vitro system . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have previously shown that the activation of DNA polymerase alpha , and the expression of the proliferating cell nuclear antigen were inhibited when the anti calmodulin drug W 13 is added to the cell cultures . ^^^ Our data suggest that calmodulin might regulate DNA replication through the control of the activities of DNA polymerases alpha and delta and the expression of proliferating cell nuclear antigen . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
As an initial step of examining the possible values or potentials of CLSM observations in diagnostic pathology materials , we applied CLSM to the analysis of immunolocalization of proliferating cell nuclear antigen ( PCNA ) , p 53 and cytokeratin , and eosin and DNA fluorochrome propidium ( PI ) stain in cell smears obtained from 20 cases of squamous cell carcinoma of the esophagus . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In order to establish whether the upregulation of IGF 1 and IGF 1R with infarction was coupled with induction of late growth related genes , which are known to be implicated in DNA replication and mitotic division , proliferating cell nuclear antigen ( PCNA ) and histone H 3 expression was assessed by Northern blot and RTPCR . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The association of the proliferating cell nuclear antigen ( PCNA ) to DNA synthesis sites during the process of DNA repair , was investigated in human diploid fibroblasts after treatment with different genotoxic agents . ^^^ These results indicate that PCNA is involved in DNA excision repair of genotoxic agents , but suggest that similar types of lesions may be repaired with alternative pathways not requiring PCNA . . ^^^ Involvement of proliferating cell nuclear antigen in DNA repair after damage induced by genotoxic agents in human fibroblasts . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
First , immunocytochemical detection of the proliferating cell nuclear antigen , an auxiliary protein of DNA polymerase , allowed labeling of cells in late G 1 , S , and early G 2 phases of the cell cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This activity was not affected first by calf thymus proliferating cell nuclear antigen and replication factor C and second by Escherichia coli single stranded DNA binding protein , which together allow DNA polymerase delta to perform strand displacement DNA synthesis ( Podust , V . , and Hbscher , U . ( 1993 ) Nucleic Acids Res . 21 , 841 846 ) . 3 ' Azido 2 ' , 3 ' dideoxythymidine triphosphate inhibited displacement completely , indicating that DNA synthesis is required for this reaction . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) is a conserved protein required for cellular DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To evaluate the objective proliferative activity in HCC nuclear DNA contents were measured by means of microspectrophotometry and at the same time the immunohistochemical technique using anti PCNA antibody was employed . ^^^ The analysis was performed by immunohistochemical demonstration of PCNA and pathologic histochemical study in formalin fixed , paraffin embedded specimens and cytophotometric measurements of nuclear DNA contents in fresh specimens . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In cancer tissues the AgNOR value is also closely related to both the percentage of cycling cells ( measured by Ki 67 or PCNA immunolabelling ) and S phase cells ( measured by BrdU incorporation or DNA flow cytometry ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition to its role as a processivity factor in DNA replication , proliferating cell nuclear antigen ( PCNA ) may function in the regulation of cell cycle progression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replicative DNA synthesis , as measured by immunohistochemical staining for proliferating cell nuclear antigen , was increased in proximal tubules of rats dosed with 2 % t butyl alcohol . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A comparative study of their proliferative activity using proliferating cell nuclear antigen , DNA flow cytometry , and p 53 . ^^^ We analyzed the proliferative activities , immunoreactivity of the p 53 protein , and aneuploidy in patients with benign and malignant fibrous lesions , including 19 with nodular fasciitis ( cellular type ) ( 6 88 years old , mean 42 . 9 ) , 11 with abdominal fibromatoses ( 22 74 years old , mean 37 . 9 ) , 13 with extraabdominal fibromatoses ( 2 38 years old , mean 19 . 5 ) , and 23 with fibrosarcomas ( adult type : 16 71 years old , mean 47 . 3 ; infantile type : 3 months to 9 years , mean 2 . 9 ) using immunohistochemistry to determine proliferating cell nuclear antigen ( PC 10 ) and p 53 protein ( CM 1 ) as well as performing DNA flow cytometry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , also known as auxiliary protein of DNA polymerase delta , is involved in DNA replication and repair . ^^^ Proliferating cell nuclear antigen ( PCNA ) , also known as auxiliary protein of DNA polymerase delta , is involved in DNA replication and repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear Ag ( PCNA ) is a DNA replication factor postulated to function as a sliding clamp around DNA . ^^^ These findings are consistent with the idea that autoantibodies are generated as a response to native Ag and provide experimental support for the hypothesis that PCNA serves its processive function in DNA replication as a trimeric ring structure . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In keeping with previous studies , the insignificant PCNA expression of macrophages should not be related to cell proliferation , but to unscheduled DNA strand repair which may be generated in the course of viral infection in AIDS . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA complexes and inhibited in vitro transcription by 95 % from the CRE containing murine proliferating cell nuclear antigen promoter . mAb 5 reacted specifically with ATF 1 and did not prevent DNA binding or affect in vitro transcription . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Quantitative nuclear morphometry , Markovian texture descriptors , and DNA content captured on a CAS 200 Image analysis system , combined with PCNA and HER 2 / neu immunohistochemistry for prediction of prostate cancer progression . ^^^ The biomarkers of greatest utility to detect progressors when analyzed univariately included post operative Gleason score ( p = < 0 . 0001 ) , HER 2 / neu antigenicity ( p = 0 . 0147 ) , CAS 200 DNA ploidy ( p = 0 . 008 ) , and twelve Markovian nuclear texture and shape features ( p = < 0 . 0001 ) , whereas PCNA ( p = 0 . 160 ) failed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The consensus panel identified a small and manageable group of biomarkers measured in tissue or serum as the most promising in prostate cancer chemoprevention , including ( 1 ) prostate specific antigen ( PSA ) ; ( 2 ) morphometric markers , such as nuclear size and roundness ; ( 3 ) proliferation markers , such as MIB 1 and PCNA ; ( 4 ) nuclear DNA content ( ploidy ) ; ( 5 ) oncogene c erbB 2 ( HER 2 / neu ) expression ; ( 6 ) angiogenesis ; and ( 7 ) high grade prostatic intraepithelial neoplasia ( PIN ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A series of 71 patients undergoing surgery for primary breast carcinoma was prospectively studied in order to evaluate the relative weight for four biologic factors ( intermediate filament vimentin expression , proliferating cell nuclear antigen [ PCNA ] , flow cytometric DNA ploidy and S phase fraction ) and of several clinicopathologic and biologic features in predicting clinical outcome ( disease free interval ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factors RF A and RF C , proliferating cell nuclear antigen , and Escherichia coli single stranded DNA binding protein showed no significant effect on this preparation ' s pol epsilon activity , processivity , or substrate specificity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cellular proliferation in vivo was confirmed by 1 ) flow cytometric analysis of DNA content ( FACS ) of freshly isolated AEC and 2 ) immunohistochemistry of proliferating cell nuclear antigen ( PCNA ) and bromodeoxyuridine ( BrdU ) incorporation into DNA on lung sections . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA is a component of the DNA replication complex and is associated with DNA polymerase delta in continuous strand DNA synthesis at the replication fork . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , examination of histological sections of human skin exposed to solar stimulated UV light showed ISEL in both keratinocytes and superficial dermal cells , with the same spatial and temporal distribution as that of a marker of DNA repair , PCNA ( proliferating cell nuclear antigen ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , the levels of proliferating cell nuclear antigen , a subunit of DNA polymerase delta , fell . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Changes in the morphology of cells in different epidermal layers were compared with histochemical analyses of the extent of DNA fragmentation , as determined by nick end labelling , and of the reactivities to a monoclonal antibody directed to Le ( y ) antigen , difucosylated type 2 chain determinant , which has a close association with apoptosis , and to a monoclonal antibody directed to the proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
High stringency in situ hybridization was performed with DNA probes to the human papillomavirus ( types 6 / 11 ; 16 / 18 ; 31 / 33 / 35 ) and Epstein Barr virus : Immunocytochemical studies for the herpes simplex virus , proliferating cell nuclear antigen , cathepsin D , mutated p 53 , and c erbB 2 were performed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PT cell proliferation has been measured by staining for proliferating cell nuclear antigen ( PCNA ) and apoptosis by in situ detection of nuclear DNA fragmentation and correlated with serum biochemistry and PTH mRNA levels . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA ploidy and tumor proliferative activity ( derived from proliferating cell nuclear antigen , PCNA FCM expression ) were evaluated . ^^^ DNA ploidy and PCNA expression of the deep specimen of primary tumors were similar to those of the liver metastasis of the same patient while this concordance was not complete in the case of superficial biopsy specimens . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To promote progression towards DNA replication , CDK / cyclin complexes phosphorylate proteins required for the activation of genes involved in DNA synthesis , as well as components of the DNA replication machinery . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A G 1 arrest requires the activity of wild type p 53 , as it is not observed in cells lacking functionally wild type protein , and at least some component of S phase and G2 / M arrests is also thought to be p 53 dependent . p 53 functions as a transcription factor which binds specific DNA sequences , and recently major downstream targets have been identified , including p21Cip1 , an inhibitor of the cell cycle kinases that also blocks the replicative but not the repair function of DNA polymerase delta auxiliary factor , PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Senescent cells contain high amounts of p 21 , a potent cyclin dependent kinase inhibitor whose levels are also elevated in cells arrested in G 1 following DNA damage , suggesting that both arrests might share a common mechanism . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A transcriptional target of p 53 , Gadd 45 , was recently found to bind to PCNA , a component of DNA replication / repair complexes , thereby implicating Gadd 45 in DNA metabolism . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study , neuroblastoma tumours were analysed for cell proliferation , using antiproliferating cell nuclear antigen ( PCNA ) immunohistochemistry , and apoptosis , by morphology and in situ end labelling of fragmented DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin kinase inhibitor WAF1 / CIP1 , also termed CDKN 1 , mediates p 53 induced cell cycle arrest in response to DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The complete coding sequence of one member of this A like cyclin subgroup has been obtained by this RACE strategy and confirmed by PCR amplification and sequencing of alfalfa genomic DNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This is the case for proliferating cell nuclear antigen ( PCNA ) , a cofactor of DNA polymerase delta that is essential for the synthesis of the leading and lagging strands of DNA . ^^^ The expression of PCNA parallels the synthesis of DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Active cyclin B cdc 2 kinase does not inhibit DNA replication and can not drive prematurely fertilized sea urchin eggs into mitosis . ^^^ Feedback mechanisms preventing M phase occurrence before S phase completion are assumed to depend on inhibition of cyclin B cdc 2 kinase activation by unreplicated DNA . ^^^ These results together show that the inhibition of cyclin B cdc 2 kinase activation is probably not the only mechanism that prevents mitotic nuclear events from occurring as long as DNA replication has not been completed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The p 21 protein is a negative regulator of mammalian cell cycle progression that functions both by inhibiting cyclin dependent kinases ( CDKs ) required for the initiation of S phase , and by binding to and inhibiting the DNA polymerase delta co factor , proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
There were significant relations between the PCNA expression and mitotic karyorrhexis index ( MKI ) , histological classification , cell concentration , tumor weight , clinical stage , local invasion , lymph node metastasis , liver metastasis , or DNA ploidy . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the present study the prognostic value of proliferating cell nuclear antigen ( PCNA ) index and tumor DNA content were evaluated in 100 patients with renal cell carcinoma . ^^^ Proliferating cell nuclear antigen expression as a prognostic indicator for renal cell carcinoma : comparison with pathologic features and DNA content ] . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The examinations included routine histology , morphologic grading at the tumor front , immunohistochemical identification of the proliferation markers proliferating cell nuclear antigen ( PCNA ) and Ki 67 , and quantitative DNA analysis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein of DNA polymerase delta , and it is highly conserved among eukaryotes . ^^^ Proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein of DNA polymerase delta , and it is highly conserved among eukaryotes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA evaluation of cell proliferation in regenerating rat liver 0 48 h post partial hepatectomy showed that 3 43 % of cells stained positively for PCNA , a pattern closely correlating with previously reported rates of maximum DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We also discuss several of the antigen autoantibody systems found in systemic lupus erythematosus ( Smith antigen , U 1 nuclear ribonucleoprotein , SS A / Ro , SS B / La , proliferating cell nuclear antigen ribosomal ribonucleoprotein , double strand DNA , histones , antiphospholipids , Ku , Ki / SL ) , systemic sclerosis ( centromere , topo 1 , RNA polymerases , fibrillarin , polymyositis Scl , Th / To ) , polymyositis / dermatomyositis ( transferRNA synthetases , signal recognition particle , and others ) , and SS ( SS A / Ro , SS B / La , nucleolar organizing region 90 , p 80 coilin ) , addressing their clinical significance , common detection methods , immunogenetic associations , and the molecular and cellular biology of the cognate antigens . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The strong positivity for PCNA staining indicated that the capacity of the giant cells to synthesis DNA was preserved . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin B / p34cdc2 triggers phosphorylation of DNA ligase 1 during Xenopus laevis oocyte maturation . ^^^ Immunoprecipitated oocyte DNA ligase 1 is phosphorylated and its molecular mass modified by purified cyclin B / p34cdc2 in vitro . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Chem . , 265 ( 1990 ) 16402 16411 ] that the second mPol delta subunit , the 48 kDa protein , might play an important role in DNA Pol delta PCNA interaction . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA ploidy pattern , p 53 immunohistochemical overexpression and PCNA labeling index in `` single nodular ' ' human hepatocellular carcinomas from the viewpoint of biological malignant potential ] . ^^^ Nuclear DNA ploidy analysis , p 53 immunohistochemical overexpression and PCNA Labeling Index ( PCNA LI ) were studied in 80 cases of resected `` single nodular ' ' human hepatocellular carcinoma ( HCC ) tissue sections . ^^^ These results suggest that nuclear DNA ploidy analysis , p 53 immunohistochemical overexpression and PCNA LI were useful markers of biological malignant potentials in `` single nodular ' ' human HCCs . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A study on the relationship between clinicopathological findings of gastric cancer and its biological behavior such as DNA ploidy pattern and immunohistochemical staining of PCNA , laminin , p 53 and nm 23 ] . ^^^ The quantity of DNA ploidy and the expression of PCNA , laminin , p 53 and nm 23 by immunohistochemical stain were investigated using paraffin embedded specimens obtained from 135 gastric cancer patients , and were compared with clinicopathological findings . ^^^ Results : ( 1 ) The incidence of DNA high ploidy ( HP ) was significantly higher in such a case with infiltrating type ( INF ) and positive lymph node metastasis ( p+ ) compared with that of negative cases . ( 2 ) The high level of PCNA labeling index ( HLI ) , negative expression of laminin ( NEL ) and nm 23 ( NE 23 ) were more frequently observed in INF ; large tumor size , deep invasion and p+ , while positive p 53 was noted only in p+ cases . ( 3 ) The survival curve of HP , HLI , NEL , and NE 23 was significantly lower than that of the cases showing the reverse findings . ^^^ As a conclusion , it is suggested that the investigation of the DNA ploidy , PCNA , laminin , p 53 and nm 23 might be useful as a parameter of biological behavior for gastric cancer and the prognosis of gastrectomized patients . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Relationship between cellular DNA contents and cell proliferation of non small cell lung cancer estimated by simultaneous quantification of PCNA and DNA contents by flow cytometer ] . ^^^ Cellular DNA contents and proliferating cell nuclear antigen ( PCNA ) expression were studied in 273 fresh specimens from 65 surgically resected non small cell lung cancers ( adenocarcinoma 36 , squamous cell carcinoma 29 ) , and the relationship between the cellular DNA contents , especially the DNA ploidy pattern , and the cell proliferation was evaluated . ^^^ The cellular DNA content and PCNA labeling index ( LI ) % were assayed with flow cytometry using simultaneous double staining technique . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The response of gastric cancer to intravenous application of low dose CDDP plus 5 fluorouracil ( FP ) was assessed by changes in DNA indices ( DIs ) and PCNA labeling indices ( LIs ) by flow cytometry , and by the thymidylate synthetase inhibition rate ( TSIR ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It is known that the direct binding of the cyclin dependent kinase ( Cdk ) inhibitor p 21 , also called Cdk interacting protein 1 ( p 21 ) , to proliferating cell nuclear antigen ( PCNA ) results in the inhibition of PCNA dependent DNA synthesis . ^^^ We provide evidence that p 21 first inhibits the replication factor C catalyzed loading of PCNA onto DNA and second prevents the binding of DNA polymerase delta core to the PCNA clamp assembled on DNA . ^^^ On the other hand , an ability of the PCNA clamp to translocate along double stranded DNA was not affected by p 21 . ^^^ These data were confirmed with a mutant of p 21 that is unable to bind PCNA and therefore neither inhibited clamp assembly nor prevented the loading of DNA polymerase delta core onto DNA . ^^^ Mechanism of inhibition of proliferating cell nuclear antigen dependent DNA synthesis by the cyclin dependent kinase inhibitor p 21 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Of interest were reports that p21SDI1 also bound proliferating cell nuclear antigen ( PCNA ) , an auxiliary protein for DNA polymerase delta , and inhibited DNA replication but not DNA repair in vitro . ^^^ Interestingly , when we determined DNA synthesis inhibitory activity of deletion mutants or point mutants that were unable to bind Cdk 2 and / or PCNA , we found that loss of binding to PCNA did not affect inhibitory activity , whereas lack of Cdk 2 binding greatly reduced the same . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A and cdk 2 have been implicated in regulating DNA replication , and may be responsible for activating components of the DNA replication initiation complex on entry into S phase . ^^^ G 1 cell extracts used for in vitro replication contain the replication proteins RPA ( the eukaryotic single stranded DNA binding protein ) and DNA polymerase alpha as well as cdk 2 , but lack cyclin A . ^^^ On localizing these components in G 1 cells we find that both RPA and DNA polymerase alpha are present as nuclear proteins , while cdk 2 is primarily cytoplasmic and there is no detectable cyclin A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Double immunofluorescence studies of K 14 keratinocytes with proliferating cell nuclear antigen ( PCNA ) / cyclin antibodies , which react with the nuclei of cells engaged in DNA replication , showed partial colocalization of PCNA / cyclin foci and large uH2A clusters in about 14 % of the S phase cells , and these corresponded mainly to late S phase cells . ^^^ Inhibition of DNA replication with hydroxyurea resulted in an overall increase in the intensity of the uH2A staining as well as in a more clear colocalization of uH2A clusters and PCNA / cyclin foci . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We find that many of the genes encoding S phase acting proteins previously suspected to be E2F targets , including DNA polymerase alpha , thymidylate synthase , proliferating cell nuclear antigen , and ribonucleotide reductase , are indeed induced by E2F1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The saccharomyces cerevisiae proliferating cell nuclear antigen ( PCNA ) , encoded by the POL 30 gene , is essential for DNA replication and DNA repair processes . ^^^ Therefore , DNA repair requires interactions between repair specific protein ( s ) and PCNA , which are distinct from those required for DNA replication . . ^^^ A mutational analysis of the yeast proliferating cell nuclear antigen indicates distinct roles in DNA replication and DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The data indicate that while cell entrance to S phase is unrelated to expression of D type cyclins ( at the time of entrance ) , accumulation of cyclin E up to critical level is a prerequisite for initiation of DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Inhibition of cyclin dependent kinases by p 21 . p21Cip1 is a cyclin dependent kinase ( Cdk ) inhibitor that is transcriptionally activated by p 53 in response to DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using cell size and cyclin A and B levels as markers of cytoplasmic progression and DNA content as a measure of nuclear cell cycle position , we have examined coordination of cytoplasmic and nuclear events during induction synchrony . ^^^ Cyclin A and B were found at mitotic ( high ) or G 1 ( low ) levels , or in combination of high and low concentrations not correlated with DNA content in drug treated cells . ^^^ For example , treatment with mimosine , which arrests cells in G 1 with 2C DNA , resulted in cyclin A accumulating to mitotic levels , whereas cyclin B remained at a low concentration , the first time this phenomenon has been observed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In vitro PCNA is involved in both DNA repair synthesis and DNA replication , and the expression of PCNA mRNA is increased after UV irradiation . ^^^ Thus , it may be speculated that UV induced c Fos transcription factor may be linked to repair of photodamaged DNA and / or cell cycle progression by trans activating PCNA gene expression . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
CDDP had severely damaging effects on the DNA synthesizing activity of spermatogenesis , based on findings using monoclonal antibody proliferating cell nuclear antigen ( PCNA ) , compared with anti androgen agents . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Early events in DNA replication require cyclin E and are blocked by p21CIP1 . ^^^ Although cyclin E / Cdk2 is likely to be the major target by which p 21 inhibits the initiation of sperm DNA replication , p 21 can inhibit single stranded replication through a mechanism dependent on PCNA . ^^^ While the cyclin E / Cdk2 complex appears to have a role in the initiation of DNA replication , another Cdk kinase , possibly cyclin A / Cdk , may be involved in a later step controlling the switch from initiation to elongation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In cryostat sections of the perfusion fixed kidneys DNA synthesis was assessed by immunohistochemistry for BrdU , and for endogenous proliferating cellular nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , TGMV infection resulted in a significant accumulation of the host DNA synthesis protein proliferating cell nuclear antigen ( PCNA ) . ^^^ PCNA , an accessory factor for DNA polymerase delta , was not present at detectable levels in healthy differentiated cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The point in G 1 at which cells irrevocably commit to DNA synthesis is controlled by protein complexes consisting of cyclin dependent kinases ( CDK 4 or CDK 6 ) and cyclins ( D 1 , D 2 or D 3 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A induction was surprisingly more important in the upper third layers of differentiated cells together with large amounts of HPV DNA , than in proliferating basal and parabasal cells . ^^^ As for proliferating cell nuclear antigen ( PCNA ) , these results observed in vivo reveal that viral oncoproteins are able to reactivate cellular DNA replication machinery to support papillomavirus DNA replication in normally differentiated , non cycling cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
CDC44 / RFC1 is known to interact genetically with the gene encoding proliferating cell nuclear antigen , confirming previous biochemical evidence of their functional interaction in DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Incorporation of 5 bromodeoxyuridine ( BrdU ) at 7 and 14 days in the urothelium of KGF treated rats parallels PCNA immunoreactivity and confirms that KGF increases DNA synthesis in urothelial cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Nucleotide sequence of a human genomic DNA fragment containing the PCNA pseudogene and its localization on chromosome 4 . ^^^ A one kb human genomic DNA fragment , containing a processed pseudogene of a proliferating cell nuclear antigen ( PCNA / DNA polymerase delta auxiliary protein ) , was isolated and sequenced . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The primary tumors were examined immunohistochemically for expression of epidermal growth factor receptor ( EGFR ) , p 53 , cathepsin D , proliferating cell nuclear antigen ( PCNA ) , and Ki 67 specific antigen , and by flow cytometry for DNA ploidy cell cycle analysis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Recombinant PCNA stimulated human DNA polymerase delta activity at least 25 fold with poly ( dA ) / oligo ( dT ) as the template . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Based on the difference in time of degradation of cyclin A versus cyclin B 1 it was possible , in the present study , to discriminate between G 2 and mitotic ( postprophase ) MOLT 4 leukemic cells , by multiparameter ( cellular DNA content versus cyclin expression ) flow cytometry . ^^^ The cells arrested in G 2 by the DNA topoisomerase 2 inhibitor m AMSA had a very high level of cyclin B 1 expression and unchanged expression of cyclin A . ^^^ During stathmokinesis induced by Vinblastine the percentage of mitotic cells estimated by analysis of cellular DNA content and cyclin A expression was identical to that estimated by the alternative method based on in situ DNA denaturation followed by staining with acridine orange . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The prognostic significance of the cytophotometric DNA content and its relationship with the argyrophilic nucleolar organizer regions ( AgNOR ) and proliferating cell nuclear antigen ( PCNA ) in oesophageal cancer . ^^^ We examined the DNA pattern , AgNOR number and PCNA positive ratio ( PCNA ratio ) from biopsy specimens of oesophageal carcinoma , and attempted to identify any prognostic factors for oesophageal carcinoma . ^^^ These results suggest that the DNA pattern , AgNOR number and PCNA ratio may thus reflect the proliferative activity of tumours and therefore also offer the possibility of interdependence among these three factors . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA functions as a processivity factor for DNA polymerases delta and epsilon and is required for both DNA replication and nucleotide excision repair . ^^^ Previous studies have shown that p 21 inhibits simian virus 40 ( SV 40 ) DNA replication in HeLa cell extracts by interacting with PCNA . ^^^ In this report we show that p 21 blocks nucleotide excision repair of DNA that has been damaged by either ultraviolet radiation or alkylating agents , and that this inhibition can be reversed following addition of PCNA . ^^^ We further show that a peptide derived from the carboxyl terminus of p 21 , which specifically interacts with PCNA , inhibits polymerase delta catalyzed elongation of DNA chains almost stoichiometrically relative to the concentration of PCNA . ^^^ These results indicate that p 21 interferes with the function of PCNA in both in vitro DNA replication and nucleotide excision repair . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Unlike serum growth factors , E 7 induces S phase entry without activating cyclin D 1 gene expression , in keeping with the finding that cyclin D 1 function is not required in cells transformed by DNA tumor viruses . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The p 53 tumor suppressor protein binds DNA and activates the expression of a 21 kDa protein that inhibits both the activity of cyclin dependent kinases and the function of proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we report that FEN 1 physically interacts with proliferating cell nuclear antigen ( PCNA ) , the processivity factor for DNA polymerases delta and epsilon . ^^^ Through protein protein interactions , PCNA focuses FEN 1 on branched DNA substrates ( flap structures ) and on nicked DNA substrates , thereby stimulating its activity 10 50 fold but only if PCNA can functionally assemble as a toroidal trimer around the DNA . ^^^ This interaction is important in the physical orchestration of lagging strand synthesis and may have implications for how PCNA stimulates other members of the FEN 1 nuclease family in a broad range of DNA metabolic transactions . . ^^^ Lagging strand DNA synthesis at the eukaryotic replication fork involves binding and stimulation of FEN 1 by proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is essential for eukaryotic DNA replication and functions as a processivity factor of DNA polymerase delta ( pol delta ) . ^^^ Due to the functional and structural similarity with the beta subunit of Escherichia coli DNA polymerase 3 , it has been proposed that PCNA would act as a molecular clamp during DNA synthesis . ^^^ By site directed mutagenesis and biochemical analyses , we have studied the functional domains of human PCNA required for stimulation of replication factor C ( RF C ) ATPase and DNA synthesis by pol delta . ^^^ Nine basic amino acids that are essential for activating DNA synthesis by pol delta are positioned at the internal alpha helices of PCNA . ^^^ This result is in good agreement with the observation that PCNA has a ring structure similar to the beta subunit and clamps a template DNA through this positively charged internal surface . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The upregulation of these genes ' protein products is coupled with the appearance of PCNA , a proliferation specific nuclear antigen , as well as significant incorporation of BrdU , which may reflect DNA repair activity ; in situ analysis shows that BrdU positive cells are also positive for DNA fragmentation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 plays a critical role in the timing of the initiation of DNA synthesis in the normal cell cycle of mammalian cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Therefore , 23 EMP of the head and neck ( from 20 patients ) were studied to ( 1 ) compare a non isotopic paraffin section in situ hybridization technique for kappa and lambda mRNA with standard immunohistochemical techniques for assessing light chain expression , ( 2 ) compare the histologic grade to the proliferative fraction using an antibody for the proliferating cell nuclear antigen , and ( 3 ) determine the frequency of Epstein Barr virus ( EBV ) association using probes for the EBV DNA ( EBV NOT 1 ) and RNA ( EBER 1 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Five of the 22 cases studied showed 11q13 DNA amplification as well as increased levels of cyclin D 1 protein by Western blot and immunostaining . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In conclusion , PCNA immunohistochemistry with the 19A2 antibody after an appropriate antigen retrieval treatment may offer a useful alternative to DNA flow cytometry for the analysis of cell proliferation activity from formalin fixed , paraffin embedded breast carcinomas . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , also referred to as cyclin , is an auxiliary protein to DNA polymerase delta and a proposed marker of replicating cells . ^^^ Proliferating cell nuclear antigen ( PCNA ) , also referred to as cyclin , is an auxiliary protein to DNA polymerase delta and a proposed marker of replicating cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PRAD1 / cyclin D 1 proto oncogene : genomic organization , 5 ' DNA sequence , and sequence of a tumor specific rearrangement breakpoint . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Recent findings in the yeast Saccharomyces cerevisiae point to a potential link between the p34 / G1 cyclin protein kinase complex and the regulation of DNA replication genes during the cell cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In vitro studies using 3H thymidine uptake and dual parameter flow cytometric analysis of DNA and proliferating cell nuclear antigen showed that leukemic blast cells in S phase were increased after incubation with G CSF . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Human hepatoma cell lines Hep G 2 and Hep 3B were used to study the relation of PCNA gene expression and the DNA methylation . ^^^ Therefore , we conclude that DNA methylation is not involved in growth regulation of the PCNA gene expression . . ^^^ DNA methylation is not involved in growth regulation of gene expression of proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Information about a tissue ' s proliferative activity can be obtained from the immunocytochemical investigation of proliferating cell nuclear antigen ( PCNA ) , an auxiliary protein of DNA polymerase delta expressed by cycling cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study we define the proliferative compartments of in vivo human epidermis , using specific antibodies related to cell differentiation ( beta 1 and beta 4 integrins and K1 / K10 differentiation keratins ) and cell cycle ( proliferating cell nuclear antigen [ PCNA ] ) in combination with flow cytometric quantitation of the DNA content and optical characteristics of the cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Complete repair synthesis was achieved by combining these factors with DNA polymerase epsilon , RFC , PCNA , and DNA ligase 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Fibroblasts that have reached the end of their in vitro life span ( senescent cells ) express five fold higher levels of cyclin D 1 protein than low passage cells and individual cells in mass culture that fail to initiate DNA synthesis in response to serum addition have severalfold higher levels of this cyclin than proliferation competent cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cip 1 inhibits DNA replication but not PCNA dependent nucleotide excision repair . ^^^ BACKGROUND : DNA that is damaged by ultraviolet ( UV ) light is repaired predominantly by nucleotide excision repair , a process requiring the DNA polymerase auxiliary factor PCNA . ^^^ Cip 1 also directly inhibits the function of PCNA during DNA synthesis . ^^^ RESULTS : We show that nucleotide excision repair of UV damaged DNA occurs in extracts of Xenopus eggs , and that this reaction is PCNA dependent . ^^^ The repair reaction is not inhibited by Cip 1 , even when the level of PCNA is reduced 100 fold so that it becomes limiting for DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The precocious localization of PCNA in those eggs fertilized after maturation simply demonstrates that the ' postactivation process ' for preparing DNA replication is triggered by fertilization and PCNA localization and S phase are sequentially initiated with a time lapse . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA polymerase delta requires proliferating cell nuclear antigen and replication factor C to form a holoenzyme efficient in DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Nucleotide excision repair DNA synthesis by DNA polymerase epsilon in the presence of PCNA , RFC , and RPA . ^^^ Nucleotide excision repair DNA synthesis is dependent on proliferating cell nuclear antigen ( PCNA ) . ^^^ To study gap filling DNA synthesis during DNA nucleotide excision repair , UV damaged DNA was first incubated with PCNA depleted human cell extracts to create repair incisions . ^^^ DNA polymerase delta could perform repair synthesis and was strictly dependent on the presence of both PCNA and replication factor C , but gave rise to a very low proportion of complete , ligated circles . ^^^ DNA polymerase epsilon , on the other hand , could fill the repair patch in the absence of PCNA and replication factor C , and most of the products were ligated circles . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A conserved region in the amino terminus of DNA polymerase delta is involved in proliferating cell nuclear antigen binding . ^^^ Synthetic peptides to selected sequences in human DNA polymerase delta ( pol delta ) were used to identify the region involved in the interaction of pol delta to proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The DNA ploidy pattern was higher , and the levels of proliferating cell nuclear antigen labeling and argyrophilic nucleolar organizer regions count were significantly higher in tumor tissues with lymphatic invasion than in those without invasion . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The relationship between proliferating cell nuclear antigen ( PCNA ) , nuclear DNA content and mutant p 53 during genesis of cervical carcinoma . ^^^ Proliferating cell nuclear antigen ( PCNA ) , nuclear DNA content and mutant p 53 overexpression were studied by means of image cytometry and immunohistochemistry respectively in normal mucosa ( n = 10 ) , in mild ( n = 16 ) , moderate ( n = 9 ) and severe ( n = 17 ) atypical lesions , as well as in squamous cell carcinomas ( n = 36 ) of the cervix uteri . ^^^ Proliferating cell nuclear antigen ( PCNA ) , nuclear DNA content and mutant p 53 overexpression were studied by means of image cytometry and immunohistochemistry respectively in normal mucosa ( n = 10 ) , in mild ( n = 16 ) , moderate ( n = 9 ) and severe ( n = 17 ) atypical lesions , as well as in squamous cell carcinomas ( n = 36 ) of the cervix uteri . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Analysis of nuclear proteins demonstrated that rapamycin selectively blocked the expression of proliferating cell nuclear antigen ( PCNA ) , an obligate cofactor of DNA polymerase delta , an important component for DNA replication . ^^^ Using DNA binding gel mobility shift assay we demonstrated that rapamycin potently inhibited the binding of CREB / ATF transcription factors to CRE elements in the murine proximal PCNA promoter . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
No close association was noted between recurrence or clinical outcome and such factors as mitotic activity , PCNA proliferation indices , percent S phase determination , or DNA ploidy status . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA ploidy data were then compared with immunocytochemical staining for proliferating cell nuclear antigen ( PCNA ) . ^^^ In adenocarcinomas , the Dukes classification paralleled well the DNA ploidy status from stage A diploid to stage D aneuploid , but was not accompanied by increasing PCNA positive cell numbers . . ^^^ DNA ploidy and proliferating cell nuclear antigen in colonic adenomas and adenocarcinomas . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Stabilization of cyclin E and cdk 2 mRNAs at G1 / S transition in Rat 1A cells emerging from the G 0 state . mRNAs for cyclin E and Cdk 2 have a role in the commitment to DNA replication in the cell cycle , and are induced in Rat 1A cells by serum stimulation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have analyzed DNA content and proliferative activity in morphologically defined cell subpopulations of 74 non Hodgkin ' s lymphomas ( NHL ) and 29 reactive lymph nodes using DNA image cytometry and antibodies to proliferative markers ( proliferating cell nuclear antigen ( PCNA ) and Ki 67 ) . ^^^ DNA image cytometry and the expression of proliferative markers ( proliferating cell nuclear antigen and Ki 67 ) in non Hodgkin ' s lymphomas . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In mouse liver after 70 % partial hepatectomy , there was > 20 fold induction of cyclin D 1 mRNA and protein , beginning prior to peak DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Regulation of cyclin D 1 , DNA topoisomerase 1 , and proliferating cell nuclear antigen promoters during the cell cycle . ^^^ Cyclin D 1 , DNA topoisomerase 1 , and proliferating cell nuclear antigen ( PCNA ) are three important cell cycle regulatory proteins . ^^^ About 1 kb of 5 ' flanking region from either cyclin D 1 or DNA topoisomerase 1 gene is sufficient to confer G 1 or S phase specific transcription activity to chloramphenicol acetyltransferase ( CAT ) reporter genes , respectively . ^^^ Cyclin D 1 , DNA topoisomerase 1 , and proliferating cell nuclear antigen ( PCNA ) are three important cell cycle regulatory proteins . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Double label immunofluorescence against PCNA and BrdU clearly revealed several characteristics of DNA replication sites in synchronized CHO cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Tritium thymidine incorporation into liver DNA , liver mass restitution , mitotic index , and nuclear expression of proliferating cell nuclear antigen were determined as indexes of hepatic proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA ploidy and PCNA index in pancreatic lesions producing hyperinsulinemic hypoglycemia . ^^^ DNA nuclear content and PCNA index ( proportion of PCNA reactive cells ) have been studied by flow cytometry in eight pancreatic lesions producing hyperinsulinemic hypoglycemia to assess DNA ploidy and tumoral growth fraction . ^^^ The authors conclude that nuclear DNA and PCNA index cytometric studies are useful parameters to assess the biological behavior of pancreatic lesions producing hyperinsulinemic hypoglycemia . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
One in six primary human breast cancers has DNA amplification centered on the cyclin D 1 gene ( CCND 1 ) on chromosome 11q13 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Correlation of DNA ploidy , c erB 2 protein tissue status , level of PCNA expression and clinical outcome in gastric carcinomas ] . ^^^ But no correlation was formed between c erbB 2 tissue status , PCNA indices and DNA contents . ^^^ From these results , it can be concluded that DNA ploidy , c erbB 2 protein , and PCNA may reflect the malignant potential of gastric carcinoma . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The protein p 21 also binds to the DNA polymerase delta processivity factor , proliferating cell nuclear antigen ( PCNA ) , and inhibits in vitro PCNA dependent DNA replication . ^^^ When separately overexpressed in mammalian cells , the CDK and PCNA inhibitory domains prevent DNA replication , demonstrating a dual function of p 21 as a cell cycle inhibitor in vivo . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , p21Sdi1 has been found to inhibit DNA replication by direct interaction with proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
By using closed circular double stranded DNA or gapped circular DNA for protein DNA complex formation , the following results were obtained , ( 1 ) RF C can load PCNA in an ATP dependent manner directly on double stranded DNA , and no 3 ' OH ends are required for this reaction ; ( 2 ) the RF C PCNA complex assembled on closed circular DNA differs from those assembled on gapped or nicked circular DNA ; ( 3 ) the stable RF C PCNA complex can be assembled on circular but not on linear DNA ; and ( 4 ) only gapped DNA can partially retain the assembled RF C PCNA complex upon the linearization of the template . ^^^ We propose that RF C first binds unspecifically to double stranded DNA in the presence of ATP and then loads PCNA onto DNA to yield a protein complex able to track along DNA . ^^^ Mammalian DNA polymerase auxiliary proteins : analysis of replication factor C catalyzed proliferating cell nuclear antigen loading onto circular double stranded DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cell proliferation and cell death were tentatively monitored in tissue culture by PCNA staining , by viability testing and in situ end labeling of fragmented DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
N Acetylcysteine does not affect the immediate early pathway but can inhibit the TPA mediated induction of cyclin D 1 and DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Tissue regeneration response was measured by 3H thymidine ( 3H T ) incorporation into hepatocellular DNA and by proliferating cell nuclear antigen ( PCNA ) procedure during a time course ( 6 , 12 , 24 , 36 , 48 , 72 , and 96 hr ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) is a nuclear protein that leads DNA synthesis by the DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This retrospective study of primary gastric carcinomas was collected from one of the highest risk regions of China and examined for the oncogenetic expression of p 53 , c erbB 2 , and PCNA using immunohistochemistry and DNA contents by flow cytometry and image analysis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , an auxiliary protein of DNA polymerase delta , has recently been proposed as a marker of proliferation that is detectable in formalin fixed paraffin embedded tissue . ^^^ Proliferating cell nuclear antigen ( PCNA ) , an auxiliary protein of DNA polymerase delta , has recently been proposed as a marker of proliferation that is detectable in formalin fixed paraffin embedded tissue . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Addition of proliferating cell nuclear antigen to DNA polymerase delta and replication protein A to DNA polymerase alpha did not restore their capacity to elongate past the adduct . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It acts on Cdks in the G 1 and S phases of the cell cycle , and also binds to proliferating cell nuclear antigen ( PCNA ) , blocking DNA replication in vitro . ^^^ Remarkably , a 20 residue peptide containing this sequence inhibited replication of simian virus 40 ( SV 40 ) DNA in vitro and could capture PCNA from whole cell extracts , demonstrating that small molecules can retain the biological activity characteristic of the whole protein . ^^^ A small peptide inhibitor of DNA replication defines the site of interaction between the cyclin dependent kinase inhibitor p21WAF1 and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Identification of p 53 target genes through immune selection of genomic DNA : the cyclin G gene contains two distinct p 53 binding sites . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have examined the interaction between the DNA replication and repair protein PCNA , and the growth arrest and DNA damage induced protein Gadd 45 . ^^^ These data provide support for the notion that PCNA Gadd 45 interactions co ordinate cell cycle and DNA repair . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
SDS 11 is identical to SWI 6 , a transcriptional regulator of genes required for DNA replication and of cyclin genes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The transcriptional activity of p 53 induced by cyclin E was regulated at the level of DNA binding . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
As DNA replication and cytokinesis are tightly regulated in somatic cells by cyclins and cyclin dependent kinases , we sought to determine the pattern of cyclin gene expression in cells that undergo megakaryocytic differentiation and polyploidization . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Reinitiation of DNA replication during the G 2 phase of the mitotic cell cycle , therefore , is prevented by cyclin E / Dmcdc2c kinase independent regulation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Promoter regions of the Drosophila proliferating cell nuclear antigen ( PCNA ) gene and the DNA polymerase alpha 180 kDa catalytic subunit gene contain a common 8 base pair ( bp ) promoter element , 5 ' TATCGATA ( DRE , Drosophila DNA replication related element ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PARP alone inhibited the pol activities in a dose dependent manner even in the presence of the accessory factors for DNA pol delta , proliferating cell nuclear antigen ( PCNA ) and activator 1 ( Al ; RF C ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our studies provide evidence for the presence of cyclin D 1 in an early G 1 cycle specific DNA binding complex Yi 1 . ^^^ These various complexes contain DNA binding proteins ( Sp 1 , E2F , p 110 , p 60 ) , cyclins A and E , cyclin dependent kinase 2 ( cdk 2 ) , and retinoblastoma related proteins ( pRB , p 107 ) . ^^^ Yi 1 contains cyclin D1 / cdk2 kinase as shown by using specific antibodies to cyclins , cdks and the Yi 1 DNA binding protein in gel retardation , western blotting , and immunoprecipitation assays . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Moreover , treatment either with antisense oligodeoxynucleotides directed against cyclin D 2 mRNA or with genistein ( a tyrosine kinase inhibitor ) caused significant inhibition of [ 3H ] thymidine incorporation into DNA as well as inhibition of cyclin D 2 expression in normal 19 day fetal rat AEC . p34cdc2 ( but not p33cdk2 or p34cdk4 ) was expressed at progressively decreasing levels with corresponding histone H 1 kinase activities during rat AEC development ( 19 day fetal > 21 day fetal > 13 day postnatal > adult rat AEC ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We confirmed the S phase status of apoptotic cells by determining that detection of nuclear cyclin A in individual cells also corresponded with detection of DNA breakage . ^^^ Levels of cyclin E , cyclin E dependent H 1 histone kinase , and p 53 proteins were maintained during dispersion induced DNA cleavage . gamma radiation failed either to inhibit cell cycle progression or to raise p 53 levels in dispersed bursal lymphoblasts . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Unscheduled activation of cyclin B1 / Cdc2 kinase in human promyelocytic leukemia cell line HL 60 cells undergoing apoptosis induced by DNA damage . ^^^ The DNA polymerase inhibitor aphidicolin abrogates camptothecin induced changes in cyclin B1 / Cdc2 kinase activity , indicating that DNA replication induced DNA damage is essential for both Cdc 2 alterations and apoptosis activation . ^^^ The same transient activation and subsequent inactivation of cyclin B1 / Cdc2 kinase were observed after DNA damage by etoposide or bis ( 2 chloroethyl ) methylamine hydrochloride . ^^^ These observations suggest that DNA damage promotes the transient and unscheduled stimulation of cyclin B1 / Cdc2 kinase activity in HL 60 cells prior to apoptosis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA and PCNA content of renal cell carcinoma and prognosis . ^^^ The authors measured the DNA content and PCNA expression of 47 stage 1 or 2 renal carcinomas , and assessed the association of these measures with pathologic stage , nuclear grade , and clinical course . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Morphological atypism and clinicopathological factors in colorectal adenoma and cancer using nuclear DNA content , p 53 and PCNA ] . ^^^ Cytofluorometric analysis of DNA content and immunohistochemical examination of p 53 and PCNA were performed in colorectal adenomas , mainly borderline lesions , and cancers . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We also demonstrate that transient inappropriate coexpression of cyclin B with p34cdc2 induces DNA fragmentation in a heterologous cell type . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In exponentially growing cultures , TGF beta 1 blocked DNA synthesis and suppressed cyclin D 1 mRNA and protein expression , whereas the levels of cyclins D 2 , D 3 and Cdk 4 remained relatively unchanged . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA polymerase epsilon interacts with proliferating cell nuclear antigen in primer recognition and elongation . ^^^ Proliferating cell nuclear antigen can reduce this nonproductive effect by increasing the rate of primer binding by DNA polymerase epsilon . ^^^ Once the complex between DNA polymerase epsilon and the primer is formed , proliferating cell nuclear antigen can increase the rate of nucleotide incorporation . ^^^ The results suggested a dual role of proliferating cell nuclear antigen in stimulating the activity of DNA polymerase epsilon , namely , first to facilitate primer binding and second to stimulate the synthetic activity itself . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA content and expression of PCNA and p 53 in Hodgkin ' s disease and Hodgkin ' s like B cell lymphoma . ^^^ DNA ploidy ( by image cytometry ) and expression of proliferating cell nuclear antigen ( PCNA ) and p 53 tumor suppressor gene product ( by immunohistochemistry ) were investigated in 15 cases of Hodgkin ' s disease ( HD ) and 12 cases of HD like B cell lymphoma ( HD like NHL ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunohistochemical staining with anti proliferation cell nuclear antigen ( PCNA ) showed that PCNA positive nuclei of squamous cell carcinoma were more numerous , as compared with that in the neighboring pseudo epitheliomatous hyperplasia ( PEH ) and in normal skin , denoting markedly augmented assimilation of DNA in malignant degeneration . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
There was no association between PCNA , p 53 and the presence of HPV DNA subtypes . ^^^ Proliferating cell nuclear antigen but not p 53 or human papillomavirus DNA correlates with advanced clinical stage in renal cell carcinoma . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Against this background we investigated immunohistochemically overexpression of the interphase associated protein proliferating cell nuclear antigen ( PCNA ) and the mutant p 53 protein in routinely paraffin embedded surgical specimens from 180 breast cancer patients with known nuclear DNA profiles . ^^^ There was a direct association between high levels of PCNA expression ( > 20 % ) and p 53 protein overexpression ( p = 0 . 001 ) , high histologic tumor grade ( p = 0 . 009 ) , and DNA aneuploidy ( p = 0 . 019 ) . ^^^ Mutant p 53 protein overexpression was found in 44 of 180 ( 24 % ) cases and was significantly related to high histologic tumor grade ( p = 0 . 004 ) , DNA aneuploidy ( p = 0 . 001 ) , and high levels of PCNA expression ( p = 0 . 001 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Since PCNA staining has proven to be a useful indicator of cells involved in DNA synthesis and repair , the pattern of PCNA staining in the ovary was compared to previous studies which used tritiated thymidine labeling as a marker for DNA synthesis . ^^^ As these cells are undergoing meiotic recombination , the presence of PCNA in these meiotic prophase cells could reflect a second function of PCNA , that of DNA excision repair . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cip 1 blocks the initiation of DNA replication in Xenopus extracts by inhibition of cyclin dependent kinases . ^^^ Cip 1 inhibition of DNA replication was fully rescued by addition of cyclins A or E , but not cyclin B , cdk 2 or PCNA . ^^^ CONCLUSIONS : Our results suggest that Cip 1 specifically blocks the initiation of DNA replication by inhibition of a cyclin dependent kinase ( cdk 2 ) , but has no major effect on the elongation of preassembled replication forks . ^^^ Cip 1 has also been shown to inhibit the DNA polymerase delta auxiliary factor PCNA ( proliferating cell nuclear antigen ) , which is required for replication fork elongation , and this could be an alternative mechanism by which p 53 induced Cip 1 blocks cell proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Although no correlation existed between recurrence and DNA ploidy , percent S phase determinations , proliferation marker ( PCNA , MIB 1 ) staining , or the frequency of p 53 immunoreactivity , a statistically significant correlation ( P < 0 . 001 ) was observed , however , between recurrence and mitotic indices . ^^^ The significance of mitotic index , proliferative marker staining ( proliferating cell nuclear antigen and MIB 1 ) , immunochemical p 53 expression , and DNA ploidy were assessed relative to tumor behavior , particularly recurrence . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Prefixing either cell line in a range of concentrations ( 0 . 25 1 . 0 % ) of paraformaldehyde also resulted in reduced intensity of PCNA and p 120 fluorescence along with increased DNA c . v . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study , we compared Ki 67 and PCNA expression in 93 malignant solid neoplasms using bivariate flow cytometric analysis of these antigens and DNA content . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results indicate that mutant p 53 differs from proliferative markers such as PCNA , Ki 67 and DNA polymerase alpha , and that there are no links between the expression of p 53 and the cell cycle in A 431 cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
S phase autoantibodies are represented by autoantibodies to PCNA ( Proliferating Cell Nuclear Antigen ) , the auxiliary protein of DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In line with these predictions , DNA tumour virus oncoproteins do not disrupt cyclin D 1 Cdk4 complexes in cells lacking p16 . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Analysis of DNA content and cyclin protein expression in studies of DNA ploidy , growth fraction , lymphocyte stimulation , and the cell cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Morphometric , DNA , and proliferating cell nuclear antigen ( PCNA ) measurements were taken of benign melanocytic tumors and malignant melanomas . ^^^ Significant differences between lesion groups according to Krushell Wallis analysis were found in terms of mean nuclear area , coefficient of variation ( cv ) of nuclear area , cv of nuclear shape nuclear contour index ( NCI ) , mean and cv of nucleolar area , DNA 2 . 5 c and 5 c exceeding rates , and PCNA positivity . ^^^ Larger values for nuclear area , DNA aneuploidy , and PCNA positivity were found in thick malignant melanomas and melanoma metastases than in benign melanocytic lesions and thin malignant melanomas . ^^^ Morphometry , DNA content , and PCNA positivity thus seem to reflect different stages in tumor progression of malignant melanoma . . ^^^ Morphometric , DNA , and proliferating cell nuclear antigen measurements in benign melanocytic lesions and cutaneous malignant melanoma . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Relationship between cellular DNA synthesis , PCNA expression and sex steroid hormone receptor status in the developing mouse ovary , uterus and oviduct . ^^^ The proliferative activities of the different cellular compartments of the developing mouse ovary , uterus , and oviduct were studied by radioautographic assessment of DNA synthesis with [ 3H ] thymidine labeling and by immunohistochemical staining of proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we report that when thapsigargin was introduced to serum stimulated human fibroblasts at a time point just before the G1 / S boundary , it completely inhibited expression of cyclin A , activation of p33CDK2 cyclin dependent kinase and initiation of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In vitro experiments with mitogen and alloantigen stimulated murine lymph node cells ( LNC ) and human peripheral blood mononuclear leukocytes ( PBML ) revealed a good correlation of total [ 3H ] thymidine incorporation into DNA and expression of PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Transforming growth factor ( TGF beta ) stimulated induction of DNA synthesis is preceded by the activation of cyclin E / cyclin dependent kinase ( cdk ) 2 kinase in late G 1 in C3H 10T1 / 2 mouse fibroblasts . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
For example , cyclin D 1 can be activated by chromosomal translocation , DNA amplification and retroviral integration . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA staining , and DNA content in follicular neoplasms of the thyroid gland . ^^^ One of the two adenomas showing positive p 53 nuclear staining was DNA aneuploid , and both were positive in PCNA staining , but their SPFs were low ( 2 . 1 and 3 . 3 per cent ) . ^^^ Because both follicular adenomas and carcinomas may be DNA aneuploid and their SPF and PCNA staining distributions overlap , the distinction between follicular adenoma and carcinoma should still be based on histological criteria . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
One of these is the cyclin Cdk family of kinases and the other is the essential DNA replication factor , proliferating cell nuclear antigen ( PCNA ) . ^^^ The PCNA binding domain is sufficient for inhibition of DNA replication based on simian virus 40 , whereas the Cdk 2 binding domain is sufficient for inhibition of DNA replication based on Xenopus egg extract and for growth suppression in transformed human cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Recently , antibodies have been developed that identify two proteins directly involved with DNA synthesis : Ki 67 protein and proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
There was a direct association between PCNA expression , high histological tumour grade ( p < 0 . 01 ) , and DNA aneuploidy ( p = 0 . 009 ) . ^^^ In a subgroup of 22 patients with near diploid DNA distribution patterns the PCNA expression yielded additional prognostic information . ^^^ Patients with tumours of near diploid DNA histograms and more than 20 % of PCNA immunoreactive neoplastic cells had a significantly worse clinical course , than patients with near diploid tumours containing less than 20 % PCNA immunoreactive cells ( p = 0 . 0001 ) . ^^^ The combined assessment of the PCNA immunoreactivity and of the nuclear DNA content in routinely processed surgical specimens of breast cancer patients appears to be of prognostic value . . ^^^ Prognostic value of the combined assessment of proliferating cell nuclear antigen immunostaining and nuclear DNA content in invasive human mammary carcinomas . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This inhibition , by TGF beta 1 , of the TSH and cAMP dependent DNA synthesis was associated with an inhibition of PCNA ( proliferating cell nuclear antigen ) synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To investigate the correlation between human papillomavirus ( HPV ) infection and cell proliferative activity in uterine cervical adenocarcinoma , in situ hybridization of HPV DNA and immunostaining of proliferative cell nuclear antigen ( PCNA ) were performed on serial sections of the carcinoma . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The AgNOR technique , PCNA immunohistochemistry , and DNA ploidy in the evaluation of choroid plexus biopsy specimens . ^^^ The authors performed the silver nucleolar organizer region ( AgNOR ) technique , immunohistochemistry for proliferating cell nuclear antigen ( PCNA ) , and DNA ploidy analysis by flow cytometry on 9 samples of normal choroid plexus , 8 papillomas , and 13 carcinomas to evaluate whether these techniques can aid in these differential diagnoses . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Nuclear DNA content , proliferating cell nuclear antigen ( PCNA ) and p 53 immunostaining in predicting progression of laryngeal cancer in situ lesions . ^^^ In the search for markers able to foretell clinical outcome , we performed image DNA cytometry ( ICM ) and immunohistochemical staining for PCNA as well as p 53 in 38 laryngeal CIS lesions , of which 9 progressed to invasive cancer . ^^^ The majority of the CIS lesions displayed high grade DNA aberration , a high PCNA positive rate , and every third lesion was p 53 positive by immunostaining . ^^^ The lesions which progressed to invasive cancer showed a clear tendency towards more pronounced DNA aberration , a higher percentage of intense PCNA staining and more frequent p 53 positivity . ^^^ By combining the results from the analyses of DNA , PCNA and p 53 in a prognostic index for each individual case , we correctly classified 82 % of the lesions as progressors or non progressors . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The simple repeating pattern of the chain fold allows a connection to be made to the as yet unknown structures of eukaryotic proliferating cell nuclear antigen and the gene 45 protein of bacteriophage T 4 , which are the processivity factors of the corresponding DNA polymerases . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Morphometric , DNA and PCNA in thin malignant melanomas . ^^^ Morphometric assessment of nuclear area , shape and density , nucleolar area , analysis of DNA content and expression of proliferating cell nuclear antigen ( PCNA ) was performed in a case control study of 72 malignant melanomas , thickness < or = 0 . 8 mm and Clark level 2 3 . ^^^ No significant differences were found regarding nuclear or nucleolar area , mean nuclear shape NCI , nuclear DNA content or expression of PCNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a component of DNA polymerase delta and is another important cell proliferation marker manifesting a striking increase in concentration during the S phase of the cell cycle . 19A2 and PC 10 are two different monoclonal antibodies which can be employed to detect PCNA in paraffin embedded tissues . 4 . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a component of DNA polymerase delta and is another important cell proliferation marker manifesting a striking increase in concentration during the S phase of the cell cycle . 19A2 and PC 10 are two different monoclonal antibodies which can be employed to detect PCNA in paraffin embedded tissues . 4 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferative activity of four malignant cellular blue nevi ( MCBN ) was assessed in routinely fixed , paraffin embedded material using staining for the argyrophilic nucleolar organizer regions ( AgNORs ) , immunohistochemical staining for proliferating cell nuclear antigen ( PCNA [ PC 10 ] ) , and DNA flow cytometry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Flow cytometric analyses of DNA content , BrdU labeling , Ki 67 , PCNA , and statin expression . ^^^ In this work , flow cytometry of DNA and of bromodeoxyuridine labeling and the evaluation of the cell cycle related antigens Ki 67 , PCNA , and statin were used to investigate the changes in the proliferation kinetics of MCF 7 cells before and after treatment with 10 ( 7 ) M TAM . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In all , 46 foci of cellular alteration ( FCA ) , three regions of adenomatous hyperplasia ( ADH ) , and 21 small hepatocellular carcinomas ( sHCC ) were studied by published criteria for sHCC and by the proliferative activity of the lesions as examined with monoclonal antibodies against DNA polymerase alpha and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
As a sequel of this pathomechanism , an undue overexpression of PCNA and Ki 67 has to be assumed , that is not necessarily associated with DNA synthesis or cell cycling . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Flow cytometric analysis of the expression of PCNA during the cell cycle in HeLa cells and effects of the inhibition of DNA synthesis on it . ^^^ Flow cytometric bivariate DNA / PCNA analysis was performed to investigate the expression of PCNA during the cell cycle and the implication in DNA replication in HeLa cells , using a monoclonal antibody ( PC 10 ) to PCNA . ^^^ However , the treatment with Triton 10 100 extracted 80 89 % of total PCNA from the cells , resulting in the dramatic change of bivariate DNA / PCNA distribution pattern . ^^^ The bivariate DNA / PCNA distribution pattern in cells treated with Triton 10 100 was strikingly so similar to the DNA / BrdUrd distribution pattern that it was unable to differentiate one from the other . ^^^ The inhibition of DNA synthesis with 10 mM hydroxyurea elevated cellular PCNA content mainly due to the increase in the fraction of the detergent extractable PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Results of quantitative DNA measurements and PCNA scores were compared to clinical symptoms , histology , and time between first onset of symptoms and diagnosis of the tumor . ^^^ In addition , the PCNA scores were higher in these tumors , indicative of increased DNA synthesis . ^^^ No correlation was found between the results of the DNA analysis and the PCNA score , or the clinical data and the predominant histologic subtype . ( ABSTRACT TRUNCATED AT 250 WORDS ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein of DNA polymerase delta and is considered to correlate with the cell ' s proliferative state . ^^^ Proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein of DNA polymerase delta and is considered to correlate with the cell ' s proliferative state . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The expression of the chloramphenicol acetyltransferase gene under control of the 1152 base pair 5 ' flanking region ( 1107 to +45 nucleotide positions with respect to the major transcription initiation site ) of the Drosophila DNA polymerase alpha gene was repressed by cotransfection into Drosophila Kc cells with a zerknllt ( zen ) expressing plasmid as previously observed with the proliferating cell nuclear antigen ( PCNA ) gene promoter . ^^^ The expression of the zen resulted in reduction of the abundance of mRNA for the transfected chloramphenicol acetyltransferase gene and also mRNAs for both DNA polymerase alpha and PCNA . ^^^ Results obtained using various deletion derivatives of the promoter region and chemically synthesized oligonucleotides of the DNA replication related element ( DRE ) , a positive cis acting element found in both DNA polymerase alpha and PCNA genes , revealed that the DRE sequences are responsible to repression by Zen protein . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In 120 to 150 g female Sprague Dawley rats , we measured the effects of rhGH and rhIGF 1 and their combination by the following parameters : kidney weight / body weight ratio , DNA / protein ratio , mRNA of GH receptor and of IGF 1 , mitosis index and PCNA ( by immunohistology ) , zonal architecture and glomerular diameter by micromorphometry . ^^^ Addition of high doses of rhGH to high doses of rhIGF 1 caused no further increase of the ratio despite a significant further increase of body weight . rhGH increased the abundance of renal GH receptor mRNA ( 0 . 46 + / 0 . 32 amol / microgram DNA vs . 0 . 08 + / 0 . 07 in controls ) and of IGF 1 mRNA ( 1 . 35 + / 0 . 5 pg / micrograms DNA vs . 0 . 35 + / 0 . 17 ) , whereas no change was seen with IGF 1 treatment . rhGH and rhIGF 1 increased kidney DNA / protein ratio , mitoses and PCNA expression in various renal structures . ( ABSTRACT TRUNCATED AT 250 WORDS ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study , genomic instability , cell proliferation , and cellular accumulation of mutant p 53 , as reflected by DNA aneuploidy , proliferating cell nuclear antigen , and p 53 immunoreactivity , respectively , were evaluated in bronchial squamous metaplasia without atypia ( n = 4 ) , bronchial squamous metaplasia with low grade atypia ( n = 12 ) , bronchial squamous metaplasia with high grade atypia ( n = 15 ) , early stage SCC ( n = 15 ) , and advanced stage SCC ( n = 33 ) . ^^^ We conclude that routine assessment of proliferating cell nuclear antigen , DNA ploidy , and p 53 may be valuable for the early diagnosis of SCC . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen expression , [ 3H ] thymidine incorporation into DNA , and liver thymidine kinase activity exhibited marked oscillations during the liver regenerative process . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen is a nuclear protein essential to DNA synthesis in eukaryotic cells . ^^^ We define in this analysis the interval of proliferating cell nuclear antigen binding to DNA ( strictly speaking , the interval through which proliferating cell nuclear antigen is stained immunohistochemically after ethanol fixation ) with respect to the stages of the cell cycle in the intact mammalian brain . ^^^ Proliferating cell nuclear antigen DNA binding in this epithelium is initiated in the final 5 % ( 26 min ) of G 1 phase and continues through the initial 35 % ( 1 . 3 h ) of S phase . ^^^ This phasic pattern of proliferating cell nuclear antigen DNA binding , as revealed for the first time in the intact cerebral wall , approximates closely the phasic pattern as it has been characterized until now only in vitro in vertebrate cell lines . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The effect of calf thymus proliferating cell nuclear antigen ( PCNA ) on wheat polymerases was studied as described for animal DNA polymerases . ^^^ The high processivity of DNA polymerase A was PCNA independent , whereas both enzyme activity and processivity of wheat DNA polymerases B and CII were significantly stimulated by PCNA . ^^^ On the other hand , DNA polymerase CI was not stimulated by PCNA and , like animal DNA polymerase beta , was distributive in all cases . ^^^ Mammalian proliferating cell nuclear antigen stimulates the processivity of two wheat embryo DNA polymerases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This finding indicates that DNA synthesis related , Ki 67 antigen bearing structures can be raised in the human nucleus in the absence of induction of PCNA bearing structures , suggesting also structural independence between the antigen bearing molecules . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Previously constructed Swiss mouse 3T3 fibroblasts producing polyomavirus large T antigen after addition of dexamethasone were used to study the transcriptional activation by the viral protein of five genes coding for enzymes involved in DNA synthesis and precursor production , namely , dihydrofolate reductase , thymidine kinase , thymidylate synthase , DNA polymerase alpha , and proliferating cell nuclear antigen . ^^^ Although there is so far no evidence that thymidylate synthase and proliferating cell nuclear antigen are regulated via E2F , our data indicate that the retinoblastoma protein still is involved in the control of these genes . mRNA for E2F itself increases in amount at the G1 / S border in serum stimulated cells but not during polyomavirus T antigen induced transcriptional activation of DNA synthesis enzymes in arrested cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The impact of EGFR staining on patient survival was compared with tumor stage , histologic grade , immunoreactivity for c erb B 2 and proliferating cell nuclear antigen , flow cytometrically determined S phase fraction and DNA ploidy , abnormal expression of blood group related antigens , and patient blood type . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
MIB 1 , Ki 67 , and PCNA scores and DNA flow cytometry in intermediate grade malignant lymphomas . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In comparison , PCNA immunoreactivity persisted for a much shorter period in small intestinal cells that had stopped DNA replication when moving from the crypt towards the villus . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our discovery that mus 209 encodes proliferating cell nuclear antigen ( PCNA ) , which is an indispensable component of the DNA replication apparatus , suggests that alterations to chromosome replication may underlie that pleiotropy . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin binding of the chimeric protein of the N terminal ( residues 1 68 ) or the C terminal ( residues 195 261 ) region of PCNA and rat DNA polymerase beta which does not bind to the cyclins by itself supports this notion . ^^^ Proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein for DNA polymerase delta and is required for both DNA replication and DNA repair . ^^^ This is apparently the first report on the structure function relationship of PCNA which may link DNA replication and DNA repair with cell cycle control . . ^^^ Proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein for DNA polymerase delta and is required for both DNA replication and DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , an auxiliary protein of DNA polymerase delta , associated with DNA synthesis , is increasingly used to determine tumor growth rate . ^^^ No correlation was found between PCNA positivity and tumor grade and DNA ploidy in tumors analyzed . ^^^ Proliferating cell nuclear antigen ( PCNA ) , an auxiliary protein of DNA polymerase delta , associated with DNA synthesis , is increasingly used to determine tumor growth rate . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A / cdk2 complexes are involved in the onset of DNA replication whereas cyclin B / cdc2 trigger mitosis . ^^^ We report here that Ca2+ and calmodulin regulate the expression of cdk 2 , cdc 2 , cyclin B and the proliferating cell nuclear antigen ( a co factor of DNA polymerase delta ) in human T lymphocytes . ^^^ Likewise , the expression of cdk 4 , cyclin A and DNA polymerase alpha is dependent of the synergistic effect of both the Ca2+ / calmodulin and the protein kinase C pathways . ^^^ Thus , calmodulin controls DNA synthesis by regulating the levels of cdk 2 and proliferating cell nuclear antigen and mitosis entry by modulating the expression of cyclin B and cdc2 . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A plasmid carrying the 5 ' flanking region of the mouse proliferating cell nuclear antigen ( PCNA ) gene or DNA polymerase beta gene was fused with the chloramphenicol acetyltransferase ( CAT ) gene , then cotransfected into mouse N18TG2 cells with the expression plasmid for the p 53 gene . ^^^ Expression of the wild type p 53 repressed the CAT expression directed by the PCNA gene promoter , while it had little effect on the DNA polymerase beta gene promoter . ^^^ Differential effect of p 53 on the promoters of mouse DNA polymerase beta gene and proliferating cell nuclear antigen gene . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The prognostic value of tumor proliferative indices in meningiomas was assessed by mitotic counts and by immunocytochemistry using a monoclonal antibody against the proliferating cell nuclear antigen ( PCNA ) ( clone 19A2 ) , a 36 kd nuclear protein involved in DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) expression and nuclear DNA content in predicting recurrence after radiotherapy of early glottic cancer . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a DNA replication protein maximally elevated in late G 1 and S phases of the cell cycle . ^^^ Both PCNA and DNA analysis can be performed on histological sections from paraffin embedded biopsies . ^^^ In search of efficient and reproducible methods to identify early glottic cancers with increased risk for recurrence after radiotherapy , the PCNA expression as well as the DNA content of the diagnostic biopsies from 28 T1N0M0 glottic cancers were assessed . ^^^ The group of tumours which recurred locally after radiotherapy displayed lower PCNA expression and higher DNA aberration than the group of tumours which were cured . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Significant differences of values were also found between pTa and invasive tumours ( p < 0 . 0001 for AgNOR count and PCNA score ; p < 0 . 001 for MIB 1 score and mean nuclear area ; p < 0 . 01 for DNA ploidy ) ; however many overlaps were seen . ^^^ Argyrophilic nucleolar organizer region ( Ag NOR ) analysis , proliferating cell nuclear antigen ( PC NA / PC10 ) and MIB 1 immunohistochemistry , nuclear morphometry and DNA flow cytometry have been performed on formalin fixed , paraffin embedded biopsies from 50 patients with transitional cell carcinoma of the urinary bladder . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A polymerase switching mechanism requiring replication factor C and the proliferating cell nuclear antigen allows two molecules of DNA polymerase delta to replicate both strands of the double helix conjointly . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have used antibodies specific for either polymerase delta ( pol delta ) or its accessory protein , proliferating cell nuclear antigen ( PCNA ) , to demonstrate that they can markedly inhibit the capacity of HeLa nuclear extracts to effect repair of UV damaged plasmid DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) gene encodes an auxiliary factor of DNA polymerase delta and functions in DNA replication during S phase . ^^^ With a gel mobility shift assay , several IL 2 inducible DNA protein complexes were detected , including CREB ( CRE binding ) and ATF 1 ( activating transcription factor ) proteins that are specific for the PCNA CRE sequence . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
When the PCNA LRs and clinicopathologic parameters were entered into the Cox regression analysis , PCNA LRs and DNA ploidy emerged as independent significant prognostic factors . ^^^ In addition , combination assay of PCNA LRs and DNA ploidy yielded a powerful prognostic indication for patients with gastric cancer . . ^^^ Prediction of lymph node metastasis and prognosis from the assay of the expression of proliferating cell nuclear antigen and DNA ploidy in gastric cancer . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The DNA synthesis activities of hepatocytes in primary biliary cirrhosis ( PBC ) and other chronic liver diseases and control subjects were examined by staining proliferating cell nuclear antigen ( PCNA ) with anti PCNA monoclonal antibody . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The p 21 inhibitor of cyclin dependent kinases controls DNA replication by interaction with PCNA . ^^^ In normal human cells , but not in many tumour cells , p 21 exists in a quaternary complex with a cyclin , a CDK , and the proliferating cell nuclear antigen ( PCNA ) . p 21 controls CDK activity , thereby affecting cell cycle control , whereas PCNA functions in both DNA replication and repair . ^^^ Here we use simian virus 40 DNA replication in vitro to show than p 21 directly inhibits PCNA dependent DNA replication in the absence of a cyclin / CDK . ^^^ Furthermore , p 21 blocks the ability of PCNA to activate DNA polymerase delta , the principal replicative DNA polymerase . ^^^ Thus , during p 53 mediated suppression of cell proliferation , p 21 and PCNA may be important for coordinating cell cycle progression , DNA replication and repair of damaged DNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The DNA ploidy pattern and the expression of proliferating cell nuclear antigen ( PCNA ) were investigated in 72 gastric carcinoma patients to determine the possible correlation between proliferation kinetics and biological behavior . ^^^ Furthermore , DNA ploidy pattern and PCNA labelling index may be useful as a parameter of depth of invasion . . ^^^ Nuclear DNA ploidy pattern and proliferating cell nuclear antigen labeling index in gastric cancer with mucosal involvement ] . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We compared histological effects following radiotherapy in relation to the DNA ploidy pattern and the proliferating cell nuclear antigen ( PCNA ) positivity rate in 37 patients with rectal cancer who underwent preoperative radiation therapy . ^^^ We suggest that cases in which the PCNA positivity rate is more than 55 % with diploid DNA pattern would show most effect . ^^^ The effects of irradiation could be predicted with biopsy materials and by measuring the DNA ploidy pattern and the PCNA positivity rate . . ^^^ DNA ploidy and proliferating cell nuclear antigen positivity rate as predictive indication of effectiveness of preoperative radiation ] . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Antiproliferating cell nuclear antigen ( PCNA ) antibodies were used to study DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this report we demonstrate that during mid late S phase , nuclear foci detected with lamin B antibodies are coincident with sites of DNA replication as detected by the colocalization of sites of incorporation of bromodeoxyuridine ( BrDU ) or proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In keeping with the hypothesis that viral DNA amplification is associated with the induction of a cellular S phase , we observed a specific induction of expression of two cell proliferation related cellular antigens ( PCNA and Ki 67 ) in a subpopulation of permissive cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , an endogenous cell replication marker , and bromodeoxyuridine ( BrdU ) , an exogenously administered DNA precursor label , were detected in formalin fixed , paraffin embedded tissues using immunohistochemical techniques . ^^^ Proliferating cell nuclear antigen ( PCNA ) , an endogenous cell replication marker , and bromodeoxyuridine ( BrdU ) , an exogenously administered DNA precursor label , were detected in formalin fixed , paraffin embedded tissues using immunohistochemical techniques . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This response can be ascertained as labeling indexes ( LI ; percentage of cells in S phase ) after the administration of the DNA precursor labels ( tritiated thymidine ; 3H TdR ; bromodeoxyuridine , BrdU ) or through immunostaining of the endogenous cell replication marker , proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
After illumination , sites of DNA repair were labeled by means of a monoclonal antibody against proliferating cell nuclear antigen ( PCNA ) bound in the nuclei . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
OH scavenger ( Na benzoate ) therapy , given at the time of renal ischemia , alters the extent of : ( 1 ) tubular necrosis and filtration failure ; ( 2 ) DNA fragmentation / apoptosis ( assessed in situ by terminal deoxynucleotidyl transferase reactivity ) ; ( 3 ) early tubular regenerative responses ( proliferating cell nuclear antigen expression ; ( 3H ) thymidine incorporation ) ; and ( 4 ) the rate and / or degree of functional and morphologic repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , the auxiliary protein for DNA polymerase delta , is one of the key factors for both PCNA dependent DNA synthesis and cell cycle progression . ^^^ Rice PCNA fusion protein was found to stimulate DNA synthesis catalyzed by DNA polymerase delta from human cells ( although much less effectively ) , while having no effect on DNA polymerase alpha activity . ^^^ The results indicate that plant PCNA functions as one of the cofactors of DNA synthesis as is the case with other eukaryotes . . ^^^ Proliferating cell nuclear antigen ( PCNA ) , the auxiliary protein for DNA polymerase delta , is one of the key factors for both PCNA dependent DNA synthesis and cell cycle progression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunohistochemical techniques for the study of the proliferating cell nuclear antigen ( PCNA ) and incorporation of 5 bromo 2 ' deoxyuridin during DNA synthesis were also done . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) is required for DNA replication and DNA nucleotide excision repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is the component of the chromosomal DNA replication machinery in eukaryotic cells that confers high processivity upon DNA polymerase delta and epsilon . ^^^ It has been proposed that PCNA functions by forming a trimeric complex with a ring like structure through which DNA is threaded . ^^^ Proliferating cell nuclear antigen ( PCNA ) is the component of the chromosomal DNA replication machinery in eukaryotic cells that confers high processivity upon DNA polymerase delta and epsilon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using a series of column chromatography procedures to fractionate 10 . laevis ovarian extracts , we developed a reconstituted system of tetrahydrofuran repair with five fractions , three of which were purified to near homogeneity : proliferating cell nuclear antigen ( PCNA ) , AP endonuclease , and DNA polymerase delta . ^^^ DNA polymerase beta was able to replace DNA polymerase delta only for repair of natural AP sites in a reaction that did not require PCNA . ^^^ This result indicates that AP sites can be repaired by two distinct pathways , the PCNA dependent pathway and the DNA polymerase beta dependent pathway . . ^^^ Proliferating cell nuclear antigen dependent abasic site repair in Xenopus laevis oocytes : an alternative pathway of base excision DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Both replication factor C and proliferating cell nuclear antigen were absolutely required and sufficient for assembly of DNA polymerase delta holoenzyme complex on DNA . ^^^ The linearization of the circular DNA template resulted in three dramatic effects : ( 1 ) DNA synthesis by DNA polymerase delta holoenzyme was abolished , ( 2 ) the inhibition effect of replication factor C and proliferating cell nuclear antigen on DNA polymerase alpha was relieved and ( 3 ) DNA polymerase epsilon could not form any longer a holoenzyme with replication factor C and proliferating cell nuclear antigen . ^^^ The comparison of the effect of replication factor C and proliferating cell nuclear antigen on DNA polymerases alpha , delta and epsilon indicated that the auxiliary proteins appear to form a mobile clamp , which can easily slide along double stranded DNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We compared the expression of p 53 with the clinicopathological features , proliferating cell nuclear antigen ( PCNA ) , and DNA ploidy . ^^^ Relatively larger diameter tumors ( more than 5cm ) , poorly differentiated tumors , tumors with distant lymph node metastasis , and DNA aneuploidy tumors were positive for p 53 more frequently . p 53 positive cases had a higher PCNA labeling index and a poorer prognosis than p 53 negative cases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferative activity of human gastric carcinoma was measured by means of in vitro incorporation of the thymidine analogue , 5 bromo 2 ' deoxyuridine ( BrdU ) , into the newly synthesized DNA of fresh tumors and immunohistochemical staining of proliferating cell nuclear antigen ( PCNA ) using avidin biotin peroxidase method . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Positive PCNA staining was significantly correlated with stage , cellularity , and DNA index . ^^^ Calculation of logistic regression coefficients indicated an association between overall survivals and tumor cellularity ( P < 0 . 0003 ) , percentage of cells stained with PCNA antibody ( P < 0 . 02 ) , DNA pattern ( aneuploid versus diploid ) ( P < 0 . 009 ) , DNA index ( P < 0 . 009 ) , and percentage of cells in S phase ( P < 0 . 04 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A radioimmunoassay ( RIA ) was developed for a proliferating cell nuclear antigen , PCNA / cyclin , which is a protein synthesized in phase with DNA as a marker for cell replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Differential effects by the p 21 CDK inhibitor on PCNA dependent DNA replication and repair . ^^^ In mammalian cells , DNA damage increases the levels of the nuclear tumour suppressor p 53 , resulting in elevated synthesis of p 21 , an inhibitor of cyclin dependent kinases ( CDK ) . p 21 may also directly block DNA replication by inhibiting the proliferating cell nuclear antigen ( PCNA ) , an essential DNA replication protein . ^^^ However , PCNA is also required for nucleotide excision repair of DNA , an intrinsic part of the cellular response to ultraviolet irradiation . ^^^ Using an in vitro system , we now show that p 21 does not block PCNA dependent nucleotide excision repair , in contrast to its inhibition of simian virus 40 DNA replication . ^^^ Furthermore , the short gap filling DNA synthesis by PCNA dependent DNA polymerases delta and epsilon is less sensitive to inhibition by p 21 than is long primer extension synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We analysed p 53 expression during proliferation of serum stimulated Swiss mouse 3T3 cells and of concanavalin A stimulated mouse spleen lymphocytes and correlated it to rate of DNA synthesis and to expression of PCNA . ^^^ We also analysed mdm 2 gene expression , as rising p 53 levels during proliferation might require MDM 2 protein expression to functionally antagonize p 53 mediated growth inhibition . p 53 protein synthesis closely paralleled DNA synthesis and PCNA expression , suggesting a direct involvement of p 53 in cellular DNA synthesis . mdm 2 expression in 3T3 cells could not be correlated with p 53 expression and DNA synthesis and was not detected at all in stimulated lymphocytes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Nuclear cdk 2 forms high molecular weight complexes which migrate at the same position as DNA polymerase alpha and proliferating cell nuclear antigen in sucrose gradient centrifugation experiments . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein of DNA polymerase delta and appears to be needed for both DNA synthesis and DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a late growth regulated gene that is expressed at the G 1 S boundary of the cell cycle and is required for DNA synthesis and cell proliferation . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a late growth regulated gene that is expressed at the G 1 S boundary of the cell cycle and is required for DNA synthesis and cell proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using a DNA binding assay , a specific p 53 binding site was identified upstream from the cyclin G gene , which functioned as a p 53 dependent cis acting element in a transient transfection assay . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The phage T 4 gene 45 protein ( gp 45 ) , Escherichia coli beta and the eukaryotic proliferating cell nuclear antigen ( PCNA ) function in replication as processivity factors of their corresponding DNA polymerases . ^^^ The ability of gp 45 , beta and PCNA to track along DNA has been analyzed by photocrosslinking . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The evidence presented here supports the idea that Pho 81 acts as a phosphate sensitive trigger that regulates the ability of the Pho 80 Pho85 cyclin cdk complex to bind Pho 4 , while DNA binding by Pho 4 is dependent on the phosphate sensitive interaction with Pho2 . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 mediated inhibition of repair and replicative DNA synthesis in human fibroblasts . ^^^ We found that during repair DNA synthesis , subsequent to UV induced DNA damage , G 1 cells readily lost their cyclin D 1 while the proliferating cell nuclear antigen ( PCNA ) tightly associated with nuclear structures . ^^^ Microinjection of cyclin D 1 antisense accelerated DNA repair , whereas overexpression of cyclin D 1 prevented DNA repair and the relocation of PCNA after DNA damage . ^^^ In contrast , coexpression of PCNA , which is also a cyclin D 1 associated protein , restored the ability of cells to repair their DNA . ^^^ Altogether , these results indicate that down regulation of cyclin D 1 is necessary for PCNA relocation and repair DNA synthesis as well as for the start of DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Only cyclin A / cdk2 can phosphorylate E2F effectively , and this phosphorylation abolishes its ability to bind DNA and mediate trans activation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Hepatic proliferation was evaluated by tritiated thymidine ( 3H TdR ) incorporation into DNA , quantitative image analysis ( QIA ) , and proliferating cell nuclear antigen immunostained hepatic nuclei ( PCNA ) . 3H TdR incorporation values in animals treated 2 days before partial hepatectomy in treatment groups 2 through 4 were similar to those of the hepatectomized controls . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a co factor for DNA polymerase delta , which replicates genomic DNA during cell growth and division . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a co factor for DNA polymerase delta , which replicates genomic DNA during cell growth and division . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The effects of TNP 470 on DNA synthesis and the expression of c myc and cyclin D 1 mRNAs were investigated in human umbilical vein endothelial ( HUVE ) cells synchronized by serum depletion and stimulated with bFGF and serum . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a nuclear protein that regulates DNA synthesis by DNA polymerase delta , and is essential for DNA replication . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a nuclear protein that regulates DNA synthesis by DNA polymerase delta , and is essential for DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen bound to DNA synthesis sites : phosphorylation and association with cyclin D 1 and cyclin A . ^^^ Association with cyclin D 1 and cyclin A might occur in a macromolecular complex assembled at the G1 / S phase boundary to drive activation of DNA replication factors . . ^^^ These results suggest that binding of PCNA to DNA synthesis sites occurs after phosphorylation . ^^^ Proliferating cell nuclear antigen bound to DNA synthesis sites : phosphorylation and association with cyclin D 1 and cyclin A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Electron microscopy of conventional thin sections proved that these factories are a subset of nuclear bodies ; they changed in the same characteristic way and contained DNA polymerase alpha and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The ratio of PCNA / DNA increased in late G 1 through early S / phase , followed by a decrease in mid and late S and enhancement in G2 / M phase . ^^^ The data on the effects of drug treatment point to a dissociation between PCNA expression and S phase fraction as calculated from the DNA distribution . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We show that forskolin and 8 bromo cAMP block the basic Fibroblast Growth Factor induced DNA synthesis , do not inhibit mitogen activated protein kinase activation whereas they reduce G 1 cyclin ( E and D 1 ) expression without modification of cyclin A level . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A immunocytochemical study for detection of proliferating cell nuclear antigen ( PCNA ) in order to quantify the number of PCNA positive spermatogonia , and cytophotometric determination of spermatogonial DNA were performed in cryptorchid and control testes . ^^^ The number of PCNA positive spermatogonia , and the average DNA content of spermatogonia in the cryptorchid testes were altered from first years of age . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Crystal structure of the eukaryotic DNA polymerase processivity factor PCNA . ^^^ The crystal structure of the processivity factor required by eukaryotic DNA polymerase delta , proliferating cell nuclear antigen ( PCNA ) from S . cerevisiae , has been determined at 2 . 3 A resolution . ^^^ The dimensions and electrostatic properties of the ring suggest that PCNA encircles duplex DNA , providing a DNA bound platform for the attachment of the polymerase . ^^^ The trimeric PCNA ring is strikingly similar to the dimeric ring formed by the beta subunit ( processivity factor ) of E . coli DNA polymerase 3 holoenzyme , with which it shares no significant sequence identity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
At discrete intervals after stimulation , replicate samples were stained for either PCNA , p 120 , or 145 ; stained for DNA ( Coulter DNA Prep ) ; evaluated on the EPICS Profile 1 ; and analyzed on the EPICS ELITE workstation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This reactivation of PCNA synthesis correlated with the presence of high copy numbers of HPV DNA and was independent of the oncogenic risk potential of the infecting HPV genotype . ^^^ We postulate that HPV gene products induce the expression of PCNA and other components of the host DNA replication machinery in differentiated cells of squamous lesions to facilitate vegetative viral replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
At low concentrations of pol alpha primase complex , the formation of high molecular weight products was dependent on the addition of DNA polymerase delta holoenzyme containing proliferating cell nuclear antigen and activator 1 , also called RF C . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We studied seven cases of large cell acanthoma by image analysis cytometry for DNA content and by immunohistochemistry , using antibodies to proliferating cell nuclear antigen ( PCNA ) / cyclin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Complex formation results in a negative biochemical effect of cyclin A kinase : the shut off of E2F 1 dependent DNA binding function in S / G2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The fractions of pol delta and epsilon were not homogeneous , but their identities were confirmed by their sensitivities to DNA polymerase inhibitors , their associated 3 ' > 5 ' exonuclease activities , optimal concentrations of salts , dependencies on the proliferating cell nuclear antigen and processivities in polymerization , which also excluded significant contamination with other DNA polymerases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the present study , multiparameter flow cytometry was used to correlate expression of cyclin B 1 or cyclin E with cell cycle position ( estimated by cellular DNA content ) in normal human proliferating lymphocytes as well as in T cell MOLT 4 leukemia ; promyelocytic HL 60 leukemia ; histiocytic U 937 lymphoma ; MCF 7 , T 47D , and Hs 587T breast carcinoma ; Colo 320DM colon carcinoma ; and the T 24 transitional cell carcinoma cell line . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have defined a coordinate program of transcription of S phase genes ( DNA polymerase alpha , PCNA and the two ribonucleotide reductase subunits ) that can be induced by the G 1 cyclin , cyclin E . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Phosphorylation of the p 34 subunit of human single stranded DNA binding protein in cyclin A activated G 1 extracts is catalyzed by cdk cyclin A complex and DNA dependent protein kinase . ^^^ Fractionation of cyclin A activated G 1 extract identified two kinases involved in the hyperphosphorylation of HSSB p 34 : cdk cyclin A complex and DNA dependent p 350 protein kinase ( DNA PK ) . ^^^ Kinetic analysis revealed that in cyclin A activated G 1 extract , p 34 was first phosphorylated by cdk cyclin A prior to the action of DNA PK . ^^^ Addition of p21cip1 , a specific inhibitor of cdk cyclin A but not DNA PK , nearly abolished the hyperphosphorylation of HSSB p 34 in G 1 extract preincubated with cyclin A . ^^^ This suggests a requirement of the cdk cyclin A activity for the phosphorylation of p 34 by DNA PK in G 1 extract . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have compared the periodic fluctuation of mRNAs encoded by CDC 6 , a cell cycle gene controlling initiation of DNA replication , and CLN 1 , a G 1 cyclin gene expressed at late G 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA is a protein involved in DNA replication and is maximally expressed in S phase of the cell cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Upstream regions containing a novel common 8 base pair ( bp ) palindromic sequence , 5 ' TATCGATA ( Drosophila DNA replication related element ( DRE ) ) , are required for the high expression of Drosophila genes for DNA polymerase alpha and the proliferating cell nuclear antigen ( PCNA ) ( an auxiliary protein for DNA polymerase delta ) . ^^^ Three DREs and one DRE are present in the DNA polymerase alpha gene ( nucleotides 217 , 83 , and 30 with respect to the transcription initiation site ) and in the PCNA gene ( nucleotide 100 ) , respectively . ^^^ Novel 8 base pair sequence ( Drosophila DNA replication related element ) and specific binding factor involved in the expression of Drosophila genes for DNA polymerase alpha and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a proliferation induced 36 kD nuclear protein that is the auxiliary component of DNA polymerase delta . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a proliferation induced 36 kD nuclear protein that is the auxiliary component of DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The mosquito homolog of mammalian DNA polymerase epsilon , formerly known as a proliferating cell nuclear antigen ( PCNA ) independent form of DNA polymerase delta , has been purified from mosquito larval extracts . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The induction of proliferating cell nuclear antigen ( PCNA ) ( which is required for both DNA replication and repair ) followed a similar spatial and temporal pattern to p 53 . ^^^ The accumulation of high levels of p 53 and PCNA in response to UV doses to which many human populations are routinely exposed provides strong support for a model in which normal p 53 acts as part of the DNA damage response in vertebrate cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Prostatic carcinoma specimens ( N = 48 ) were incubated in the presence of BrdUrd to label cells undergoing DNA synthesis , and immunocytochemical staining was performed with monoclonal antibodies to BrdUrd and PCNA and a standard indirect immunoperoxidase technique . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The PCNA index of these cases ( 34 . 1 ) was higher than that of DNA homogeneous cases ( 19 . 4 ) . ^^^ Expression of proliferating cell nuclear antigen in lung cancer : a systematic study and correlation with DNA ploidy . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The maximum fraction of PCNA positive nuclei ( PCNAmax ) , the average fraction of positive nuclei ( PCNAtot ) and the number of intensely stained nuclei per microscope field ( PCNAcount ) were significantly related to histological grade ( P < 0 . 001 ) , DNA ploidy ( ( P < 0 . 001 ) , S phase fraction ( P < 0 . 001 ) , mitotic index ( P < 0 . 001 ) and sex steroid receptor content ( P = 0 . 002 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In view of the essential role of proliferating cell nuclear antigen ( PCNA ) in DNA replication , we performed a mutational analysis of the minimal human PCNA promoter ( nucleotides 87 to +62 ) to define sequence elements which mediate transactivation by the 243 residue E1A protein ( E1A 243R ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
One such gene product , proliferating cell nuclear Ag ( PCNA ) , is the auxiliary protein of DNA polymerase delta , and is induced during late G 1 and early S phase after stimulation of resting ( G 0 ) cells . ^^^ Elevation of PCNA expression among double positive thymocytes is not the result of increased numbers of cycling cells in this subpopulation , being specifically observed in double positive thymocytes with normal diploid DNA content and resting ( G 0 ) levels of RNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We confirmed in vitro that PCNA , an essential component of the DNA synthesis machinery , is selectively expressed in proliferating human vascular smooth muscle cells . 37 atherosclerotic lesions ( 18 primary and 19 restenotic ) retrieved by directional atherectomy from either coronary or peripheral arteries were then studied for the expression of PCNA , using in situ hybridization or immunohistochemistry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The mitotic count analyzed by light microscopy , the proliferating cell nuclear antigen ( PCNA ) and the epidermal growth factor ( EGF ) expressions by immunohistochemical analysis , and the ploidy status analyzed by DNA flow cytometry were used as the proliferation related markers in this study . ^^^ The presence of mitoses , high PCNA score and DNA aneuploidy did not correlate with the histologic subtypes , patient age , sex or the tumor extent . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunohistochemical detection of the nuclear antigen recognised by the monoclonal antibody Ki 67 , DNA polymerase alpha , and the proliferating cell nuclear antigen ( PCNA ) , and histochemical staining for the argyrophilic proteins associated with the nucleolar organizer regions ( AgNOR ) were carried out on histological sections from 107 colorectal adenomas containing invasive carcinoma ( ACIC ) , including 7 with regional lymph node metastases . ^^^ The mean percentages of Ki 67 , DNA polymerase alpha , and PCNA positive nuclei and the number of AgNOR per nucleus progressively increased along the sequence from normal mucosa via low grade and high grade dysplasia adenoma to advanced cancer , whereas the early cancer values were not significantly different from those in the low grade dysplasia areas . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
As others have found , approximately 150 focal sites of synthesis were visible in each nucleus by light microscopy ; they also contained DNA polymerase alpha and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The association of the proliferating cell nuclear antigen ( PCNA ) to DNA synthesis sites was investigated in human quiescent fibroblasts after UV irradiation . ^^^ Immunoprecipitation studies on nuclear extracts from 32P labeled cells showed that PCNA bound to DNA synthesis sites was phosphorylated . ^^^ The results indicate that PCNA associated to DNA repair synthesis sites may be detected with PC 10 MoAb after a hypotonic lysis step , and provide evidence that the transition from soluble to chromatin associated form of the protein is dependent on a phosphorylation mechanism . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Localization of cyclin A at the sites of cellular DNA replication . ^^^ To examine the relationship between cyclin A and DNA replication , we simultaneously labeled exponentially growing HeLa cells for the distribution of cyclin A and proliferating cell nuclear antigen ( PCNA ) . ^^^ We have now demonstrated , by means of immunoelectron microscopy , that cyclin A is located at the sites of DNA replication visualized by both BrdU and PCNA labeling . ^^^ Thus cyclin A may play a significant role in the phosphorylation of proteins at or near the sites of DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cell kinetics were analyzed by counting the number of argyrophilic nucleolar organizer regions ( AgNOR ) using immunostaining of proliferating cell nuclear antigens ( PCNA ) and flow cytometric DNA analysis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Growth type of colorectal cancer invasion of the proper muscle in relation to DNA ploidy and distribution of PCNA ] . ^^^ In order to elucidate the biological characteristics of colorectal cancer invading the proper muscle , we analyzed DNA ploidy and PCNA labeling index . ^^^ The results were as follows : 1 ) Growth types bore no relation to DNA ploidy and distribution of PCNA . 2 ) In aneuploidy cancer , it showed a high incidence of lymphatic vessel permeation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Correlation of DNA ploidy , c erbB 2 protein tissue status , level of PCNA expression and clinical outcome in gastric carcinomas ] . ^^^ There is a relationship between c erbB 2 tissue status and PCNA indices , but no correlations were found among c erbB 2 tissue status , PCNA indices and DNA contents . ^^^ From these results , it can be concluded that DNA ploidy , c erbB 2 protein , and PCNA may reflect the malignant potential of gastric carcinoma . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The authors attempted to estimate the relationship between three biological parameters ( nuclear DNA content , PCNA ( proliferating cell nuclear antigen ) / cyclin , HER 2 / neu oncoprotein ) and lymph node metastasis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Pol delta requires the accessory factors , proliferating cell nuclear antigen ( PCNA ) , activator 1 ( A 1 ; also known as replication factor C [ RF C ] ) , human single stranded DNA binding protein ( HSSB ; also known as replication protein A [ RP A ] ) for the elongation of primed template DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The functional interaction of simian virus 40 ( SV 40 ) large tumor antigen ( T antigen ) with DNA polymerase alpha ( pol alpha ) primase complex , human single stranded DNA binding protein ( HSSB ) , and DNA polymerase delta ( pol delta ) holoenzyme , which includes pol delta , activator 1 ( also called replication factor C ) , and proliferating cell nuclear antigen , at the replication fork was examined using the purified components that support SV 40 DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
BACKGROUND : Proliferating cell nuclear antigen ( PCNA ) is a 36 kd nuclear protein whose expression is associated with DNA synthesis and cell proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The whole cell preparation technique allows accurate DNA ploidy measurements and , with the use of PCNA , a measure of proliferative activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A polyacrylamide gel electrophoresis band mobility shift assay was developed to study the binding of synthetic oligonucleotides by DNA polymerase delta ( pol delta ) and proliferating cell nuclear antigen ( PCNA ) . ^^^ As measured by this assay , neither calf thymus pol delta core enzyme nor PCNA alone bind DNA stably . ^^^ A model for the ordered sequential interaction of pol delta , PCNA , and DNA template primers is proposed . . ^^^ Interaction of DNA polymerase delta , proliferating cell nuclear antigen , and synthetic oligonucleotide template primers . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We studied cell kinetics of colo rectal neoplasms using PCNA ( the auxiliary protein of DNA polymerase delta ) immunohistochemistry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The PCNA expression in adjacent morphologically normal breast tissue may suggest an accumulation of cyclin without a necessary induction of DNA synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The maximum fraction of PCNA positive nuclei ( PCNAmax ) , the average fraction of positive nuclei ( PCNAtot ) and the number of intensively stained nuclei / microscope field ( PCNAcount ) were significantly related to histological grade ( p < 0 . 001 ) , DNA Ploidy ( p < 0 . 022 ) , S phase fraction ( p < 0 . 003 ) and mitotic index ( p < 0 . 003 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , we did not find any correlation between p 53 expression and proliferating activity evaluated by PCNA , Ki 67 and DNA flow cytometric cell cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA flow cytometry was performed on 30 patients and compared with PCNA score and survival . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , a protein associated with DNA polymerase that is expressed only in the nuclei of cells actively synthesizing DNA , was quantitated in 46 formalin fixed , paraffin embedded samples of various types of NHL using the Cell Analysis Systems 200 image analyzer . ^^^ Proliferating cell nuclear antigen ( PCNA ) , a protein associated with DNA polymerase that is expressed only in the nuclei of cells actively synthesizing DNA , was quantitated in 46 formalin fixed , paraffin embedded samples of various types of NHL using the Cell Analysis Systems 200 image analyzer . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression of proliferating cell nuclear antigen , a DNA polymerase delta auxiliary protein , was studied in 20 specimens from 20 patients with conjunctival malignant melanoma by means of the total number of cells that showed immunoreactivity per square millimeter . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Upon transformation of diploid fibroblasts with the DNA tumor virus SV 40 , or its transforming tumor antigen ( T ) , the cyclin D / p21 / CDK / PCNA complexes are disrupted . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA was stained in proliferating cell by measuring nuclear DNA simultaneously . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cellular nicks were detected by in situ nick translation ( ISNT ) using biotin labelled mixture and DNA synthesis was assessed by immunohistochemical staining using BrdU and / or PCNA monoclonal antibodies . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The B cell expression of proliferating cell nuclear antigen , which is closely related to the auxiliary protein for DNA polymerase delta , was not inhibited by anti CD 3 activated control T 4 cells at any time of the cultures . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The high degree of structural conservation of PCNA from such diverse organisms as humans and higher plants suggests that the plant PCNA may function in a manner analogous to that found in mammals with respect to plant cell DNA replication . ^^^ Such conservation suggests that PCNA is also a critical component of the plant cell DNA replication complex . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
First , while the expression of PCNA was increased during serum stimulation of quiescent Hep G 2 cells , the DNA methylation pattern of PCNA gene remained unchanged . ^^^ Second , in rat liver regeneration , the PCNA mRNA level rose and declined , but the DNA methylation status of PCNA gene was unaltered . ^^^ Therefore , the DNA hypomethylation of the PCNA gene found in hepatocellular carcinoma was not due to cell proliferation , but a possible consequence of cell transformation . . ^^^ DNA hypomethylation of proliferating cell nuclear antigen gene in human hepatocellular carcinoma is not due to cell proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study , experimental conditions are described that allowed us to follow the fate of the DNA polymerase delta associated proliferating cell nuclear antigen ( PCNA ) , by immunolabeling during the overall cell cycle . ^^^ More precisely , thyrotropin ( TSH ) , acting via cAMP , exerts a potent triggering effect on DNA synthesis , associated with a precocious induction of PCNA appearance . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA is essential for cells to cycle through S phase and its synthesis is initiated during late G 1 phase before incorporation of BrdU and remains high during active DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We investigated the proliferating activity of human papillomavirus ( HPV ) infection in cervical neoplasia obtained from 37 mild dysplasia , 26 moderate dysplasia , 34 severe dysplasia and 26 carcinoma in situ ( CIS ) and 10 normal cervical epithelium by in situ hybridization ( ISH ) with biotinylated HPV 6 , 11 , 16 and 18 DNA probes and by immunohistochemical staining with monoclonal antibody ( PC 10 ) to proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The expression of PCNA increased in the cell from the late G 1 and S phases of the cell cycle immediately preceding DNA synthesis . ^^^ Recent studies have revealed that the auxiliary protein of DNA polymerase d is identical to PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Thus far , the only clear examples are genes that encode a class of unstable ' cyclin ' proteins , which bind and activate the cdc2 / Cdc28 protein kinase : the G 1 specific cyclins encoded by CLN 1 and CLN 2 , a B type cyclin implicated in DNA replication encoded by CLB 5 ; and four B type cyclins involved in mitosis encoded by CLB 1 , 2 , 3 , 4 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To better define the relationship of these various TPA measurements in CA , the authors selected 46 tumors with diploid DNA content previously analyzed by two color DNA FCM analysis of fresh specimens to more effectively assess actual S phase fractions ( SPFs ) from cytokeratin gated DNA histograms for comparison with the following : ( 1 ) immunohistologic Ki 67 and PCNA tumor proliferation indices ( TPIs ) ; and ( 2 ) conventional histopathologic observations of prognostic import . ^^^ These data show no significant correlation coefficient between Ki 67 or PCNA TPIs and SPFs derived from FCM analysis ; however , the DNA diploid tumor subset categorized as having a greater than median SPF value had a significantly higher mean Ki 67 but not PCNA proliferation index . ^^^ Ki 67 and proliferating cell nuclear antigen tumor proliferative indices in DNA diploid colorectal adenocarcinomas . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These sections were submitted to immunohistochemical staining with the 19A2 monoclonal antibody against proliferating cell nuclear antigen ( PCNA ) ( i . e . the PCNA identified as the auxiliary protein to DNA polymerase delta ) , followed by autoradiography . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this work , we investigate the ability of yeast proliferating cell nuclear antigen ( PCNA ) to stimulate processive synthesis by the bacterially produced , single subunit DNA polymerase delta . ^^^ Yeast PCNA was found to stimulate the full length single subunit yeast DNA polymerase delta and to increase its processivity . ^^^ Thus , we conclude that the single subunit DNA polymerase can associate productively with PCNA in the absence of other proteins and that the NH 2 terminal domain of the catalytic subunit must be intact for this interaction . . ^^^ Interaction of proliferating cell nuclear antigen with yeast DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Flow cytometric analysis was carried out by double staining for PCNA and DNA using fresh materials from 14 patients . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein to DNA polymerase delta necessary for tissue cellular proliferation . ^^^ Proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein to DNA polymerase delta necessary for tissue cellular proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , immunostaining and flow cytometric DNA analysis of renal cell carcinoma . ^^^ The purpose of the present study was to examine immunohistochemical staining of PCNA in renal cell carcinoma and its relationship to tumor grading , flow cytometric DNA analysis and prognosis . ^^^ In parallel with the PCNA immunostaining DNA flow cytometry was performed , using the cell suspension prepared from paraffin sections and stained with propidium iodide . 79 tumors were evaluable for PCNA immunohistochemistry and 54 tumors for DNA flow cytometry . ^^^ Proliferating cell nuclear antigen ( PCNA ) , immunostaining and flow cytometric DNA analysis of renal cell carcinoma . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , also known as cyclin , is an auxiliary protein of DNA polymerase delta and is found only in the nuclei of proliferating cells in the late G 1 and S phases . ^^^ Proliferating cell nuclear antigen ( PCNA ) , also known as cyclin , is an auxiliary protein of DNA polymerase delta and is found only in the nuclei of proliferating cells in the late G 1 and S phases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Since PCNA is a cofactor for Delta DNA polymerase , PCNA overexpression in CLL may also reflect the intrinsic DNA repair activity of the leukemic cells and thus their resistance to chemotherapy . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA damage led to increased levels of WAF1 / CIP1 in cyclin E containing complexes and to an associated decrease in cyclin dependent kinase activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In human umbilical vein endothelial cells , the protein kinase C ( PKC ) stimulation during the early G 1 phase leads to potentiations in growth factor stimulated DNA synthesis , the activation of cdc 2 and cdk 2 cyclin dependent kinases , and the mRNA expression of cdc 2 , cyclins A , D 1 and E , but not cdk 2 or cdk 4 . ^^^ Conversely , the PKC stimulation in the late G 1 phase completely inhibits DNA synthesis , the activation of cyclin dependent kinases , and the mRNA expression of the same set of molecules except cyclin D 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have cloned a rat cyclin B complementary DNA ( cDNA ) and have investigated cyclin B mRNA expression and regulation in the regenerating rat liver following 70 % partial hepatectomy ( PH ) . ^^^ The present study indicates that the appearance of cyclin B mRNA in the regenerating rat liver is coincident with peak DNA synthesis , although its own peak expression is significantly delayed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using multivariate flow cytometry ( DNA content vs . expression of cyclin B , nuclear p 120 protein , or protein reactive with Ki 67 antibody ) which makes it possible to discriminate cells with identical DNA content but at different phases of the cycle , we have studied the cell cycle progression of human lymphocytic leukemic MOLT 4 cells in the presence of 0 . 1 microM SSP . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proteins and enzymatic activities associated with this mouse cell multiprotein form of DNA polymerase include the DNA polymerases alpha and delta , DNA primase , proliferating cell nuclear antigen ( PCNA ) , DNA ligase 1 , DNA helicase , and DNA topoisomerases 1 and 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Band shift analysis of bacterially produced E2F 1 showed that this protein bound to the promoters of human DNA polymerase alpha , cyclin D 1 , and c myb but not to the cdc 2 gene promoter . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results suggest that the frequency of overexpression is much higher than previously concluded from DNA based analyses and that more than one third of human breast cancers may contain excessive levels of cyclin D 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using a procedure to stain cells simultaneously for cyclin B 1 protein and DNA , we have examined cyclin B 1 expression by flow cytometry in human cells under a variety of perturbing and nonperturbing conditions . ^^^ Flow cytometric analysis of cyclin B expression and DNA content permits detailed examination of the effects of cell cycle perturbations on cyclin B expression under a variety of conditions . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using these proteins , complete SV 40 DNA replication was reconstituted with only purified DNA replication factors : SV 40 large tumor antigen ( TAg ) , replication protein A ( RPA ) , DNA topoisomerases 1 and 2 , DNA polymerase alpha primase , replication factor C ( RFC ) , the proliferating cell nuclear antigen ( PCNA ) , DNA polymerase delta , maturation factor 1 ( MF 1 ) , and DNA ligase 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A nucleotide ( nt ) sequence of a DNA molecule from Stylonychia lemnae with an open reading frame encoding a protein showing homology to cyclin B has been determined . ^^^ The DNA molecule is 3791 nt long and the deduced 444 amino acid ( aa ) sequence shares about 30 % identity with the sequences of two yeast cyclin B homologs over a length of about 210 aa . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We describe a method for simultaneous measurement of PCNA and DNA in solid tumors using flow cytometry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We now report aberrant nuclear overexpression / accumulation of the cyclin D 1 protein in about half of the 170 primary breast carcinoma specimens analyzed by monoclonal antibody immunohistochemistry , indicating that the frequency of cyclin D 1 abnormalities may be considerably higher than previously deduced from DNA amplification studies . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA tumor virus oncoproteins and retinoblastoma gene mutations share the ability to relieve the cell ' s requirement for cyclin D 1 function in G 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using multivariate flow cytometry to correlate the expression of cyclin E or cyclin D with cellular DNA content ( i . e . , cell cycle position ) , we have presently characterized the point of action of SSP in relation to the expression of these cyclins . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 was identified as a candidate oncogene ( PRAD 1 ) in tumour specific DNA rearrangements and is suspected to be a contributor to several types of neoplasms including breast cancer . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In a survey of breast cancer cell lines and tumors by Southern blot hybridization , using a 1 . 2 kb human cyclin D 1 cDNA , we observed that genomic DNA derived from the MDA MB 453 cell line contains an extra band in the Bg1II and BamHI digests , suggesting that one allele of gene is altered . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Simultaneous analysis of cell cycle kinetics at two different DNA ploidy levels based on DNA content and cyclin B measurements . ^^^ The aim of the present study was to explore the utility of a monoclonal antibody against the G 2 and M phase specific regulatory protein cyclin B for discrimination of cell populations with overlapping DNA content . ^^^ This analysis , which was based on correlated DNA / cyclin B content measurements by flow cytometry , was applied to human lymphocytic leukemic MOLT 4 cells . ^^^ It was possible , utilizing the cyclin B antibody , to discriminate between G 2 + M cells with a 2C level of DNA and G 1 cells with 4C DNA , as well as to distinguish doublets of G 1 cells with a 2C DNA level . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Tissue markers , including nuclear grade , steroid hormone receptors , DNA index , ploidy , expression of oncogenes or tumor suppressor genes , epidermal growth factors , cathepsin D , proliferating cell nuclear antigen ( PCNA ) , Ki 67 , p 32 , and others , may influence choices of initial treatment as well as adjuvant chemotherapy and ( or ) hormone administration . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Differences in the regulation of protein synthesis , cyclin B accumulation , and cellular growth in response to the inhibition of DNA synthesis in Chinese hamster ovary and HeLa S 3 cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A activates histone H 1 kinase and becomes destroyed by proteolysis earlier than cyclines B and plays an important role in the DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To investigate the role of cyclin D 1 in human hepatocellular carcinoma ( HCC ) , DNA from 30 HCC and 5 control liver tissues from Taiwan and also the HCC cells lines HepG 2 and Hep3B , were examined for amplification of the cyclin D 1 gene . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The human cyclin D 1 gene is located on chromosome 11q13 where DNA rearrangement and amplification have been detected in several types of human cancer . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
They also have specific functions : cyclin A plays a role in DNA replication , whereas cyclin B are involved in the inhibition of the fusion of early endosomes and in the activation of cdc 25 phosphatase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Transfection of NRK cells with a cyclin A complementary DNA resulted in adhesion independent accumulation of cyclin A protein and cyclin A associated kinase activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin A gene was first identified at a site of hepatitis B virus DNA integration in a primary liver cancer ( PLC ) . ^^^ We conclude that allelic loss in the cyclin A gene is a rare event in patients with PLC , and that PCR is rapid and reliable for the detection of allelic loss in the cyclin A gene when only small amounts of DNA are available . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 2 RNA was induced rapidly to peak levels well before initiation of DNA synthesis and gradually declined during the remainder of G 1 . ^^^ Cyclin D 3 RNA and protein showed a slower induction during G 1 to maximal levels as cells initiated DNA synthesis that remained high throughout S phase . ^^^ Rapamycin was found to target a pathway late in G 1 that is distal to induction of D type cyclin gene expression but proximal to DNA replication , perhaps involving the function of the D type cyclin proteins or their associated kinases . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our DNA sequencing data indicate that the promoter region of the p34cdc2 gene contains putative E2F like binding sites which are recognized by Rb and binding sites for c myb , Sp 1 , and ATF , and that the promoter region of the cyclin A gene contains binding sites for p 53 , Sp 1 , and ATF . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The gene is expressed only in ovaries and embryos , null alleles are strict maternal effect mutations , and the phenotype of inappropriate DNA replication is the consequence of loss of gene function . plu therefore negatively regulates S phase at a time in early development when commitment to S phase does not depend on cyclic transcription . plu encodes a protein with two ankyrin like repeats , a domain for protein protein interaction . plu is immediately adjacent to , but distinct from , the PCNA gene . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis and entry into mitosis are known to be regulated by cyclin A . ^^^ In serum starved tumor cells ( HeLa ) we have observed increased cyclin A synthesis within 10 hr , in parallel with enhancement of DNA synthesis and shortening of the S phase after TNF treatment . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The functions of the Cdc 28 protein kinase in DNA replication and mitosis in Saccharomyces cerevisiae are thought to be determined by the type of cyclin subunit with which it is associated . ^^^ We describe a new family of B type cyclin genes , CLB 5 and CLB 6 , whose transcripts appear in late G 1 along with those of CLN 1 , CLN 2 , and many genes required for DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The involvement of DNA polymerase delta or epsilon and proliferating cell nuclear antigen but not single strand binding protein was indicated by partial fractionation , inhibitor , and antibody studies . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Binding depended upon the minimal regions of Rb necessary for its growth suppressive activity , as well as upon the D type cyclin sequence motif shared with Rb binding DNA tumor virus oncoproteins . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Optimal conditions for immunostaining varied in fixation and pretreatment procedures among antigens , bromodeoxyuridine ( BrdU ) , Ki 67 epitope , DNA polymerase alpha and PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our data also suggest that the deregulated expression of cyclin D 1 and E is not sufficient to drive senescent cells into DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis was performed with a low processivity in the presence and absence of PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The modification of cyclin A expression in a human liver cancer by the insertion of hepatitis B viral DNA into the cyclin A gene , and binding of cyclin A to the oncogenic E1A viral protein in adenovirus infected cells suggest that the cyclin is implicated in human carcinogenesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Both the cyclin E p33cdk2 and cyclin A p33cdk2 complexes have been implicated in regulatory events controlling entry into or passage through DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression of cyclin D 1 mRNA is low in quiescent WI 38 cells and reaches a maximum around 10 hours after serum stimulation , i . e . approximately 8 hours prior to the onset of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In extracts supplemented with nuclei , the block on p34cdc2 / cyclin B activation by unreplicated DNA is abolished when PP 2A is inhibited or when stably phosphorylated cdc 25 C is added , but not when PP 1 is specifically inhibited . ^^^ This suggests that unreplicated DNA inhibits p34cdc2 / cyclin B activation by maintaining cdc 25 C in a low activity , dephosphorylated state , probably by keeping the activity of a type 2A protein phosphatase towards cdc 25 C at a high level . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Finally , DNA unwinding of a primer recognition complex for DNA polymerase delta which is composed of proliferating cell nuclear antigen , replication factor C and ATP bound to a singly primed M13DNA slightly inhibited DNA unwinding . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cdc 2 cyclin B kinase complex that we have isolated , consisting of two polypeptides of p 60 ( cyclin B ) and p 34 ( cdc 2 ) , phosphorylated both the p 34 and p 70 subunits of the three subunit human single stranded DNA binding protein ( also called RP A ) , a DNA replication and repair factor . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The reconstituted cdc 2 cyclin B 1 complex incorporated 4 5 fold more phosphate into the p 34 subunit of the three subunit ( p 70 , p 34 , and p 14 ) human single stranded DNA binding protein ( also called RP A ) , a DNA replication and DNA repair factor , than cdc 2 cyclin A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Reversal of terminal differentiation and control of DNA replication : cyclin A and Cdk 2 specifically localize at subnuclear sites of DNA replication . ^^^ The specific localization of cyclin A and cdk 2 at nuclear replication foci provides a direct link between cell cycle regulation and DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have examined DNA from four human esophageal carcinoma cell lines and 50 primary esophageal carcinomas obtained from China , Italy , and France for amplification of the cyclin D 1 gene . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cell cycle regulation of a human cyclin like gene encoding uracil DNA glycosylase . ^^^ The predicted amino acid sequence of a human cDNA encoding uracil DNA glycosylase activity shows striking similarity to the cyclin protein family . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In an attempt to further localize the point in the cell cycle where arrest occurred , a set of key regulatory events leading to the G1 / S boundary were examined , including p110Rb phosphorylation , which occurred at least 6 hr prior to DNA synthesis , p34cdc2 synthesis , and cyclin A synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cells were shown to resume DNA synthesis within 12 16 h of reoxygenation concomitant with pRB hyperphosphorylation and an increase in cyclin A detection . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
By using a defined gapped DNA substrate that mimics a lagging strand of 230 nucleotides and that contains a defined pause site , we have analyzed calf thymus DNA polymerases ( pol ) alpha , beta , delta , and epsilon in the presence of the three auxiliary proteins proliferating cell nuclear antigen ( PCNA ) , replication factor C ( RF C ) and replication protein A ( RP A ) for their ability to complete an Okazaki fragment . ^^^ This pausing could only be overcome upon addition of PCNA , RF C and E . coli single stranded DNA binding protein . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We investigated the temporal regulation of cyclin A and B 1 dependent kinases in human lymphoma cells treated with nitrogen mustard ( HN 2 ) and pentoxifylline , to determine whether the activity of these complexes correlated with cell cycle arrest induced by DNA damage . ^^^ Our findings suggest that delayed entry into mitosis following DNA damage correlates with suppression of cyclin B1 / cdc2 and cyclin A / cdc2 complexes , while maintaining cyclin A / cdc2 complexes in an active state . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In mammalian cells , association with the cdc type kinases suggests that cyclin A complexes are important for DNA replication and regulating other DNA bound substrates required for S phase . ^^^ Though the p33cdk2 and other nuclear factor complexes exhibit constitutive binding to the htk G 1 S regulatory domain , the binding activity of a cyclin A / p107 protein complex is greatly enhanced when the cells enter S phase , correlating with the increase in the tk mRNA levels and the replication of DNA . ^^^ Mutation of the DNA sequences on either half of the 25 bp protein binding site results in the loss of its ability to compete efficiently in vitro for the htk complexes , including that of cyclin A containing complex . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Serum creatinine and urea , which initially rose similarly in the ARF+vehicle and ARF+rhIGF 1 rats , increased more slowly after commencing the rhIGF 1 injections . 72 h after surgery , the ARF+rhIGF 1 rats , in comparison with ARF+vehicle animals , showed significantly greater renal plasma flow and filtration fraction , a fivefold higher glomerular filtration rate , greater renal cortical IGF 1 levels , increased proliferating cell nuclear antigen expression in proximal tubule nuclei and enhanced DNA synthesis in the renal cortex , corticomedullary junction , glomeruli , and tubules as demonstrated by [ 3H ] thymidine incorporation and in corticomedullary junction tubules as determined by autoradiography . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Various methods of measuring tumor cell proliferation ( proliferating cell nuclear antigen , bromodeoxyuridine , Ki 67 , nucleolar organizer regions , and DNA flow cytometry ) are being compared with each other and correlated with clinical outcome in an attempt to validate these methods and to discover the most relevant one . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Other markers of proliferation ( e . g . proliferating cell nuclear antigen ) have been shown to be expressed in DNA repair , thus we investigated expression of MIB 1 immunoreactivity in situations of DNA repair in vivo ultraviolet irradiated human skin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Misregulated expression of the cyclin dependent kinase 2 protein in human fibroblasts is accompanied by the inability to maintain a G 2 arrest following DNA damage . ^^^ Surprisingly , both cyclin dependent kinase 2 ( CDK 2 ) and cyclin A proteins were specifically down regulated within 24 h of DNA damage . ^^^ In contrast , TAg transformed cells did not down regulate either cyclin A or CDK 2 after DNA damage and showed a significantly shortened G 2 arrest . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Mammalian CDK 7 is a protein kinase identified as the catalytic subunit of cyclin dependent kinase ( CDK ) activating kinase and as an essential component of the transcription factor TFIIH that is involved in transcription initiation and DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our purpose was to analyze the predictive relevance of proliferative variables studied [ proliferating cell nuclear antigen ( PCNA ) expression , volume corrected mitotic ( M / V ) index , and S phase fraction ( SPF ) ] on clinical outcome in relation to DNA ploidy and clinicopathological features . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Temperature sensitive mutation of DNA polymerase alpha induces growth suppressive phenotypes involving retinoblastoma protein and cyclin D 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It is proposed that the CDK 7 cyclin H complex functions in cell cycle progression , basal transcription and DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In order to study the effect of trimerization of proliferating cell nuclear antigen ( PCNA ) on its interaction with DNA polymerase ( pol ) delta and its loading onto DNA by replication factor C ( RF C ) we have mutated a single tyrosine residue located at the subunit interface ( Tyr 114 ) to alanine . ^^^ Furthermore , the mutant protein was unable to stimulate DNA synthesis by pol delta and did not compete effectively with wild type PCNA for pol delta , although it was able to oligomerize and could to some extent interact with subunits of functionally active PCNA . ^^^ We thus conclude that PCNA molecules that are not part of a circular trimeric complex can not interact with the pol delta core . furthermore , the mutant protein could not be loaded onto DNA by RF C and did not compete with wild type PCNA for loading onto DNA , indicating that PCNA trimerization may also be a prerequisite for its recognition by RF C . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These observations suggest that moderate elevation of the cellular wild type p 53 level induces PCNA production to help in DNA repair . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunocytochemical analysis was performed using defined , commercially available antibodies for PCNA ( PCNA 10 , DAKO ) and MIB 1 ( raised against recombinant DNA defined segment of Ki 67 antigen DAKO ) streptavidin / biotin and alkaline phosphatase immunocytochemistry ( for MIB 1 with microwave enhanced antigen retrieval ) were used to demonstrate the presence of cell cycling associated nuclear proteins . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Moreover , these cells continue to synthesize cyclin B protein , enlarge and display an abnormal ballooned morphology , and disappear from the cultures in a pattern previously described for cytotoxicity induced by DNA synthesis ( S phase ) inhibitors . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To target live breast tumor cells in a heterogeneous breast tumor model , we have designed a panel consisting of the DNA specific dye DAPI and epithelial tissue specific ( cytokeratin ) , tumor associated ( MC 5 ) , proliferation associated ( proliferating cell nuclear antigen ) , and viability associated ( tubulin ) markers . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proteins that were found at that time to co purify with the human cell multiprotein form of DNA polymerase included : DNA polymerase alpha , DNA primase , topoisomerase 1 , RNase H , PCNA , and a DNA dependent ATPase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
BACKGROUND / AIMS : The cyclin A gene plays an important role in both the S and G 2 M phases of the cell cycle , and has been identified at a site of hepatitis B virus DNA integration in a human liver cancer . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The repair of 10 ray induced DNA damage related to the proliferating cell nuclear antigen ( PCNA ) was characterized in human diploid fibroblasts by an indirect immunofluorescence method . ^^^ These results imply that PCNA dependent , aphidicolin sensitive DNA polymerases may be involved in repair of 10 ray induced DNA damage in vivo , but the repair initiation step could be different from that of nucleotide excision repair initiated by XP proteins . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a 36 kD nuclear protein that functions as a cofactor of delta DNA polymerase which is regulated in a cell cycle dependent fashion . ^^^ PCNA expression also increases when cells are actively engaged in DNA repair . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a 36 kD nuclear protein that functions as a cofactor of delta DNA polymerase which is regulated in a cell cycle dependent fashion . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have confirmed that the DNA replication related element ( DRE ) consisting of an 8 bp palindrome , TATCGATA , and not neighboring sequences , are responsible for activating promoters of the Drosophila melanogaster ( Dm ) PCNA ( proliferating cell nuclear antigen ) and DNA polymerase alpha encoding genes in both cultured cell and transgenic fly systems . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The significance of the lack of cyclin D 2 regulation by competence inducing growth factors was demonstrated , in that only mitogenic factors that stimulated DNA synthesis 1 ) led to the formation of stable cyclin D2 / cdk4 holoenzyme complexes during G 1 phase progression , and 2 ) afforded the isolation of anti cyclin D 2 or anti cdk 4 immunoprecipitates that phosphorylated retinoblastoma . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
For progression through G 1 and commitment to DNA synthesis , the activity of a family of proteins , the cyclin dependent kinases ( cdks ) , is required . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A kinase regulation of E2F 1 DNA binding function underlies suppression of an S phase checkpoint . ^^^ Here , we show that suppression of E2F 1 DNA binding activity by cyclin A kinase is linked to orderly S phase progression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using this approach the presence of the proliferating cell nuclear antigen at the DNA replication sites was revealed in MCF 7 breast carcinoma cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Mucosal regenerative activity at the ulcer edge was assessed by quantitating DNA synthesis in cells by immunohistochemical techniques using monoclonal antibodies to detect expression of proliferating cell nuclear antigen ( PCNA ) and incorporated 5 bromo 5 iododeoxyuridine ( BrdU ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Moreover , a bivariate distribution of cells stained for DNA and cyclin B 1 showed that , following melphalan and hyperthermia treatment , the fraction of cyclin B 1 expressing cells paralleled the fraction of G2+M phase cells , thus indicating that the inability of cells to enter mitosis was not ascribable to a reduction of cyclin B 1 expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a key cycle regulatory protein of known structure and function that also has an important role in DNA repair , its use as a marker of proliferation can be assessed directly using a thymidine analogue in suitably labelled pathological material . ^^^ PCNA PC 10 is expressed throughout the cell cycle in human colorectal tumour biopsies , which is in keeping with the range of DNA repair , synthesis , and regulatory functions that it is now recognised to perform throughout the cell cycle . . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a key cycle regulatory protein of known structure and function that also has an important role in DNA repair , its use as a marker of proliferation can be assessed directly using a thymidine analogue in suitably labelled pathological material . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Interleukin 2 ( IL 2 ) stimulates T lymphocyte proliferation and induces the expression of proliferating cell nuclear antigen ( PCNA ) , a processivity factor for DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , the number of myocyte nuclei exhibiting DNA strand breaks , as well as the frequency of myocytes labeled by PCNA and Fas protein , was determined . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In vivo administration of transforming growth factor beta 1 , an inhibitor of DNA synthesis in regenerating liver , resulted in reduced expression of Rb as well as its protein partners , cell cycle dependent kinase 4 and cyclin E . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Northern blot analysis indicates that cellular levels of cyclin A and CDC 2 mRNAs increase when DNA synthesis and H 4 gene expression are initiated , supporting involvement in cell cycle progression . ^^^ In the initial period , the levels of SP 1 and HiNF P are moderately elevated ; ATF , AP 1 , and HiNF M / IRF 2 are maximal during the second period ; while E2F and HiNF D , which contain cyclin A as a component , predominate during the third period , coinciding with maximal H 4 gene expression and DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results provide direct evidence that premature expression of cyclin B 1 can make cells more vulnerable to chemically induced uncoupling of mitosis from the completion of DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein of DNA polymerase delta and is considered to correlate with the cell ' s proliferative state . ^^^ Proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein of DNA polymerase delta and is considered to correlate with the cell ' s proliferative state . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a DNA damage inducible protein that performs an essential function in DNA replication and repair as an auxiliary factor for DNA polymerases delta and epsilon . ^^^ Examination of the human PCNA promoter DNA sequence revealed a site with homology to the consensus DNA sequence bound by p 53 . ^^^ These findings provide a mechanism whereby p 53 modulates activation of PCNA expression as a cellular response to DNA damage . . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a DNA damage inducible protein that performs an essential function in DNA replication and repair as an auxiliary factor for DNA polymerases delta and epsilon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
BACKGROUND : DNA replication and mitosis are triggered by activation of kinase complexes , each made up of a cyclin and a cyclin dependent kinase ( Cdk ) . ^^^ Thus , a cyclin B kinase that promotes DNA replication in G 1 phase cells can prevent re replication in G 2 phase cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These giant multinucleated cells were negative for [ 3H ] thymidine incorporation and displayed dispersed nuclear staining for proliferating cell nuclear antigen , indicating the absence of DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
At both the DNA and protein levels , the predominant sites of cyclin A 2 expression were in the germ line stem cells , the spermatogonia , and in highest levels in preleptotene spermatocytes , cells in which premeiotic DNA synthesis occurs . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen is an antibody against DNA polymerase delta , which is expressed in late G 1 through S phase of the cell cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we present a three parameter flow cytometric assay based on the simultaneous detection of cytokeratin , DNA and a proliferation associated marker , such as BrdUrd , PCNA or Ki 67 Ag . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Identification of the interphase stages was performed in single cells using DNA quantification by cytometry for the G 1 and G 2 phases while the S phase was identified by immunolabelling of the proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These data support the roles of CDK 2 and cdc 2 at G1 / S and G2 / mitosis transitions , respectively . ( 3 ) We were unable to demonstrate in individual cells a strict association between the nuclear appearance of cyclin A and G1 / S transition , and an association of cyclin A and CDK 2 with PCNA stained DNA replication sites . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It was found to have the properties typical for this type of DNA polymerase from higher eukaryotes with regard to effectors , template primer acceptance , co purification with 3 ' 5 ' exonuclease activity , as well as the effect of endogenous proliferating cell nuclear antigen ( PCNA ) from amoebae on the stimulation and processivity of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Administration of the nucleoside and nucleotide mixture resulted in significantly higher residual jejunal total and mucosal weights , proteins , DNA , RNA contents , and the ratio of proliferating cell nuclear antigen positive cells per crypt than did the standard TPN solution on d 7 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The authors examined three cell biological parameters DNA status , proliferating cell nuclear antigen ( PCNA ) immunostaining , and argyrophilic nucleolar organizer region ( AgNOR ) counts in surgically resected , formalin fixed , paraffin embedded urachal adenocarcinomas from 41 patients . ^^^ A study in 41 specimens of DNA status , proliferating cell nuclear antigen immunostaining , and argyrophilic nucleolar organizer region counts . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Leiomyosarcoma versus bizarre and cellular leiomyomas of the uterus : a comparative study based on the MIB 1 and proliferating cell nuclear antigen indices , p 53 expression , DNA flow cytometry , and muscle specific actins . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) expression is required for DNA replication . ^^^ Flow cytometric analysis was used to measure cellular DNA content with dual labeling of PCNA . ^^^ Proliferating cell nuclear antigen ( PCNA ) expression is required for DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Clinicopathologic variables , carcinoembryonic antigen ( CEA ) , nuclear DNA ploidy , and proliferating cell nuclear antigen labeling index ( PCNA LI ) have been studied for their effect on patients with various types of cancer . ^^^ Thirteen clinicopathologic variables , preoperative serum CEA levels , PCNA LI , DNA ploidy patterns , and survival were studied for 57 colorectal carcinoma patients , and the mutual relation between these variables , tumor progression , and survival were analyzed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Several fixatives proved to be suitable for the immunocytochemical detection of statin ; among them , 70 % ethanol was selected because this fixation procedure is suitable for DNA staining with intercalating dyes and is routinely used for the immunolabeling of proliferation markers ( such as proliferating cell nuclear antigen [ PCNA ] and Ki 67 ) and of bromodeoxyuridine ( BrdUrd ) incorporation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Bivariate flow cytometric analysis of DNA content and cyclin B 1 expression showed that , following 2 and 5 Gy , the fraction of cyclin B 1 expressing cells was superimposable upon that of G2M cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The results were compared with the expression of human papillomavirus ( HPV ) DNA subgroups ( 6 / 11 ( low risk ) and 16 / 18 / 31 / 33 / 35 ( high risk ) of the lesions , as determined by dot blot and in situ hybridization , and with epithelial cell proliferation as determined by immunohistochemistry for PCNA . ^^^ However , moderate or strong PCNA staining in vascular endothelial cells was seen significantly more often in CIN 2 3 lesions than in condylomas and CIN 1 lesions ( p = 0 . 008 ) : 34 / 80 ( 45 % ) cases contained detectable HPV DNA as determined by dot blot or in situ hybridization . ^^^ There was no correlation between the presence or absence of HPV DNA and the number of PCNA positive endothelial cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
TSH pretreatment induced the expression of G 1 cyclin in FRTL 5 cells , and IGF 1 caused the accumulation of enough G 1 cyclins to drive the cell cycle from G 1 to S phase in a short time , which accounts for the effect of TSH on IGF 1 induced DNA synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Distribution of episomal HBV DNA and proliferating cell nuclear antigen in liver specimens was assessed by simultaneous in situ hybridization and immunohistochemistry . ^^^ In vivo studies showed an inverse correlation between expression of proliferating cell nuclear antigen and presence of episomal HBV DNA in individual hepatocytes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , a cell cycle regulated protein , has been recently characterized as the cofactor of DNA polymerase delta , an enzyme required for DNA replication . ^^^ Proliferating cell nuclear antigen ( PCNA ) , a cell cycle regulated protein , has been recently characterized as the cofactor of DNA polymerase delta , an enzyme required for DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Twenty six of the 105 major ORFs resembled genes in the databases including three chitinases , a chitosanase , three serine / threonine protein kinases , two additional protein kinases , a tyrosine protein phosphatase , two ankyrins , an ornithine decarboxylase , a copper / zinc superoxide dismutase , a proliferating cell nuclear antigen , a DNA polymerase , a fibronectin binding protein , the yeast Ski 2 protein , an adenine DNA methyltransferase and its corresponding DNA site specific endonuclease , and an amidase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Elevated cyclin B 1 levels could then account for the observed abrogation of the cell cycle checkpoint , which usually assures that mitosis does not proceed until DNA replication is complete . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The main cellular factors which are activated by DNA damage and interfere with the cell cycle controls are : p 53 , delaying the transition through the G 1 S boundary ; p21WAF1 / CIP1 , preventing the entrance into S phase ; proliferating cell nuclear antigen ( PCNA ) and replication protein A ( RPA ) , blocking DNA replication ; and the p 53 variant protein p 53 as together with the retinoblastoma protein ( Rb ) , with less defined functions during the G 2 phase of the cell cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To get more insight into the role of 11q13 amplification in bladder tumour development , we have studied the level of amplification and expression of 4 ( protoonco ) genes lying within the amplicon ; cyclin D 1 , FGF 3 , FGF 4 and EMS 1 DNA amplification was found in 5 / 46 tumours . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Modified citrus pectin ( MCP ) added to the media of cultured androgen independent human prostatic JCA 1 cells reduced cell growth and correspondingly [ 3H ] thymidine incorporation into DNA , which was correlated with the down regulation of cyclin B and p34cdc2 MCP also induced distinct increases in specific endogenous phosphoproteins , including a cAMP stimulated 52 , 000 ( 52 kDa ) protein . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The authors observed that approximately 50 % of ESCC cell lines with cyclin D 1 DNA amplification also had RNA and protein overexpression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Repair Defect in p 21 WAF1 / CIP1 / human cancer cells . p 53 induction and cell cycle arrest occur following DNA damage , possibly to allow repair prior to replication . p21WAF1 / CIP1 , a cyclin cyclin dependent kinase inhibitor and proliferating cell nuclear antigen interacting protein , is induced by p 53 and mediates the cell cycle arrest . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The expression of proliferating cell nuclear antigen ( PCNA ) at least in its insoluble form , is restricted to cells shortly after and during DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Traverse of the G1 / S phase boundary and the initiation of DNA replication require functional cyclin E cyclin dependent kinase ( Cdk ) 2 and cyclin A Cdk 2 complexes ; however , the mechanisms by which PDGF and PPP regulate Cdk 2 activation are not known . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The level of the G1 / S cyclin , cyclin A , as well as of the G 1 phase cyclin , cyclin D 3 , were elevated at the onset of DNA synthesis , either in MegT cells undergoing a mitotic cell cycle or during endomitosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 overexpression is a feature of typical parathyroid adenomas and is not confined to unusually large , symptom causing adenomas as had been suggested by early DNA studies . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , the expression of PCNA was significantly increased in 0 . 1 and 1 microM paclitaxel treated cells , suggesting that DNA repair was increased in these cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Deletion of the fission yeast mitotic B type cyclin gene cdc 13 causes cells to undergo successive rounds of DNA replication . ^^^ These data suggest that a single oscillation of p34cdc2 kinase activity provided by a single B type cyclin can promote ordered progression into both DNA replication and mitosis , and that the level of cyclin dependent kinase activity may act as a master regulator dictating whether cells undergo S phase or mitosis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using cyclin D 1 and incorporation of bromodeoxyuridine as markers of respectively , G 1 and S phase , we show that PC 12 cultures can have a considerable amount of tetraploid cells which , when in the G 1 phase , have a 4c DNA content and express cyclin D 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , an auxiliary factor of DNA polymerase delta , is required for cell proliferation . ^^^ Proliferating cell nuclear antigen ( PCNA ) , an auxiliary factor of DNA polymerase delta , is required for cell proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a 36 kD nuclear protein involved in DNA replication that is believed to provide an indication of proliferation in some neoplasms . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a 36 kD nuclear protein involved in DNA replication that is believed to provide an indication of proliferation in some neoplasms . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunohistochemical detection of PCNA revealed its cooccurrence with HPV 16 DNA in cancer cells . ^^^ Detection of human papillomavirus DNA sequences in oral squamous cell carcinomas and their relation to p 53 and proliferating cell nuclear antigen expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin dependent kinase inhibitor p21Cip1 / Waf1 is responsible for the p 53 dependent growth arrest of cells in G 1 phase following DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factor C apparently mediates the interaction of DNA polymerase delta in the complex with proliferating cell nuclear antigen , through an ATP dependent mechanism . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Oligonucleotide antisense to human proliferating cell nuclear antigen mRNA specifically reduced DNA synthesis ( P < . 01 ) and proliferating cell nuclear antigen protein content ( P < . 05 ) in human VSMCs . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
For investigation of relative differences in mRNA expression levels and of correlations in the expression of genes possibly involved in multidrug resistance ( MDR ) of acute myelogenous leukemias ( AML ) , a complementary DNA polymerase chain reaction ( cDNA PCR ) analysis was established for the genes encoding MDR1 / P glycoprotein , the multidrug resistance associated protein ( MRP ) , topoisomerase 2 alpha , topoisomerase 2 beta , topoisomerase 1 , glutathione S transferase pi , protein kinase C ( PKC ) isozymes alpha , beta 1 , beta 2 , epsilon , eta , theta and cyclin A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
If so , this would suggest that modulation of PCNA activity may play an important role in plant responses to DNA damage and would imply that functional homologue ( s ) of p21WAF1 exist in plants . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cells treated with 0 or 5 Micron choline for 72h detached from the substrate in high numbers ( 58 % of choline deficient cells vs . 1 . 4 % of choline sufficient cells detached ) exhibited a high incidence of apoptosis ( apoptotic bodies were seen in 55 75 % of cells ; 67 73 % had DNA strand breaks ) , and an absence of mitosis and proliferating cell nuclear antigen ( PCNA ) expression . ^^^ By 72h , the cells grown in 0 or 5 Micron choline were forming DNA much more slowly than control cells ( assessed by thymidine incorporation , PCNA expression , and mitotic index ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Several different methods of measuring proliferation indices have been developed , including measurements of cellular DNA content ( flow cytometry ) , S phase incorporation of thymidine analogues into DNA ( e . g . , tritiated thymidine and 5 ' bromodeoxyuridine ) , and immunostaining of cell cycle restricted proteins ( e . g . , Ki 67 antigen and PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using consensus / CRE and proliferating cell nuclear Ag ( PCNA ) / CRE as probes in the DNA binding assay , we showed that a marked induction of CRE binding is associated with activation of splenic T lymphocytes with anti CD 3 Ab . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Mbp 1 , a transcription factor related to Swi 4 , forms the MCB binding factor complex with Swi 6 , which activates DNA synthesis genes and S phase cyclin genes CLB 5 and CLB 6 in late G 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A 39 amino acid fragment of the cell cycle regulator p 21 is sufficient to bind PCNA and partially inhibit DNA replication in vivo . ^^^ The cell cycle regulator p 21 interacts with and inhibits the DNA replication and repair factor proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The levels of cyclin D 1 increased 5 . 8 fold and Cdk 4 increased by 4 . 4 fold by 24 hours after reseeding the day 9 density arrested cultures , coincident with the increase in DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A significant difference was found between PAs and ACCs by site ( P < 0 . 01 ) and DNA ploidy ( P < 0 . 05 ) ; furthermore , all PCNA indices ( single index ) were significantly lower in PAs than in ACCs . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
MATERIALS AND METHODS : The immunoreactivity of p 53 , nuclear DNA content ( assessed by ploidy and 2c deviation index [ 2cDI ] ) and the expression of proliferating cell nuclear antigen ( PCNA ) in 17 IPs were evaluated using a computer assisted image analyser and compared with those in 12 superficial transitional cell carcinomas ( TCCs ) , 29 invasive TCCs and one inverted papillary TCC of the bladder . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Absence of somatic changes in p 21 gene in non Hodgkin ' s lymphoma and chronic myelogenous leukemia . p 21 is induced by and mediates the effects of p 53 in response to DNA damage arresting the cell in G 1 or G 2 , by inhibiting multiple cyclin cyclin dependent kinases ( CDK ) or binding to proliferating cell nuclear antigen ( PCNA ) , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Nerve growth factor and aphidicolin , an inhibitor of DNA polymerases , synergistically induce neuronal differentiation of SH SY5Y neuroblastoma cells and the expression of p21WAF1 , an inhibitor of cyclin dependent kinases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The imprints were subjected to fluorescence in situ hybridization analyses utilizing a biotin dUTP labeled genomic DNA probe for the cyclin D 1 gene ( CCND1 / PRAD1 ) and a digoxygenin labeled chromosome 11 alpha satellite probe to control for chromosomal copy number . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results may have implications for the NER process in vivo in that coordinately occurring dual incisions by XPG and XPF / ERCC1 proteins play an important role in inducing PCNA complex formation , but the step may not be required for PCNA dependent repair of 10 ray induced DNA damage . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is an essential component for the normal processive DNA synthesis by DNA polymerase delta and is also required for DNA excision repair . ^^^ A monoclonal IgG 2 PCNA antibody , 74B1 , that effectively inhibited DNA replication in vitro was identified . ^^^ Interestingly , a neighboring and partly overlapping peptide , aa 111 125 , contains an immunodominant region recognized by a number of monoclonal PCNA antibodies with no inhibitory effect on DNA synthesis . ^^^ The 74B1 antibody is a potentially useful antibody in future studies of PCNA and its interaction in complexes associated with cell cycle progress , DNA replication , and DNA repair . . ^^^ Proliferating cell nuclear antigen ( PCNA ) is an essential component for the normal processive DNA synthesis by DNA polymerase delta and is also required for DNA excision repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Within this region , we found three sequences identical or similar to the DNA replication related element ( DRE ) , 5 ' TATCGATA , which is known as a common promoter activating element for the Drosophila DNA polymerase alpha 180 kDa subunit gene and the proliferating cell nuclear antigen gene . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
By contrast , the R94W mutant was unaltered in its ability to promote cyclin CDK association as well as in its ability to bind proliferating cell nuclear antigen , thus leaving its putative functions as kinase activator or as inhibitor of replicative DNA synthesis intact . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Wild type Schizosaccharomyces pombe PCNA and PCNA proteins with mutations in Asp 63 , Gln 201 , Glu 259 , or Glu 260 to Ala were able to stimulate DNA synthetic activity and to enhance the processivity of calf thymus DNA polymerase delta holoenzyme similar to calf thymus PCNA . ^^^ Mutations of Leu 2 to Val or Arg 64 to Ala , either singly or as a double mutant , yielded PCNA mutant proteins that had reduced capacity in enhancing the processivity of DNA polymerase delta but showed no deficiency in stimulation of the ATPase activity of replication factor C . ^^^ Together , these in vitro and in vivo studies suggest that the side chains of Leu 2 and Arg 64 in one face of the PCNA trimer ring structure are two of the several sites involved in tethering DNA polymerase delta for processive DNA synthesis during DNA replication . . ^^^ Schizosaccharomyces pombe proliferating cell nuclear antigen mutations affect DNA polymerase delta processivity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Correlations of Ki 67 and PCNA to DNA ploidy , S phase fraction and survival in uveal melanoma . ^^^ In 79 patients with uveal melanoma , the tumours were investigated by DNA flow cytometry and immunohistochemical staining of PCNA and Ki 67 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The authors investigated the prognostic role of p 53 , c erbB 2 , proliferating cell nuclear antigen ( PCNA ) , and DNA flow cytometry in a pathobiological evaluation of a cohort of 30 patients with these neoplasms . ^^^ PCNA positivity ranged from 16 . 5 % to 91 . 0 % , with a mean of 49 . 5 % . p 53 immunopositivity , DNA aneuploidy , high growth , and proliferative fractions by PCNA and flow cytometry did not correlate with patient outcome . ^^^ Prognostic significance of biomarkers ( c erbB 2 , p 53 , proliferating cell nuclear antigen , and DNA content ) in salivary duct carcinoma . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin dependent kinases regulate the progression of eukaryotic cells through the cell cycle . p21Cip1 / Waf1 / Sdi1 is an inhibitor of cdk cyclin kinase activity , and has been shown to form complexes with cdk cyclins and with PCNA , an accessory protein of DNA polymerase delta . ^^^ Cyclin dependent kinases regulate the progression of eukaryotic cells through the cell cycle . p21Cip1 / Waf1 / Sdi1 is an inhibitor of cdk cyclin kinase activity , and has been shown to form complexes with cdk cyclins and with PCNA , an accessory protein of DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Newly assembled cyclin B cdc 2 kinase is required to suppress DNA replication between meiosis 1 and meiosis 2 in starfish oocytes . ^^^ Micro injection of catalytically inactive GST cdc 2 K33R or GST cdk 2 K33R fusion proteins , each of which efficiently titrates cyclin B in oocytes and prevents assembly of cyclin B cdc 2 complexes , readily induces premature DNA replication in starfish oocytes after emission of the first polar body . ^^^ Moreover , partial ablation of cyclin B mRNA by micro injection of antisense oligonucleotides facilitates premature DNA replication induced by the dominant negative cdc 2 and cdk 2 mutant proteins . ^^^ We thus propose that enhanced translation of cyclin B after GVBD , a universal feature of oocyte maturation in the animal kingdom , and subsequent assembly of cyclin B cdc 2 complexes , are part of the checkpoint that prevents DNA replication in the oocyte after emission of the first polar body . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Subcellular distribution of p 21 and PCNA in normal and repair deficient cells following DNA damage . ^^^ Biochemical studies have shown that the direct interaction between p 21 and PCNA blocks the latter ' s function in DNA replication but not in DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The DNA index , expression of cell cycle related proteins proliferating cell nuclear antigen ( PCNA , cyclin ) and Ki 67 and the content of silver binding nucleolar organizer regions ( AgNORs ) were evaluated in 30 unselected consecutive primary squamous cell carcinomas of the larynx . ^^^ No significant correlation was found among DNA index , PCNA and Ki 67 expressions , and AgNOR counts . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Three direct assays , polyacrylamide gel electrophoresis band mobility shift , agarose gel electrophoresis band mobility shift , and nitrocellulose filter binding , were established to study complexes formed among mammalian DNA polymerase delta ( pol delta ) , proliferating cell nuclear antigen ( PCNA ) , and synthetic oligonucleotide template primers . ^^^ The mammalian DNA polymerase delta proliferating cell nuclear antigen template primer complex : molecular characterization by direct binding . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
During the last few years it has become possible to label total nuclear DNA ( Feulgen ) , synthesized DNA ( BrdU ) , specific A / T versus G / C rich DNA , cell cycle proteins ( PCNA , Ki 67 ) , hormonal receptors ( ER , PR , EGF ) , cdc genes and gene primary transcripts , etc . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) as an auxillary protein for DNA polymerase gamma is an evolutionarily conserved molecule that may be detected in human and animal frozen or paraffin embedded tissues . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
High expression of tumor proliferation related factors ( Ki 67 , PCNA , and AgNOR ) , abnormalities of adhesion molecule ( E Cadherin , alpha Catenin ) , activation of autocrine mechanism of growth factor ( EGFR TGF alpha , EGF ) , and DNA ploidy pattern , which is thought to be the result of an accumulation of genomic abnormalities are also prognostic factors for esophageal cancer . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Novel alterations in CDK1 / cyclin B 1 kinase complex formation occur during the acquisition of a polyploid DNA content . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In eukaryotes the ring shaped homotrimeric protein , proliferating cell nuclear antigen ( PCNA ) , ensures tight template polymerase interaction by encircling the DNA strand . ^^^ Proliferating cell nuclear antigen is loaded onto DNA through the action of RFC in an ATP dependent reaction . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It is also shown that MyD 118 is a nuclear protein , which regardless of the pathway induced , predominantly localized within the cell nucleus , and interacted with the DNA replication and repair protein PCNA and the cyclin dependent kinase inhibitor P21WAF1 / CIP1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Ablation occurred in the absence of thyrocyte proliferation or nuclear DNA synthesis , but was accompanied by transient expression of proliferating cell nuclear antigen and the dying thyrocytes exhibited the ultrastructural features of apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Interestingly , reduction of up to 90 % of p 27 protein expression increased both basal and serum stimulated gene transcription of cyclin D 1 , cyclin A , dihydrofolate reductase , and DNA synthesis reinitiation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These breaks activate a p 53 dependent or independent DNA damage pathway that leads to the induction of a family of inhibitors of cyclin dependent kinases ( including p 21 and p 16 ) and the eventual G 1 block of senescence . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition p21WAF1 / CIP1 associates with PCNA and inhibits DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In CD pretreated rats , CCl 4 induced toxicity progressed with time culminating in 25 and 100 % mortality by 72 h after CCl 4 in 45 and 60 day rats , respectively , in contrast to regression of CCl 4 induced toxicity and 0 % mortality in 20 day rats . [ 3H ] Thymidine ( 3H T ) incorporation and proliferating cell nuclear antigen ( PCNA ) studies revealed an association between delayed and diminished DNA synthesis , unrestrained progression of liver injury , and animal death . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Possible predictive indicators include DNA ploidy , Tpot , EGFR and cyclin D 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Nuclear DNA contents and the labeling index of proliferating cell nuclear antigen ( PCNA ) were measured as well . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin B dependent kinases have conserved roles in both Saccharomyces cerevisiae and Schizosaccharomyces pombe , switching on DNA replication in G 1 and preventing re replication in G 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Inhibited cells had a 2C DNA content and were judged by cytology and pulsed field gel electrophoresis to be in the G 2 phase of the cell cycle . p21Cip1 accumulated in the nucleus and was associated with p34cdc2 and PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Since cyclin D 1 codes for a critical regulatory protein for progression of the G 0 to G 1 phase in the cell cycle and we did not observe prominent occurrence of DNA fragmentation in microglial cells in the hippocampus at time points when cyclin D 1 messenger RNA was found , we suggest that cyclin D 1 induction is involved in the onset of microglial cell proliferation . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin dependent kinase 7 : at the cross roads of transcription , DNA repair and cell cycle control . ^^^ Subsequently , both CDK 7 and its partner , cyclin H , were found to be associated with the general transcription factor TFIIH , suggesting additional roles for CDK 7 in transcription and DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin destruction was followed by nuclear reassembly and an additional round of DNA replication , indicating that there is no protein synthesis requirement for DNA replication in this embryonic system . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Since Proliferating Cell Nuclear Antigen ( PCNA ) and DNA cytometry have shown a good correlation between premalignant lesions and their progressive potential towards full fledged carcinoma in the larynx as described in part 1 of this work , we have analyzed the PCNA index and DNA cytometry in specimen taken from vocal chord carcinomas with a 5 year follow up , in order to assess its relationship with the presence or absence of tumour progression . 42 cases with ( 21 ) and without ( 2 ) recurrence have been examined . ^^^ Furthermore the high correction between PCNA and DNA index is of special interest for single case assessment . ^^^ High DNA aberration and PCNA index in vocal chord carcinoma may indicate a higher cellular aggressiveness of the tumour , resulting in a greater overall risk of metastases and local recurrences . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using PC 10 , an antibody to PCNA and a standard immunohistochemical staining , we examined 11 cases of simple hyperplasia of epithelium ( SHE ) , 32 cases of atypical hyperplasia of epithelium ( AHE ) and 42 cases of laryngeal squamous cell carcinoma ( LSCC ) for expression of PCNA , a protein associated with DNA polymerase delta and DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Yeast proliferating cell nuclear antigen ( yPCNA ) is a cell cycle regulated protein that has been shown to be required for the efficient elongation of primed DNA templates by DNA polymerase delta in vitro . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Measurements made by computer assisted image analysis that are potentially useful as surrogate endpoint biomarkers include nuclear polymorphism comprising nuclear size , shape ( roundness ) , and texture ( DNA distribution patterns ) ; nucleolar size and number of nucleoli / nuclei ; DNA ploidy , and proliferation biomarkers such as S phase fraction and PCNA . . . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression of these gene products was examined in 69 formalin fixed , paraffin embedded cervical biopsies by immunohistochemistry utilizing antibodies against p 53 , Rb , and proliferating cell nuclear antigen ( PCNA ) and by human papillomavirus DNA in situ hybridization assays . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis in the testes of infertile men with varicocele image cytometeric analysis of proliferating cell nuclear antigen ] . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
At or shortly after Start , the development of B type cyclin Clb Cdc 28 kinase activity and initiation of DNA replication requires the destruction of p40SIC1 , a specific inhibitor of the Clb Cdc 28 kinases . 1 report here that cln cells are rendered viable by deletion of SIC 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin dependent kinase ( Cdk ) inhibitor p 21 is induced by the tumor suppressor p 53 and is required for the G 1 S block in cells with DNA damage . ^^^ Peptides containing only the Cy 1 or Cy 2 motif partially inhibit cyclin Cdk kinase activity in vitro and DNA replication in Xenopus egg extracts . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Yeast genetics have implicated three important genes involved in DNA ploidy changes : cdc 2 , cyclin b , and a specific inhibitor of the p 34 ( cdc 2 ) / cyclin B kinase , rum 1 . ^^^ It was proposed that the inactivation of the mitotic kinase complex , p 34 ( cdc 2 ) / cyclin B , induces a G ( 1 ) , state wherein the cells re replicate their DNA without an intervening mitosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Thirty six six week old female C57BI / 6J mice were injected intraperitoneally with two doses of allyl alcohol on day 0 and tissue sections were taken at various times and stained by haematoxylin and eosin or immunostained for proliferating cell nuclear antigen ( PCNA ) , bile duct / oval cell marker A 6 , and DNA fragments ( apoptosis ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The aim of the present study is to characterise the cell kinetics of pleomorphic adenoma of the parotid gland by assessing DNA content and proliferating cell nuclear antigen ( PCNA ) positivity . ^^^ In 22 parotid adenomas , DNA content was measured by densitometry in histological serial sections stained with Feulgen ' s method and PCNA positivity was determined by immunohistochemistry with the monoclonal antibody PC 10 . ^^^ To assess the proliferative activity , DNA index and PCNA index were evaluated . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The data also indicate that PCNA immunostaining does not reflect the true proliferation state in the early phase after AOM exposure , probably due to the occurrence of cell cycle arrest or DNA repair . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
However , the expression levels of PCNA in cervical cancers were not influenced by the presence of oncogenic HPV DNA or pathologic metastasis in the pelvic lymph nodes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We utilized an antibody to proliferating cell nuclear antigen ( PCNA ) staining to determine which cells were in active DNA synthesis ( S phase ) during fetal development and liver disease progression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using these antibodies together with those for DNA polymerase alpha and proliferating cell nuclear antigen ( PCNA ) , we examined expression patterns and sub cellular distributions of these proteins during Drosophila development . ^^^ DNA polymerase alpha , epsilon and PCNA proteins were maternally stored in unfertilized eggs and maintained at high levels during embryogenesis . ^^^ Since DNA polymerase alpha , epsilon and PCNA are hardly detectable in adult males , DREF very likely regulates genes other than those closely linked to DNA replication in adult males . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Sixty molar and nonmolar placentas with hydropic features [ 23 complete moles , 14 partial moles , 8 moles not further classified , and 15 hydropic , nonmolar placentas ] were evaluated immunohistochemically for expression of Ki 67 , proliferating cell nuclear antigen ( PCNA ) , and p 53 , and the results were compared with DNA ploidy and S phase fractions derived from flow cytometric analysis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) acts as a processivity factor for replicative DNA polymerases and is essential for DNA replication . ^^^ However , because of the lack of genetic evidence , it is not clear which of the DNA repair processes are in fact affected by PCNA in vivo . ^^^ Here , we describe a PCNA mutation , pol 30 46 , that confers ultraviolet ( UV ) sensitivity but has no effect on growth or cell cycle progression , and the mutant pcna interacts normally with DNA polymerase delta and epsilon . ^^^ These results implicate a role for PCNA as an intermediary between DNA replication and postreplicational DNA repair . . ^^^ Requirement of proliferating cell nuclear antigen in RAD 6 dependent postreplicational DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Evaluation of DNA content by flow cytometry and by cytophotometry , AgNOR technique , and immunohistochemical detection of antigens in cycling cells such as the Ki 67 antigen and proliferating cell nuclear antigen ( PCNA ) have been applied to a variety of benign and malignant salivary gland tumors in only few studies so far . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The MRC were shown to contain DNA polymerases alpha and delta , DNA primase , DNA helicase , DNA ligase , and topoisomerases 1 and 2 , as well as accessory proteins such as PCNA , RF C , and RP A . ^^^ Finally , immunoblot analysis of MRCs from both cell types with monoclonal antibodies to poly ( ADP ribose ) revealed the presence of approximately 15 poly ( ADP ribosyl ) ated proteins , some of which were further confirmed to be DNA polymerase alpha , DNA topoisomerase 1 , and PCNA by immunoprecipitation experiments . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Expression plasmids containing either the neomycin resistance gene and the complementary DNA sequence encoding human cyclin D 1 or the neomycin resistance gene only ( control ) were transfected by lipofection into the human HT 1080 fibrosarcoma cell line , and cell colonies resistant to the antibiotic neomycin ( G 418 ) were isolated . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A , D 2 , D 3 , and E genes never , or only on rare occasions , showed increased DNA copy numbers and were never found overexpressed at the RNA level . ^^^ Cyclin D 1 DNA amplification was much less frequent in ovarian than in breast tumors ( 3 . 3 % vs . 12 . 6 % ) , whereas cyclin E amplification and overexpression were observed in a significant number of cases ( 12 . 5 % and 18 . 0 % respectively ) . ^^^ Cyclin A , cyclin D 2 and D 3 rarely showed anomalies at the DNA level and were never overexpressed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In order to determine whether the activation of Ras by TGFbeta was required for the growth inhibitory effect of TGFbeta , we examined TGFbeta 2 effects on Cdk 2 associated histone H 1 kinase activity , cyclin A protein expression levels , and DNA synthesis in two intestinal epithelial cell clones transfected with RasN 17 . ^^^ In cells expressing RasN 17 , we observed a 50 % reversal of the inhibition of Cdk 2 activity , a 78 % reversal of the down regulation of cyclin A protein expression , and a 21 % reversal of the inhibition of DNA synthesis by TGFbeta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Xenopus cyclin E , a nuclear phosphoprotein , accumulates when oocytes gain the ability to initiate DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Affinity depletion of cyclin dependent kinases ( Cdks ) from these extracts blocks the initiation of DNA replication . ^^^ High concentrations of cyclin A promoted entry into mitosis , which inhibited DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Reduced cyclin D 1 expression in the cerebella of nutritionally deprived rats correlates with developmental delay and decreased cellular DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin dependent kinase 2 ( Cdk 2 ) is required for initiation and progression of DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Characterisation of human cyclin G 1 and G 2 : DNA damage inducible genes . ^^^ Both human G cyclins are induced by the DNA damaging agent actinomycin D and although the induction of cyclin G 1 is clearly p 53 dependent , activation of cyclin G 2 expression was observed in the absence of p 53 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Tumor suppressor p 53 is a nuclear protein that is induced by DNA damage and is involved in G 1 and G 2 phase control of the cell cycle . p21WAF1 / CIP1 / SDI1 ( p 21 ) , a cyclin dependent kinase inhibitor , is a downstream target and effector of p 53 to induce G 1 arrest . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The PCNA and YC genes appear to be single copy and may overlap in their 3 ' regions on opposite DNA strands . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Forty six human renal cell carcinoma tissues obtained from radical nephrectomy , fixed in 10 % formaldehyde solution and embedded in paraffin for histopathological examination were used for immunohistochemical staining of proliferating cell nuclear antigen ( PCNA ) using a monoclonal antibody PC 10 , and 37 of the 46 were also used for flow cytometric DNA ploidy analysis . ^^^ The relationships between the DNA ploidy and PCNA positive rates and patient survival were also determined . ^^^ No relationship was observed between the PCNA positive rate and DNA ploidy . ^^^ But for patients with histopathological stage 1 and grade 1 tumors , the PCNA positive rates and DNA ploidy did not provide independent prognostic information . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The evaluation of each biopsy included quantitative DNA measurements based on image analysis , immunohistochemical assessment of proliferations markers ( i . e . , Ki 67 MIB1 , proliferating cell nuclear antigen [ PCNA ] ) , and morphological tumor front grading . ^^^ There was good correlation between DNA data and proliferative cell fractions ( Ki 67 score , PCNA score ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is an accessory protein of DNA polymerase delta . ^^^ The athymic mouse xenograft model of HPV 11 infection was used to test the hypothesis that PCNA is induced early in the course of HPV 11 infection and to study the temporal and histologic relationships between detection of PCNA and HPV DNA . ^^^ PCNA was as or more abundant in implants removed at earlier time points than at later time points , whereas HPV DNA became increasingly more abundant with time . ^^^ PCNA was detected only in basal cells in areas of histologically normal epithelium that were also negative for HPV DNA . ^^^ In contrast , PCNA was present throughout the epithelium in regions that were HPV DNA positive . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PDGF BB induced an increase in mRNA levels of cyclin D 1 , cyclin dependent kinase ( cdk ) 4 , and cdk 2 , as well as the activity of cdk 2 , which preceded the G1 / S boundary , as estimated by the kinetics of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PURPOSE : This study was undertaken to determine if proliferating cell nuclear antigen ( PCNA ) , p 53 , DNA ploidy , and S phase fraction are associated with response to radiation and / or risk for distant metastatic disease and to determine if these cellular markers are best evaluated from preradiation biopsy specimen or the larger ( but possibly altered ) final surgical specimen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin B1 / Cdc2 kinase activity decreased after BFA treatment in HL 60 cells , indicating that BFA induced DNA fragmentation was independent of a cyclin B1 / Cdc2 kinase upregulation pathway . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Changes in cyclins and cyclin dependent kinases induced by DNA damaging agents in a human ovarian cancer cell line expressing mutated or wild type P 53 . ^^^ Treatment with DX or AMSA caused similar effects , suggesting that p 53 induced changes in cyclin , cdk , and cdk inhibitors after DNA damage are not responsible for the marked reduction in the cytotoxicity of DX we observed in wt p 53 expressing cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The calphostin C induced inhibition of PKC activity was accompanied by changes in the expression of proliferating cell nuclear antigen ( PCNA ) a protein known to participate in regulation of DNA replication and repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
One protein requisite for DNA synthesis is proliferating cell nuclear antigen ( PCNA ) . ^^^ The events involving PCNA correlated closely with the time period when cell division and then DNA synthesis ceased in these cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RFC is required , along with the proliferating cell nuclear antigen and DNA polymerase delta , for the synthesis of the leading strand during DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Staurosporine resistance accompanies DNA tumor virus induced immortalization and is independent of the expression and activities of ERK 1 , ERK 2 , cyclin A , cyclin dependent kinase ( cdk ) 2 , and cdk 4 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Tissue regeneration response was measured by 3H thymidine incorporation into hepatonuclear DNA and by proliferating cell nuclear antigen ( PCNA ) assay . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition to this action , we show here that cyclin E has an essential role in DNA replication distinct from activating E2F . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We implicate the cell cycle regulator cyclin E in DNA under representation by identifying a hypomorphic , female sterile cycE mutation , cycE 01672 , that increases the amount of satellite DNA propagated in nurse cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Comparative flow cytometric analysis of DNA bound PCNA and DNA content as estimators of S phase cells in cell cultures . ^^^ Measurements of the S fraction estimated from bivariate PCNA / DNA analysis after detergent extraction of DNA non bound PCNA were compared with those obtained from total DNA histograms ( Vindelv and Christensen ' s technique , methanol fixed whole cells and PCNA extracted nuclei ) . ^^^ Because of these shortcomings , and the fact that is more costly and time consuming , the estimation of the S phase fraction by means of bivariate DNA bound PCNA / total DNA flow cytometric studies does not seem to surpass that obtained from standard DNA cell cycle analyses . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition to its inhibition of CDK enzymes and proliferating cell nuclear antigen function in DNA replication , these studies reveal a novel mechanism by which p 21 mediates growth arrest : direct interaction with E2F complexes and negative regulation of E2F transcription factor activity . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Stage specific expression of proliferating cell nuclear antigen and DNA polymerase delta from Plasmodium falciparum . ^^^ Antisera raised against proliferating cell nuclear antigen ( PfPCNA ) and DNA polymerase delta ( PfDNA Pol delta ) have been used against extracts from synchronised parasites to show that both proteins accumulate in trophozoites and persist in schizonts . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Loss of chromosome arm 9p DNA and analysis of the p 16 and p 15 cyclin dependent kinase inhibitor genes in human parathyroid adenomas . ^^^ Because inactivation of the p 16 or p 15 genes might be expected to result in oncogenic consequences similar to those from cyclin D 1 overexpression , we examined 25 parathyroid adenomas for 1 ) allelic loss of polymorphic DNA loci on chromosome arm 9p , 2 ) homozygous deletions of the p 16 and p 15 genes by Southern blot analysis , and 3 ) mutations of the p 16 and p 15 genes by single strand conformational polymorphism analysis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Requirement for PCNA in DNA mismatch repair at a step preceding DNA resynthesis . ^^^ The data suggest a PCNA requirement in mismatch repair at a step preceding DNA resynthesis . ^^^ The ability of PCNA to bind to MLH 1 and MSH 2 may reflect linkage between mismatch repair and replication and may be relevant to the roles of mismatch repair proteins in other DNA transactions . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study , the authors determined the prognostic significance of proliferating cell nuclear antigen ( PCNA ) , p 53 protein , and nm 23 protein , as well as nuclear DNA content in specimens with TCC of the bladder . ^^^ PCNA expression , p 53 protein and nm 23 protein immunoreactivities , and the parameters for nuclear DNA content such as 2c deviation index ( 2cDI ) and 5c exceeding rate ( 5cER ) were evaluated using a computer assisted image analyzer , and the results were compared with histologic findings and clinical outcome . ^^^ Immunohistochemical analysis of proliferating cell nuclear antigen , p 53 protein and nm 23 protein , and nuclear DNA content in transitional cell carcinoma of the bladder . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A conserved domain of the large subunit of replication factor C binds PCNA and acts like a dominant negative inhibitor of DNA replication in mammalian cells . ^^^ The PCNA binding domain of RF Cp 145 inhibits several functions of RF C , such as : ( 1 ) in vitro DNA replication of SV 40 origin containing DNA ; ( 2 ) RF C dependent loading of PCNA onto DNA ; and ( 3 ) RF C dependent DNA elongation . ^^^ The PCNA binding domain of RF Cp 145 localizes to the nucleus and inhibits DNA synthesis in transfected mammalian cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Neither cyclin A nor cyclin D is induced , and cellular DNA synthesis does not occur if one takes care to avoid addition of fresh serum to serum starved cultures . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The liver regenerative process was estimated 24h after PH . [ 3H ] thymidine incorporation into liver DNA , liver thymidine kinase ( TK ) activity , mitotic index and proliferating cell nuclear antigen ( PCNA ) immunostaining were used as indices of hepatocyte proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Differences in cyclin expression make it possible to discriminate between cells having the same DNA content but residing at different phases such as in G 2 vs . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin dependent kinase ( Cdk ) inhibitor p21Waf1 / Cip1 / Sdi1 , important for p 53 dependent cell cycle control , mediates G1 / S arrest through inhibition of Cdks and possibly through inhibition of DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Hence , DNA replication dependent histone H 4 genes are regulated by an E2F independent mechanism involving a complex of CDP / cut with cyclin A / CDC2 / RB related proteins . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Therefore , the polymerase delta PCNA Fen 1 complex has all the activities associated with prokaryotic DNA polymerases involved in replication : 5 ' 3 ' polymerase , 3 ' 5 ' exonuclease , and 5 ' 3 ' exonuclease . ^^^ Although p 21 , a regulatory protein induced by p 53 in response to DNA damage , interacts with PCNA with a comparable Kd ( 10 nM ) and a stoichiometry of three molecules of p 21 per PCNA trimer , a p 21 PCNA Fen 1 complex is not formed . ^^^ Cip1 / Waf1 disrupts the recruitment of human Fen 1 by proliferating cell nuclear antigen into the DNA replication complex . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In these latter systems , the highest nuclear concentrations of the WT protein are always found in G 1 cells that still fail to exhibit a high rate of nuclear cyclin A ; past the G 1 S transition , the nuclear level of WT p 53 tends to decrease , possibly to the benefit of cytoplasmic expression , whereas that of cyclin A concomitantly increases , suggesting that the nuclear accumulation of WT p 53 becomes restricted during the phase of DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In a retrospective study of 60 spindle cell sarcomas of peripheral soft tissues , we evaluated the extent of immunostaining with antibodies against Ki 67 , proliferating cell nuclear antigen , and p 53 protein and flow cytometric DNA ploidy , their relation to tumor location , depth , histologic type , size , mitotic rate , and extent of tumor necrosis , as well as their influence on survival . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using a yeast two hybrid interactive screen , we have now isolated a novel cyclin D interacting myb like protein ( designated DMP 1 ) , which binds specifically to the nonamer DNA consensus sequences CCCG ( G / T ) ATGT to activate transcription . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Although CycAc 1 was classified as an A like cyclin , the failure to detect CycAc 1 mRNA at the onset of the S phase suggests that CycAc 1 might not play a role in the replication of DNA during the S phase . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Thus , our results show that PCNA plays an essential role in both DNA replication and DNA repair in vivo . . ^^^ In vivo analysis reveals that the interdomain region of the yeast proliferating cell nuclear antigen is important for DNA replication and DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Their inhibitory action concerns a large range of cyclin / CDK complexes involved in G 1 and S phase . p21Waf1 , induced in part by p 53 , is up regulated by senescence , DNA damage and cellular differentiation . p21Waf1 forms quaternary complexes with CDKs , cyclins and PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Recently , two important cancer pathways implicated in the genesis of multiple tumor types have also been inculpated in esophageal carcinogenesis : the cyclin kinase inhibitor cascade and the DNA mismatch repair process . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA digestion resulted in the almost complete release of PCNA from its binding sites , while only about 60 % of nuclear bound p 21 could be solubilized . ^^^ Immunoprecipitation of PCNA and p 21 released by enzymatic digestion showed that p 21 was associated with PCNA bound to late DNA repair sites . ^^^ These results indicate that during nucleotide excision repair , nuclear binding of PCNA precedes that of p 21 protein , and suggest that temporal association of p 21 with the detergent insoluble fraction is coincident with the disassembly of PCNA from DNA repair sites . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Delayed cyclin B 1 expression during the G 2 arrest following DNA damage . ^^^ Decreased transcription and stability of cyclin B 1 mRNA were shown to occur after treatment with these DNA damaging agents . ^^^ These results indicate that suppression of cyclin B 1 mRNA expression is one consequence of DNA damage in HeLa cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To elucidate the mechanism of this response , the induction of the replication enzymes DNA polymerases alpha , delta , epsilon , as well as proliferating cell nuclear antigen ( PCNA ) , were investigated in nonligated lobes after portal branch ligation . ^^^ From the similar changes in DNA polymerases and PCNA , our data indicate that portal branch ligation induces hepatocyte proliferation in the nonligated lobes in a way similar to partial hepatectomy . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Liver regeneration was estimated by 3H thymidine incorporation into hepatonuclear DNA and via proliferating cell nuclear antigen ( PCNA ) assay . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These data suggest that uninephrectomy reduces apoptotic cells and DNA fragmentation and enhances PCNA expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Used along with E1B to avert apoptosis , E2F 1 inhibited the cardiac and skeletal alpha actin promoters , serum response factor abundance , and sarcomeric actin biosynthesis , while inducing DNA synthesis and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) plays a pleiotropic role in DNA replication , excision repair of injured DNA and apoptosis . ^^^ These results suggest that expression of PCNA in non proliferating central neurones is associated with repair of injured DNA . . ^^^ Proliferating cell nuclear antigen ( PCNA ) plays a pleiotropic role in DNA replication , excision repair of injured DNA and apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Samples were immunolabeled for proliferating cell nuclear antigen or DNA strand breaks or stained with acridine orange . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) is essential for DNA replication , where it acts as a processivity factor . ^^^ Here , we identify a point mutation , pol 30 104 , in the Saccharomyces cerevisiae POL 30 gene encoding PCNA that increases the rate of instability of simple repetitive DNA sequences and raises the rate of spontaneous forward mutation . ^^^ Evidence for involvement of yeast proliferating cell nuclear antigen in DNA mismatch repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Partial DNA sequences demonstrated that 17 clones were distinct cellular genes , including those encoding the modulators of signal transduction ( saposin , 14 3 3 , adenylate kinase , adenylyl cyclase , protein kinase C alpha ) , those encoding the components of translation ( fau , ribosomal proteins S 11 , L 31 , L 36 ) , other cellular genes ( peptidase , cyclin E , rch 1 , oligo C rich single stranded nucleic acid binding protein , rap , arginyl tRNA synthetase ) , and two unknown genes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The inhibitors were found to suppress the phosphorylation of pRB , lead to the production of higher order E2F complexes , and suppress the expression of c myc and proliferating cell nuclear antigen ( PCNA ) to an extent that correlated with their ability to block DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The level of cellular proteins known to be associated with DNA synthesis such as PCNA and DNA primase were also investigated . ^^^ Concerning DNA polymerase B we have previously shown that PCNA stimulates its processivity . ^^^ Besides studying the changes of DNA polymerases A and B and DNA primase we have also studied changes in PCNA during germination . ^^^ After 48 h , the absence of PCNA is concomitant with an important decrease in DNA polymerase B activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Human replication factor C ( RFC , also called activator 1 ) is a five subunit protein complex ( p 140 , p 40 , p 38 , p 37 , and p 36 ) required for proliferating cell nuclear antigen ( PCNA ) dependent processive DNA synthesis catalyzed by DNA polymerase delta or epsilon . ^^^ The purified baculovirus produced RFC appears to contain equimolar levels of each subunit and was shown to be functionally identical to its native counterpart in ( 1 ) supporting DNA polymerase delta catalyzed PCNA dependent DNA chain elongation ; ( 2 ) catalyzing DNA dependent ATP hydrolysis that was stimulated by PCNA and human single stranded DNA binding protein ; ( 3 ) binding preferentially to DNA primer ends ; and ( 4 ) catalytically loading PCNA onto singly nicked circular DNA and catalytically removing PCNA from these DNA molecules . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the upstream region ( 71 to 64 with respect to the transcription initiation site ) of the CycA gene , we found a sequence identical to the DNA replication related element ( DRE ; 5 ' TATCGATA ) , which is important for high level expression of replication related genes such as those encoding DNA polymerase alpha and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study we investigated the programmed cell death of normal adrenal tissues on the basis of apoptotic index by the nonradioactive in situ end labeling of DNA fragments , proliferating cell nuclear antigen , ( PCNA ) , CD 95 ( cluster of differentiation ) , major histocompatibility complex class 2 immunohistochemistry , and ultrastructural analysis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
With 28 surgically resected islet cell tumors , including 20 primary and eight metastatic tumors , nuclear DNA ploidy was analyzed and compared for the S phase by image analysis and immunocytochemical staining for proliferating cell nuclear antigen ( PCNA ) . ^^^ DNA ploidy and proliferating cell nuclear antigen in islet cell tumors . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a 36 kDa DNA delta polymerase associated protein that is directly involved in the mechanisms of DNA synthesis . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a 36 kDa DNA delta polymerase associated protein that is directly involved in the mechanisms of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
As they do so , the majority continue to show association with PCNA in synchrony with nuclei at the cortex , suggesting some continuity of the synchrony of DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Processing of O 6 meG by mismatch correction requires PCNA and therefore probably DNA polymerase delta and / or epsilon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The activity and processivity of native DNA polymerase delta are markedly stimulated by PCNA whereas it has no effect on the recombinant catalytic subunit . ^^^ These results suggest that the small subunit of DNA polymerase delta is essential for functional interaction with PCNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Role for cyclin A dependent kinase in DNA replication in human S phase cell extracts . ^^^ Using in vitro replication of SV 40 origin containing DNA as a model system , we have performed a detailed analysis of the dependence on cyclin associated kinases of mammalian DNA replication . ^^^ Addition of cyclin A alone reconstitutes both kinase activity and DNA replication , whereas addition of cyclin E or cyclin B reconstitutes neither . ^^^ By comparison , depletion of cyclin E from S phase cell extracts does not have any significant inhibitory effect on DNA replication . ^^^ Moreover , specific p 21 ( Waf 1 ) mutants that bind to CDK 2 cyclin and inhibit both cyclin A and cyclin E kinase activities , but do not bind to proliferating cell nuclear antigen , inhibit DNA replication to the same extent as cyclin A depletion . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A proliferating cell nuclear antigen ( PCNA ) dependent complex , detectable after nondenaturing polyacrylamide gel electrophoresis , is formed between calf thymus DNA polymerase delta ( pol delta ) and synthetic oligonucleotide template primers containing a mispaired nucleotide at the 3 ' terminal position of the primer . ^^^ Proliferating cell nuclear antigen promotes misincorporation catalyzed by calf thymus DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , the expression of the different A type cyclin genes responded differently upon a block at mid S phase by DNA synthesis inhibitors . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we demonstrate that cyclin D 1 inhibits muscle gene expression without affecting MyoD DNA binding activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We propose that a protein complex composed of cyclin D 1 , PCNA , and possibly cyclin A may play a role in cell cycle regulation and DNA repair , which determine ASRs in human cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In DNA diploid tumors , antigen expression ( HER 2 / Neu , proliferating cell nuclear antigen ) could be analyzed without interference of fluorescence signals from nonneoplastic cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Aberrant proliferation in the CNS correlates with increased free E2F DNA binding activity and increased expression of cyclin E , an E2F target gene and critical cell cycle regulator . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Human cDNA and genomic DNA encoding cyclin G were cloned and analyzed . ^^^ The genomic DNA for human cyclin G consists of six exons , and in the first intron , one distinct putative binding site for the p 53 tumor suppressor gene product ( GCACAAGCCCAGGCTAGTCC ) was detected . ^^^ We performed chromosome mapping utilizing the fluorescence in situ hybridization ( FISH ) technique using both cDNA and genomic DNA for cyclin G . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
With concentrations of each inhibitor able to block DNA synthesis , no induction of message for the cyclin dependent kinase inhibitor waf 1 was observed ; while induction of gadd 45 message indicated that the cells might be responding to growth arrest or DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Uncoupling of DNA replication and cell cycle progression by human cyclin E . ^^^ Here , we report that the ectopic expression of human cyclin E , but not cyclin D 1 , deregulates DNA synthesis in both yeast and mammalian cells . ^^^ In yeast , induction of DNA synthesis by cyclin E occurs even under conditions of cell cycle arrest in G 1 or G2 / M , indicating an uncoupling of DNA replication from cell cycle progression . ^^^ These cells , in contrast to those transformed by Ras and cyclin D 1 , show aberrant levels of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using flow cytometry , DNA content and index , and / or proliferative capacity ( measuring proliferating cell nuclear antigen PCNA ) in operated pituitary tumors , control pituitaries obtained at necropsy , and experimental pituitary hyperplasia induced in rats were analyzed . ^^^ Simultaneous measurement of cell ploidy and proliferation differentiated normal pituitary ( diploid DNA index and negative PCNA ) from pituitary hyperplasia ( diploid DNA index with intensely positive PCNA , between 30 and 72 % of cells ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , also called cyclin , is a 36 KD auxiliary protein of DNA polymerase delta , that has been found to be a useful marker in immunocytochemical studies of cell proliferation because its expression correlates with the proliferative state of the cell . ^^^ Proliferating cell nuclear antigen ( PCNA ) , also called cyclin , is a 36 KD auxiliary protein of DNA polymerase delta , that has been found to be a useful marker in immunocytochemical studies of cell proliferation because its expression correlates with the proliferative state of the cell . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression of proliferating cell nuclear antigen ( PCNA ) is intimately linked to cell growth and DNA replication and repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin B 1 was induced in infected cells which exhibited a G1 / S DNA content by FACS analysis , suggesting that expression of this key cell cycle function was dramatically altered by viral functions . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It also contains a number of motifs which are characteristic of DNA polymerases in general and viral polymerases in particular , as well as the conserved motif which interacts with proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It is a molecular matchmaker required for loading of proliferating cell nuclear antigen ( PCNA ) onto double stranded DNA and , thus , for PCNA dependent DNA elongation by DNA polymerases delta and epsilon . ^^^ A similar protection profile was obtained with the recently identified PCNA binding region ( residues 478 712 ) , but not with the DNA binding region ( residues 366 477 ) , of the human RF C large subunit ( Fotedar , R . , Mossi , R . , Fitzgerald , P . , Rousselle , T . , Maga , G . , Brickner , H . , Messner , H . , Khastilba , S . , Hbscher , U . , and Fotedar , A . , ( 1996 ) EMBO J . , 15 , 4423 4433 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In eukaryotes , processive DNA synthesis catalyzed by DNA polymerases delta and epsilon ( pol delta and epsilon ) requires the proliferating cell nuclear antigen ( PCNA ) . ^^^ It has recently been shown that in humans ( h ) , the PCNA function , required for both DNA replication and nucleotide excision repair , can be inactivated by p 21 ( CIP 1 ) due to a specific interaction between hPCNA and the carboxyl terminus of p 21 ( CIP 1 ) . ^^^ In this report , we show that Saccharomyces cerevisiae ( S . cerevisiae ) PCNA dependent pol delta catalyzed DNA synthesis was inhibited less efficiently than the human system by the intact p 21 ( CIP 1 ) protein and was unaffected by the p 21 ( CIP 1 ) carboxyl terminal peptide ( codons 139 160 ) . ^^^ This species specific response of PCNA to p 21 ( CIP 1 ) mediated inhibition of DNA synthesis results from a marked difference in the ability of h and S . cerevisiae PCNA to interact with p 21 ( CIP 1 ) . ^^^ The influence of the proliferating cell nuclear antigen interacting domain of p 21 ( CIP 1 ) on DNA synthesis catalyzed by the human and Saccharomyces cerevisiae polymerase delta holoenzymes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To evaluate the proliferative activity of the hepatocytes in tissue sections , hepatic DNA content and immunostaining of the liver tissue sections for proliferating cell nuclear antigen ( PCNA ) were performed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Concerning DNA ploidy , aneuploid tumours had a significantly higher PCNA index compared with diploid tumours ( p = 0 . 002 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In another 23 patients ( Series 2 ) , the authors investigated the association between DNA amplification ( by slot blot hybridization ) , overexpression of cyclin D 1 , and cytogenetics . ^^^ In general , DNA amplification results in overexpression of cyclin D 1 , but additional genetic mechanisms are involved in the deregulation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To predict the proliferative potential , immunoreactivity to proliferating cell nuclear antigen ( PCNA ) , silver colloid staining for nucleolar organizing regions ( AgNORs ) , and DNA flow cytometry were performed in 10 of the 13 cases . ^^^ The one case of tumor recurrence , in which the authors performed the study of proliferative potential , and another case that demonstrated mild nuclear pleomorphism also showed low percentages of PCNA positive cells , low AgNORs scores , and diploidy in DNA flow cytometry . ^^^ It is suggested that most central neurocytomas follow a benign clinical course with low proliferative potential assessed by PCNA , AgNORs , and DNA flow cytometry ; however , recurrence is possible within a relatively short time period . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Transfected Sam68DeltaKH inhibits serum induced DNA synthesis and cyclin D 1 expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The high levels of PCNA induced by 20 micrograms / ml GLA , in both G 1 and S phases , may indicate a state of DNA repair synthesis , whilst at the higher concentration of GLA , most of the cells became apoptotic . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have analyzed expression and activity of DNA polymerases alpha , beta , delta and epsilon , proliferating cell nuclear antigen ( PCNA ) , topoisomerases 1 and 2 , terminal deoxynucleotidyl transferase ( TdT ) and DNA ligases 1 , 3 and 4 upon induction of preB cell differentiation . ^^^ Despite the immediate arrest of cell proliferation , DNA polymerase delta protein levels remained unchanged for approximately 2 days and its activity was up regulated several fold , while PCNA was continuously present . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The DRE / DREF system plays an important role in transcription of DNA replication genes such as those encoding the 180 and 73 kDa subunits of DNA polymerase alpha as well as that for encoding PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression of PCNA is associated with the presence of HPV DNA in skin warts . ^^^ The signal distribution of HPV DNA markedly differed from that of PCNA expression . ^^^ Although strong PCNA signals within the wart lesions were found in the areas where HPV DNA was present , the PCNA positivity was almost invariably localized in the differentiated cells of the spinous cell layers , just below the HPV DNA expressing cells . ^^^ HPV DNA positive warts showed more intense expression of PCNA than did the HPV DNA negative ones in this study . ^^^ Our results indicate that PCNA induction is associated with the presence of HPV DNA , suggesting that HPV can reactivate PCNA , thus interfering with the host cell DNA replication machinery . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin / Cdk dependent initiation of DNA replication in a human cell free system . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Microglial proliferation was assessed by PCNA labelling and DNA fragmentation by the TUNEL technique in the presence or absence of several cytokines including IL 1 , IL 6 , TGF beta 1 , TNF alpha , M CSF and GM CSF . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Southern blot analysis showed that there was no change of the cyclin B 1 gene at the somatic DNA level in spite of its high expression at the protein level . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA sequence analysis of this clone identified an open reading frame which has 32 % amino acid identity and 53 % similarity to the virus encoded cyclin ( 5 cyclin ) of herpesvirus saimiri ( HVS ) and 31 % identity and 53 % similarity to human cellular cyclin D 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results suggest that the H type is a complex form consisting of the P and L types of PCNA and DNA . ^^^ These results suggest that the increase in the L type in the cytoplasm reflects newly synthesized PCNA production for cellular proliferation and that the increase in the H type in the nucleoplasm is a reflection of binding to DNA and the fundamental role of PCNA itself in liver regeneration in young rats . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
One of the well established functions for PCNA is its role as the processivity factor for DNA polymerase delta and epsilon . ^^^ PCNA tethers the polymerase catalytic unit to the DNA template for rapid and processive DNA synthesis . ^^^ In the last several years it has become apparent that PCNA interacts with proteins involved in cell cycle progression which are not a part of the DNA polymerase apparatus . ^^^ This review summarizes the structural features of PCNA and describes the diverse functions played by the protein in DNA replication and repair as well as its possible role in chromatin assembly and gene transcription . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The placement of cells in suspension culture reduced cyclin A , D 1 , and E kinase activity within 6 h , accompanied by the cessation of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Multivariate flow cytometry using specific cyclin proteins and DNA content can identify cell populations at different points within the cell cycle . ^^^ Quantification of cyclin B 1 and DNA content reveals that cells with high levels of cyclin B 1 predominantly have a 4C DNA content and are therefore in G 2 or mitosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Such studies neither provide information regarding intercellular variability in cyclin expression nor yield precise data on a time relationship between initiation and termination of DNA replication in relation to cyclin expression . ^^^ A strong correlation between expression of cyclin A and the rate of DNA replication , estimated by the degree of BrdUrd incorporation ( r = 0 . 99 ) , was observed . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the present study , assessment of the expression of the proliferating cell nuclear antigen ( PCNA ) , a nuclear acidic protein necessary for DNA replication that is expressed through the cell cycle , was used to investigate the proliferative capability of glial cells in the hypomyelinated Jimpy mutant mice . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Co infection of insect cells with five baculoviruses encoding individual RF C subunits ( p 140 , p 40 , p 38 , p 37 , and p 36 ) yielded a protein preparation active in two assays characteristic for authentic RF C : stimulation of DNA polymerase delta DNA synthesis on singly primed single stranded DNA template and formation of a complex of proliferating cell nuclear antigen with circular double stranded DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA ploidy , AgNORs and PCNA as marker of tumor cellular proliferative activity are reported to be a prognostic marker but still remain controversial . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
CONCLUSION : These results indicate that staurosporine potentiates apoptosis through events which occur downstream of DNA damage , and implicate unscheduled activation of cyclin A dependent kinase during inhibition of DNA synthesis as a possible cause . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunohistochemical staining using proliferating cell nuclear antigen revealed DNA synthesis peaks at 18 h after PH . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis , and proliferating cell nuclear antigen labeling index in the remnant pancreas ) after pancreatectomy was significantly enhanced in the high zinc diet group compared to the standard diet group . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In response to DNA damage , no dramatic difference was detected in G 1 or S phase cyclin or cyclin dependent kinase ( Cdk ) levels when E 7 expressing cells were compared to the parental cell line , RKO . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
No cases recurrence were found in the group of DNA euploid tumors with PCNA . expression lower than 30 % , in contrast a very high percentage of recurrence in patients with DNA aneuploid tumors with PCNA expression higher than 30 % . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA and DNA polymerase delta catalytic subunit from Schizosaccharomyces pombe do not interact directly . ^^^ We show that the recombinant p 125 is active for basal DNA polymerase activity and for 3 ' > 5 ' exonuclease activity but is not stimulated by PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : 115 biopsies from 17 liver allografts and 47 biopsies of liver cirrhosis were analyzed and compared with 22 normal controls and with biopsies from patients with primary sclerosing cholangitis or primary biliary cirrhosis . bcl 2 protein and PCNA ( proliferating cell nuclear antigen ) expression was assessed using immunohistochemistry , and apoptosis was analyzed employing in situ DNA end labeling . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression of proliferating cell nuclear antigen demonstrated a reduction in DNA synthesis in the seminiferous tubules after incubation at 37 degrees C CONCLUSION : These findings indicate that a high temperature of 37 degrees C reduces the activity of the enzymes involved in the testicular synthesis of DNA which may cause the impairment of spermatogenesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Promoter regions of the Drosophila proliferating cell nuclear antigen ( PCNA ) gene and the DNA polymerase alpha gene contain a common 8 base pair promoter element ( DRE : DNA replication related element ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
On DNA , the PCNA clamp slides freely and dissociates from DNA slowly ( t1 / 2 approximately 24 min ) . beta is more stable in solution ( Kd < 60 PM ) and on DNA ( t1 / 2 approximately 1 h ) than PCNA which may be explained by its simpler oligomeric state . ^^^ The T 4 gp45 clamp is a much less stable trimer than PCNA ( Kd approximately 250 nM ) and requires association with the polymerase to stabilize it on DNA as observed previously . ^^^ However , the greater stability of the PCNA and beta clamps on DNA necessitates an active process for their removal . ^^^ The stability of the PCNA and beta clamps predicts they will require an unloading factor to recycle them on and off DNA during replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Recently , FEN 1 was found to specifically associate with PCNA , explaining some aspects of FEN 1 function during DNA replication and potentially in DNA repair . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Association of cyclin A and cdk 2 with SV 40 DNA in replication initiation complexes is cell cycle dependent . ^^^ In mammalian cells the timing of activation of cyclin A associated kinase activity coincides with the onset of DNA synthesis in S phase . ^^^ This analysis reveals that , in addition to replication initiation proteins , cyclin A and cdk 2 are also specifically associated with DNA . ^^^ The association of cyclin A and cdk 2 with DNA during initiation is cell cycle regulated and occurs specifically in the presence of SV 40 origin containing plasmid and SV 40 T antigen ( the viral replication initiator protein ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
As a consequence of this disruption , the distributions of PCNA and the large subunit of the RFC complex , proteins required for the elongation phase of DNA replication , are altered such that they are found within the intranucleoplasmic lamin aggregates . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA S and PCNA tot correlated strongly to each other ( r ( s ) = 0 . 969 , p < 0 . 001 ) and to the S phase fraction determined by DNA histogram analysis ( r ( s ) = 0 . 927 and 0 . 934 respectively , p < 0 . 001 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factor C ( RFC ) and proliferating cell nuclear antigen ( PCNA ) are processivity factors for eukaryotic DNA polymerases delta and epsilon . ^^^ RFC contains multiple activities , including its ability to recognize and bind to a DNA primer end and load the ring shaped PCNA onto DNA in an ATP dependent reaction . ^^^ PCNA then tethers the polymerase to the template allowing processive DNA chain elongation . ^^^ Deletion of the p 140 N terminal half , including the DNA ligase homology domain , resulted in the formation of an RFC complex with enhanced activity in replication and PCNA loading . ^^^ DNA primer end recognition and PCNA binding activities , located in the p 140 C terminal half , were unaffected in this mutant , but PCNA loading was abolished . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factor C ( RFC ) and proliferating cell nuclear antigen ( PCNA ) are processivity factors for eukaryotic DNA polymerases delta and epsilon . ^^^ RFC binds to a DNA primer end and loads PCNA onto DNA in an ATP dependent reaction . ^^^ A N terminal region of the small subunits , containing the RFC homology box 2 , plays a critical role in the function of these subunits , deletion of which reduces but does not abolish RFC activity in loading PCNA onto DNA and in supporting an RFC dependent replication reaction . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The enzyme is distributive by itself and requires an accessory protein , the proliferating cell nuclear antigen ( PCNA ) , for highly processive DNA synthesis . ^^^ We have recently demonstrated that the catalytic subunit of human DNA polymerase delta ( p 125 ) expressed in baculovirus infected insect cells , in contrast to the native heterodimeric calf thymus DNA polymerase delta , is not responsive to stimulation by PCNA . ^^^ To determine whether the lack of response to PCNA of the recombinant catalytic subunit is due to the absence of the small subunit or to differences in post translational modification in insect cells versus mammalian cells , we have co expressed the two subunits of human DNA polymerase delta in insect cells . ^^^ We have demonstrated that co expression of the catalytic and small subunits of human DNA polymerase delta results in formation of a stable , fully functional heterodimer , that the recombinant heterodimer , similar to native heterodimer , is markedly stimulated ( 40 to 50 fold ) by PCNA and that the increase in activity seen in the presence of PCNA is the result of an increase in processivity . ^^^ These data establish that the 50 kDa subunit is essential for functional interaction of DNA polymerase delta with PCNA and for highly processive DNA synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Hepatic regeneration was documented by determining [ 3H ] thymidine incorporation into hepatic DNA , liver thymidine kinase activity , mitotic index and proliferating cell nuclear antigen immunostaining , at various time points after partial hepatectomy . 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
E 7 does not interfere with the initial steps of the p 53 response , however , and E 7 expressing cells showed enhanced expression of p 21 ( waf1 / cip1 ) and reductions in cyclin E and A associated kinase activities following DNA damage . ^^^ One function of cyclin dependent kinases is to phosphorylate pRB and activate E2F , thus allowing entry into DNA synthesis . ^^^ It is possible that inefficient cyclin A dependent inactivation of E2F at the end of DNA synthesis contributes to the enhanced apoptosis displayed by E 7 expressing cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This was achieved through a protocol that takes advantage of the reported differential sensitivities of different DNA polymerases towards certain inhibitors such as butylphenyl and butylanilino nucleotide analogs . 2 ' , 3 ' dideoxythymidine triphosphate , the monoclonal antibody of human polymerase alpha and the use of preferred template primers and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Other ancillary tests DNA ploidy , proliferation index ( proliferating cell nuclear antigen , Ki 67 ) and p 53 protein immunolocalization were utilized in a diagnostic sequence . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Proliferation index at the invasive tumor margin of 86 paraffin sections of advanced colorectal carcinomas was assessed by immunohistochemical study using a mouse monoclonal antibody to PCNA ( PC 10 ) and was compared with conventional clinicopathologic factors and other possible prognostic parameters , including p 53 overexpression , tissue carcinoembryonic antigen immunoreactivity pattern , and flow cytometric DNA ploidy . ^^^ Mean PCNA LI was also significantly higher in tumors with DNA aneuploidy ( P = 0 . 0006 ) and negative and cytoplasmic patterns of carcinoembryonic antigen immunoreactivity ( P = 0 . 01 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The kinetics of Jnk 1 kinase activity is delayed and occurs by a time when we also detect DNA synthesis and the expression of the S phase specific cyclin A protein . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) , a crucial component of eukaryotic cell cycle and DNA replication complexes , is induced by the adenovirus E1A 243R oncoprotein through a cis acting element termed the PERE ( PCNA E1A responsive element ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our studies demonstrate that the following DNA replication proteins constitute the DNA synthesome : DNA polymerase alpha , DNA primase , DNA polymerase delta , proliferating cell nuclear antigen , replication protein A , replication factor C , DNA topoisomerases 1 , 2 , and DNA polymerase epsilon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA content , nucleoside precursor incorporation and proliferating cell nuclear antigen ( PCNA ) expression as functions of drug treatment were assessed by multiparameter flow cytometry . ^^^ The number of S phase cells in treated populations was slightly elevated relative to control as measured by DNA content and PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunofluorescent detection of proliferating cell nuclear antigen ( PCNA ) and bromodeoxyuridine ( BrdU ) incorporation into DNA during S phase we used to assess rat hepatocyte proliferation in vivo during dietary administration of Wy 14 , 643 , a known peroxisome proliferator and hepatocarcinogen in rodents . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunohistochemical staining for nuclear antigens ( Ki 67 , proliferating cell nuclear antigen [ PCNA ] , DNA polymerase alpha and nucleolar organizer region [ NOR ] proteins ) are acceptable and commonly used methods of monitoring regenerative activity but are subject to inter and intra observer variability . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA index ( percentage PCNA positive cells ) , DNA index , and S phase fraction ( SPF , euploid tumors only ) were determined . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Phosphorylation of DNA polymerase alpha primase by cyclin A dependent kinases regulates initiation of DNA replication in vitro . ^^^ The p 180 and the p 68 subunits of DNA polymerase alpha primase were phosphorylated using Cyclin A , B and E dependent kinases . ^^^ In contrast , site specific initiation of replication on plasmid DNA containing the SV 40 origin is affected : Cyclin A Cdk 2 and Cyclin A Cdc 2 inhibited initiation of SV 40 DNA replication in vitro , Cyclin B Cdc 2 had no effect and Cyclin E Cdk 2 stimulated the initiation reaction . ^^^ DNA polymerase alpha primase that was pre phosphorylated by Cyclin A Cdk 2 was completely unable to initiate the SV 40 DNA replication in vitro ; Cyclin B Cdc 2 phosphorylated enzyme was moderately inhibited , while Cyclin E Cdk 2 treated DNA polymerase alpha primase remained fully active in the initiation reaction . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Liver injury was assessed by serum enzyme elevations and histopathology , and tissue repair was measured by [ 3H ] thymidine incorporation into hepatonuclear DNA and proliferating cell nuclear antigen immunohistochemistry over a time course of 0 to 96 h . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin dependent kinase ( CDK ) activating kinase CAK has been proposed to function in the control of cell cycle progression , DNA repair and RNA polymerase 2 ( pol 2 ) transcription . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Apoptosis was determined by in situ DNA nick end labelling techniques and proliferating cells were identified with a monoclonal antibody antiproliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin dependent kinase inhibitor p21WAF1 has been shown to be upregulated during differentiation and after DNA damage in somatic cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have been isolating a small DNA probe encoding the goat cyclin B 1 box to analyze the expression of the cyclin B 1 gene in competent and incompetent goat oocytes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Since their presence was associated with DNA fragmentation revealed by the TUNEL procedure , we propose that c Jun and cyclin D 1 are involved in the process of neuronal death . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Only when cultured at subconfluence and in the presence of EGF did hepatocytes exhibit a proliferative response , assessed by measuring DNA synthesis and cyclin A accumulation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Examination of the effects of recombinant p 50 on the activity of DNA polymerase delta showed that p 50 is able to slightly stimulate ( about 2 fold ) the activity of the recombinant 125 kDa catalytic subunit using poly ( dA ) . oligo ( dT ) as a template in the absence of proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA content and PCNA / Ki 67 expression were analyzed by bivariate flow cytometry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our analysis demonstrates an approach for examining human sequence as it is made available from large sequencing programs and has resulted in the discovery of several biomedically important genes , including a cyclin , a transcription factor that is homologous to an oncogene , a protein involved in DNA repair , and several new members of a family of transporter proteins . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Increased cyclin E / cdk2 expression was accompanied by increased DNA synthesis , whereas increased cyclin D1 / cdk5 levels correlated with decreased DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To assess the role of cyclin D 1 in the cAMP mediated inhibition of DNA synthesis , we overexpressed the cyclin D 1 gene in CCL 39 and analysed the cAMP response in stable transfectants . ^^^ Interestingly , the mitogen induced DNA synthesis reinitiation is also much less inhibited by cAMP in cyclin D 1 transfectants than in control cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Endpoints included expression of leucocyte antigens CD 4 ( T helper / inducer ) , CD 8 ( T suppressor / cytotoxic ) and CD 11 b / c ( macrophage ) , proliferating cell nuclear antigen ( PCNA ) as an indicator of proliferation , and in situ end labelling ( ISEL ) of 3 ' OH DNA strand breaks as an indicator of DNA damage and apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The variety of techniques for measuring cell proliferation in routine sections include mitosis counting , AgNORs , DNA precursor uptake ( bromodeoxyuridine ) , and immunohistochemical detection of cell cycle proteins ( PCNA , Ki 67 / MIB 1 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Phosphorylation of the PCNA binding domain of the large subunit of replication factor C by Ca2+ / calmodulin dependent protein kinase 2 inhibits DNA synthesis . ^^^ It is a molecular matchmaker required for loading of the proliferating cell nuclear antigen ( PCNA ) sliding clamp onto double strand DNA and for PCNA dependent DNA synthesis by DNA polymerases delta and epsilon . ^^^ The DNA and PCNA binding domains of the large 140 kDa subunit of human RF C have been recently cloned [ Fotedar , R . , Mossi , R . , Fitzgerald , P . , Rousselle , T . , Maga , G . , Brickner , H . , Messier , H . , Khastilba . ^^^ Phosphorylation by CaMKII reduces the binding of PCNA to RF C and consequently inhibits RF C dependent DNA synthesis by DNA polymerases delta 1 and epsilon . ^^^ Once bound to PCNA and DNA , RF C is protected from phosphorylation by CaMKII , suggesting a possible role of CaMKII in regulating the dynamics of interaction between PCNA and RF C and thus interfering in the formation of an active sliding clamp by DNA polymerases delta and epsilon . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Five factors prior to NAC ( nuclear grade , pretreatment tumor volume , PCNA index , p 53 protein expression , and DNA ploidy ) were analyzed for correlation with the decrease in tumor volume and histologic response in cervical and endometrial adenocarcinoma , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
An auxiliary protein of DNA polymerases delta and epsilon , the proliferating cell nuclear antigen ( PCNA ) , is necessary for efficient DNA replication in vivo and in vitro , and also for the repair synthesis in vitro , but its role in the excision repair of genome in vivo is not exactly established . ^^^ In S phase of unirradiated cells , PCNA is tightly bound to focal centers of DNA replication and is not removed by treatment with detergent Triton 10 100 , but is completely extracted from non S phase cells by the indicated detergent . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Differential effects were observed with the G 1 cell cycle mediators CDK 4 , CDK 5 , and cyclin D 3 , p21Waf1 and p27Kip1 CDK inhibitory protein concentrations rose in accordance with the induction of DNA synthesis and histone H 1 kinase activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA content and proliferating cell nuclear antigen ( PCNA ) expression were investigated in normal hearts , in hypertrophic from hemodynamic overload hearts and in hypertrophic cardiomyopathy ( HCM ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
OBJECTIVE : To determine the role of DNA and proliferating cell nuclear antigen ( PCNA ) image analysis ( IA ) in enhancing the diagnostic sensitivity of conventional cytology ( CC ) . ^^^ There were positive correlations between DNA ploidy profile and PCNA proliferative index ( PI ) , ( R = . 697 ) and significant differences in PCNA PI between malignant and benign effusions ( P < . 001 ) . ^^^ CONCLUSION : The DNA IA PI by PCNA can be used as a complementary diagnostic tool with CC in cytologically inconclusive cases . . ^^^ DNA ploidy and proliferating cell nuclear antigen image analysis of peritoneal and pleural effusions . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 overexpression promotes cardiomyocyte DNA synthesis and multinucleation in transgenic mice . ^^^ D type cyclin / cyclin dependent kinase ( CDK ) complexes regulate transit through the restriction point of the cell cycle , and thus are required for the initiation of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This element , which we call an ECB ( early cell cycle box ) , was first identified in the SWI 4 promoter , but it is also present in the promoter of a G 1 cyclin CLN 3 , as well as in the promoters of three DNA replication genes : CDC 6 , CDC 47 , and CDC 46 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Diagnostic and prognostic value of p 53 oncogene and the selected neoplastic markers ( Ki 67 , PCNA , DNA ploidy ) of the ultrastructure in patients with laryngeal cancer ] . ^^^ A comparison was performed of staining intensity of immunohistochemical proliferating antigens ( p 53 , PCNA , Ki 67 ) , DNA flow cytometry and ultrastructure of the carcinoma cells in 120 cases of laryngeal cancer . ^^^ A positive staining was obtained in 70 % for p 53 , 57 % for Ki 67 and in 80 ( 2 / 3 ) for PCNA . 62 % of the cases were DNA diploid and 38 % DNA aneuploid . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Consistent with previous observations , proliferating cell nuclear antigen ( PCNA ) promotes DNA synthesis by calf thymus DNA polymerase delta ( pol delta ) past several chemically defined template lesions including model abasic sites , 8 oxo deoxyguanosine ( dG ) and aminofluorene dG ( but not acetylaminofluorene dG ) . ^^^ When all deoxyribonucleoside triphosphates and a template bearing a model abasic site were present , DNA synthesis by pol delta beyond this site was stimulated 53 fold by addition of homologous PCNA . ^^^ Moreover , corollary primer extension studies demonstrated that in the presence ( but not the absence ) of PCNA , pol delta preferentially elongated primers containing dAMP opposite the model abasic template site . p 21 , a specific inhibitor of PCNA dependent DNA replication , inhibits PCNA stimulated synthesis past model abasic template sites . ^^^ We propose that DNA synthesis past template lesions by pol delta promoted by PCNA results from the fundamental mechanism by which PCNA stimulates pol delta , i . e . , stabilization of the pol delta . template primer complex . . ^^^ Proliferating cell nuclear antigen promotes DNA synthesis past template lesions by mammalian DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Liver injury was assessed by measuring plasma ALT and SDH activity , liver histopathology , and liver regeneration was estimated by [ 3H ] thymidine incorporation into hepatonuclear DNA and proliferating cell nuclear antigen ( PCNA ) assay in both groups . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The data establish the E2F site in the human cyclin A promoter as a key target for the signaling pathway leading to G 1 arrest in response to DNA damage by cisplatin and potentially other genotoxic agents . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Morphologic restoration of the liver after hepatectomy was evaluated on the basis of remnant liver weight , proliferating cell nuclear antigen labeling index , and the DNA content of the regenerating liver . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Initiation of DNA synthesis by human papillomavirus E 7 oncoproteins is resistant to p 21 mediated inhibition of cyclin E cdk 2 activity . ^^^ U20S cells which stably express E 7 were found to initiate DNA synthesis in the presence of DNA damaging agents despite the inhibition of cyclin E activity by p 21 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Induction of the Myc oestrogen receptor fusion protein ( MycER ) by 4 OH tamoxifen ( OHT ) leads to the activation of Cyclin E / Cyclin dependent kinase 2 ( CycE / Cdk2 ) complexes followed by the induction of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
XPA , RP A and PCNA , suggesting their tighter association with genomic DNA after UV . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA ) gene and thereby suppresses DNA synthesis in regenerating rat liver . ^^^ We suggest that PRL negatively regulates the PCNA gene transcription by interfering with the cAMP / PKA mediated induction of CREB binding to the CRE sequences and thereby suppresses DNA synthesis in regenerating rat liver . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Topical application of TGF beta 3 to the buccal mucosa significantly reduced basal cell proliferation , as measured by proliferating cell nuclear antigen ( PCNA ) immunohistochemistry and DNA ploidy . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Wild type p 53 accumulation induced by DNA damaging agents such as ultraviolet ( UV ) radiation , gamma irradiation and drugs , may arrest the cell cycle until DNA damage is repaired . p21Waf1 / Cip1 is a cyclin dependent kinase ( CDK ) inhibitor induced by wild type p 53 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The mitogen dependent induction of cyclin D dependent kinase activity is required for cells to enter the DNA synthetic ( S ) phase of their division cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The p 21 protein , a regulator of cyclin dependent kinases ( CDKs ) , has been thought to be one of the key proteins to function in cell proliferation suppression upon DNA damage . ^^^ In normal cells but not in many tumor cells , p 21 forms a quaternary complex with a cyclin , a CDK and the proliferating cell nuclear antigen ( PCNA ) , one of the DNA replication and repair factors , suggesting that this complex might play an important role in maintaining the integrity of the genome . ^^^ Here , we have focused on the p 21 PCNA interaction in the context of DNA replication or DNA repair , presenting the data from both in vitro and in vivo studies of the p 21 function . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This has been confirmed by DNA fiber FISH analysis by which the breakpoints could be accurately mapped over a 220 kb region centromeric of the cyclin D 1 gene . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Pretreatment with antisense but not mismatch p 27 oligonucleotides attenuated the inhibitory effects of IL 4 on DNA synthesis and histone kinase activity of cyclin E / cdk2 complexes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In searching for an explanation for this accelerate DNA synthesis , we discovered that UCN 01 caused translocation of proliferating cell nuclear antigen ( PCNA ) to the detergent insoluble , DNA bound fraction . ^^^ PCNA acts as a sliding clamp for DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Since testis offer unique opportunities to examine the cell cycle in vivo , we examined the temporal and spatial expression of cyclin D 3 and the DNA synthesis indicator , proliferating cell nuclear antigen ( PCNA ) , in the rat testis during development . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA replication also occurred in a G 1 arrest induced by G 1 cyclin ( Cln ) depletion , indicating that mutant cells with a defective APC initiate DNA replication without the Cln G 1 cyclins , which are normally needed for the onset of S phase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We conclude that 1 ) mitogenic stimulation of cultured bovine tracheal myocytes by PDGF induces cyclin D 1 transcriptional activation and protein expression , 2 ) cyclin D 1 expression is accompanied by Rb phosphorylation , which is evidence of increased cyclin D 1 associated kinase activity in vivo , and 3 ) microinjection of anti cyclin D 1 antibodies inhibits cellular DNA synthesis , which is evidence that cyclin D 1 is required for airway smooth muscle S phase traversal . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Both the stimulation of DNA synthesis and the induction of proliferating cell nuclear antigen by natural ceramide 1 phosphate were inhibited by natural ceramides . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , subsequent apoptotic DNA fragmentation induced by GL 331 could be interrupted by treatment of the cells with the cyclin B 1 specific antisense oligonucleotides , suggesting that abnormal activation of cyclin B 1 associated CDC 2 kinase and CDC 25A phosphatase was involved in GL 331 induced apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Univariate analysis suggested that the stage according to the UICC classification , curability , DNA ploidy , proliferating cell nuclear antigen ( PCNA ) , S phase and G2M phase fractions , and histologic differentiation were significant prognostic factors . ^^^ When PCNA was omitted from the analysis , DNA ploidy and histologic differentiation were independent prognostic factors for both crude and cause specific survival . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA is a DNA polymerase expressed at the highest levels in the S phase , the most resistant portion of the cell cycle to ionizing radiation in vitro . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 and cyclin dependent kinases were undetected and no sign of active DNA synthesis could be observed , indicating that activation of cell cycle components is incomplete . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Sections from 23 primary malignant melanomas and 39 corresponding metastases were analysed for DNA content , nuclear morphometry , and proliferating cell nuclear antigen ( PCNA ) . ^^^ Analysis of nuclear DNA and morphometry , and proliferating cell nuclear antigen in primary and metastatic malignant melanoma . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
So we investigated proliferating character of IP by DNA ploidy analysis and immunohistostaining with proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cell number and total DNA were significantly larger and the level of LDH and proliferating cell nuclear antigen ( PCNA ) was elevated in Ca / 2 compared to FCa . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We revealed the malignant potential of this tumour , analyzing and evaluating nuclear DNA content , proliferating cell nuclear antigen ( PCNA ) as well as p 53 expression . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunofluorescence analysis using antibodies directed against the essential repair factors proliferating cell nuclear antigen and XPG did not reveal labeling of the coiled body in either untreated cells or cells irradiated with UV light , arguing that coiled bodies are probably not involved in DNA repair mechanisms . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Retroviral vectors bearing an antisense cyclin G 1 construct inhibited the proliferation of transduced aortic SMCs in 2 to 6 day cultures , concomitant with down regulation of cyclin G 1 protein expression and decreased [ 3H ] thymidine incorporation into DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The p21WAF1 is a potent inhibitor of most cyclin / CDK complexes and also inhibits the ability of the proliferating cell nuclear antigen ( PCNA ) to activate DNA polymerase d . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA is an auxilliary protein for DNA polymerase delta whose function is to increase both polymerase activity and processivity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
UCN 01 induced DNA fragmentation was preceded by activation of cyclin B1 / cdc2 kinase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Early Recurrence of Hepatoma : PCNA Labeling Index and DNA Ploidy Pattern Sixty four cases of recurrent hepatocellular carcinoma ( HCC ) after hepatectomy were divided into two groups ; E group with recurrence within one year , and L group with recurrence after 1 year . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results suggest that p 21 suppresses synthesis of DNA via cyclin E and PCNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Multivariate relative risk ( RR ) of tumor recurrence and death according to the presence of FF in the primary tumor was estimated using the Cox proportional hazards regression model with adjustment for other prognostic factors ( histologic grade , T classification , nodal status , tumor necrosis , DNA ploidy , c erbB 2 protein expression , p 53 protein expression , and labeling index of proliferating cell nuclear antigen ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Activation of c Myc uncouples DNA replication from activation of G 1 cyclin dependent kinases . ^^^ These data also provide evidence of at least one dominant mechanism besides activation of E2F and of cyclin E / cdk2 kinase , which prevents DNA replication unless a critical cell size has been reached . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA damage inhibits proteolysis of the B type cyclin Clb 5 in S . cerevisiae . ^^^ In this study , we have investigated the effects of DNA damage on the cyclin proteolytic machinery in Saccharomyces cerevisiae . ^^^ We find that the half life of the B type cyclin Clb 5 is markedly increased following DNA damage while that of G 1 cyclins is not . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Finally , a human ovarian ascites tumor specimen was triple stained for keratin 8 / 18 ( PE ) , vimentin ( FITC ) and DNA or keratin 8 / 18 ( PE ) , PCNA ( FITC ) and DNA . ^^^ Furthermore , vimentin negative and PCNA negative cells were better resolved in a human DNA aneuploid ovarian ascites tumor after staining the DNA with PI / TP3 , rather than with PI alone . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Flow cytometric and immunohistochemical correlations in high incidence human solid tumors . 475 patients with carcinoma at different sites ( 141 colon rectum ; 102 breast ; 50 stomach ; 48 kidney ; 46 head and neck ; 41 bladder ; 47 other sites ) submitted to surgery have been analyzed after histopathological staging and grading , by flow cytometry ( monoparametric DNA content analysis ) and immunohistochemistry ( p 53 , c erbB 2 , and PCNA expression ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Thus , greatly reduced levels of cyclin E transcript suffice for DNA replication until late in development . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RRB 1 is a 96 kDa nuclear protein that can physically interact with two mammalian DNA tumor virus oncoproteins , simian virus 40 large T antigen and adenovirus E1A , and with a plant D type cyclin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In contrast , moderate Raf activity induces DNA synthesis and is sufficient to induce cyclin D expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The Drosophila proliferating cell nuclear antigen ( PCNA ) gene promoter contains at least three transcriptional regulatory elements , the URE ( upstream regulatory element ) , DRE ( DNA replication related element ) , and E2F recognition sites . ^^^ In nuclear extracts of Drosophila Kc cells , we detected a novel protein factor ( s ) , CFDD ( common regulatory factor for DNA replication and DREF genes ) that appeared to recognize two unique nucleotide sequences ( 5 ' CGATA and 5 ' CAATCA ) and bind to three sites in the PCNA gene promoter . ^^^ In addition to the PCNA gene , multiple CFDD sites were found in promoters of the DNA polymerase alpha and DREF genes , and CFDD binding to the DREF promoter was confirmed . ^^^ Identification of CFDD ( common regulatory factor for DNA replication and DREF genes ) and role of its binding site in regulation of the proliferating cell nuclear antigen gene promoter . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proteins and enzymatic activities thus far identified to co purify with the leukemia cell DNA synthesome include the DNA polymerases alpha and delta , DNA primase , proliferating cell nuclear antigen ( PCNA ) , replication factor C ( RF C ) , replication protein A ( RP A ) , and DNA topoisomerases 1 and 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Xenopus cyclin A 1 can associate with Cdc 28 in budding yeast , causing cell cycle arrest with an abnormal distribution of nuclear DNA . ^^^ The induction of cyclin A 1 expression in yeast caused cell cycle arrest with an abnormal distribution of nuclear DNA to the daughter bud . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Inhibition of CDK activity and PCNA dependent DNA replication by p 21 is blocked by interaction with the HPV 16 E 7 oncoprotein . p 21 inhibits cyclin dependent kinase ( CDK ) activity and proliferating cell nuclear antigen ( PCNA ) dependent DNA replication by binding to CDK / cyclin complexes and to PCNA through distinct domains . ^^^ Using cell lysates and purified proteins we show that 16E7 prevented p 21 both from inhibiting CDK2 / cyclin E activity and PCNA dependent DNA replication , whereas the nononcogenic HPV 6 E 7 had reduced effects . ^^^ These data imply that the carboxyl terminus of p 21 simultaneously modulates both CDK activity and PCNA dependent DNA replication and that a single protein , 16E7 , can override this modulation to disrupt normal cell cycle control . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Staurosporine , on the other hand , inhibited DNA replication of PC 12 cells in a time and dose dependent fashion by affecting cyclin dependent kinases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Rb E2F complexes suppress transcription of genes required for DNA synthesis ( [ 4 ] , reviewed in [ 3 , 5 ] ) , and the prevailing view is that phosphorylation of Rb by complexes of cyclin dependent kinases ( Cdks ) and their regulatory cyclin subunits , and the subsequent release of active E2F , is required for S phase entry [ 1 3 ] . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen labeling index showed that this increase resulted from the stimulation of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In hct 1 mutants , the mitotic cyclin Clb 2 is highly stabilized and inappropriately induces DNA replication , while G 1 cyclins and other proteolytic substrates remain short lived . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Double staining for DNA fragmentation detection ( TUNEL ) and expression of cyclin D 1 and cdk 4 also was performed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The super recovery of cyclin E Cdk 2 coincided with the appearance of a small synchronous population of cells entering into S phase , consistent with transient G 1 phase delay / recovery regulated by cyclin E Cdk 2 , whereas the activities of cyclin A Cdk ' s ( 75 % cyclin A Cdk 2 ; 25 % cyclin A Cdc 2 when inhibition was maximal ) were correlated with rates of total DNA synthesis . ^^^ The recovery of cyclin A Cdk activities coincided with increased levels of total DNA synthesis and BrdU incorporation into cells within the last quarter of S phase . ^^^ Western blot analysis demonstrated that levels of Waf1 / p21 did not increase during inhibition of cyclin A Cdk ' s and DNA synthesis in the irradiated p 53 mutated CHO cells ; however , Cdc 2 and Cdk 2 exhibited increased levels of phosphotyrosine . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The presence of PCNA positive neurons may suggest DNA repair in these nuclei , which might be activated at an early stage of apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Restoration of the cdk 2 kinase activity was proportional to the amount of cotransfected cyclin E plasmid DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Human DNA ( cytosine 5 ) methyltransferase PCNA complex as a target for p21WAF1 . ^^^ Here , MCMT is shown to bind proliferating cell nuclear antigen ( PCNA ) , an auxiliary factor for DNA replication and repair . ^^^ Binding of PCNA requires amino acids 163 to 174 of MCMT , occurs in intact cells at foci of newly replicated DNA , and does not alter MCMT activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The effects of oestradiol in the uterus were determined by measuring the following : mitotic index ; the percentage of cells positive for the proliferating cell nuclear antigen ( using immunocytochemistry ) ; the DNA content ( using Feulgen ' s method ) ; and the volume of cells , nuclei and nucleoli ( using morphometry ) in the luminal epithelium , glandular epithelium and stroma of the endometrium 24 , 36 and 48 h after injection with oestradiol . ^^^ However , parameters that reflected proliferative processes ( mitotic indices , the number of cells positive for proliferating cell nuclear antigen , and DNA content ) were much more reduced than those indicating cell growth ( volumes of cells , nuclei and nucleoli ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The function of p 53 is also linked to DNA synthesis via interaction with p 21 and PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Effect of DNA synthesis inhibitors on Kaposi ' s sarcoma associated herpesvirus cyclin and major capsid protein gene expression . ^^^ Transcripts hybridizing to a KSHV encoded cyclin gene were unaffected by either TPA or DNA polymerase inhibitors in both cell lines . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The prognostic significance of DNA ploidy , measured by image cytometry on isolated cells , and of the mitotic index , proliferating cell nuclear antigen , and p 53 protein , all measured by image cytometry in histologic sections , were evaluated on archival tumor tissues from 53 patients with Stage 3 or 4 nasopharyngeal carcinomas . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We used double staining histochemistry to investigate the relationship between apoptotic cell death and selective protein expression associated with DNA damage ( p 53 , Bax , MDM 2 , Gadd 45 ) , DNA repair ( PCNA ) and cell cycle proteins ( cyclin A , cyclin D , cdk 2 , cdk 4 ) in rats ( n = 6 ; control rats , n = 5 ) subjected to transient ( 2 h ) middle cerebral artery occlusion ( MCAo ) and 46 h of reperfusion . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The Matrigel biomatrix KGF culture conditions were also associated with an enhanced proliferative response , as measured by fluorescent activated cell sorter analysis , thymidine incorporation into DNA , and proliferating cell nuclear antigen expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The DNA polymerase responsible for error free bypass , however , has not been identified , but genetic studies implicating proliferating cell nuclear antigen in this process have suggested that either DNA polymerase delta or DNA polymerase epsilon may be involved . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Activation of this kinase is suppressed by DNA damage , and this may result from the imposition of inhibitory phosphorylations on the CDC 2 kinase as well as downregulation of cyclin B 1 levels . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
From a murine genomic library constructed with spleen DNA , two overlapping genomic clones of cyclin D 2 were isolated . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Localization of murine cyclin G 1 will facilitate determination of gene linkage and the identification of synteny groups in mammals and of DNA elements in or near this gene that mediate its tissue expression or development specific pattern of expression . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , DNA synthesis and mitosis in myocytes following cardiac transplantation in man . ^^^ However , it is unknown whether cell cycle related gene product , such as PCNA , and DNA synthesis are stimulated under these conditions . ^^^ Proliferating cell nuclear antigen ( PCNA ) , DNA synthesis and mitosis in myocytes following cardiac transplantation in man . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Thus , although differentiated neuroblastoma and quiescent fibroblasts cells were essentially nondividing , their extracts were competent for DNA replication using DNA polymerases delta , alpha , and possibly epsilon , with proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin dependent kinases ( CDKs ) promote the initiation of DNA replication and prevent reinitiation before mitosis , presumably through phosphorylation of key substrates at origins of replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Twenty seven of the 85 major ORFs resemble proteins in databases , including the large subunit of ribonucleotide diphosphate reductase , ATP dependent DNA ligase , type 2 DNA topoisomerase , a helicase , histidine decarboxylase , dCMP deaminase , dUTP pyrophosphatase , proliferating cell nuclear antigen , a transposase , fungal translation elongation factor 3 ( EF 3 ) , UDP glucose dehydrogenase , a protein kinase , and an adenine DNA methyltransferase and its corresponding DNA site specific endonuclease . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Third , two color immunofluorescence staining of psoriatic plaques revealed that numerous TUNEL positive keratinocytes were also positive for proliferating cell nuclear antigen and Ki 67 antigens and that by flow cytometry TUNEL positive keratinocytes obtained from psoriatic plaques possessed a DNA content profile indicative of proliferating and not dying cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The results demonstrated that the growth inhibitory effects of 10 ( 8 ) M E 2 in ER stably transfected MDA MB 468 cells were associated with modulation of several factors required for cell cycle progression and DNA synthesis , including significant induction of the cyclin dependent kinase inhibitor p21cip 1 ( > 4 fold increase after 12 h ) and decreased E2F1 and PCNA protein levels . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Early MAP kinase activation did not interfere significantly with DNA replication , cyclin synthesis , or association of cyclins with Cdc 2 , but it did prevent hyperphosphorylation of Cdc 25 and Wee 1 and activation of Cdc2 / cyclin complexes . ^^^ The MAP kinase induced G 2 arrest appeared not to be related to the DNA replication checkpoint and not to be mediated through inhibition of Cdk2 / cyclin E ; evidently a novel mechanism underlies this arrest . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Study variables included colon weight , mucosal DNA , mucosal protein , and proliferating cell nuclear antigen immunohistochemistry , labeling of which was determined in five crypt compartments from base to surface ( 12 crypts per rat ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study , fractionation of a HeLa nuclear extract by DNA ligase 1 affinity chromatography resulted in the specific retention of a replication protein , proliferating cell nuclear antigen ( PCNA ) , by the affinity resin . ^^^ Subsequent experiments demonstrated that DNA ligase 1 and PCNA interact directly via the amino terminal 118 aa of DNA ligase 1 , the same region of DNA ligase 1 that is required for localization of this enzyme at replication foci during S phase . ^^^ PCNA , which forms a sliding clamp around duplex DNA , interacts with DNA pol delta and enables this enzyme to synthesize DNA processively . ^^^ An interaction between DNA ligase 1 and PCNA that is topologically linked to DNA was detected . ^^^ However , DNA ligase 1 inhibited PCNA dependent DNA synthesis by DNA pol delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In tumour cell nests , the expression of SKALP / elafin was localized in the cells overlying PCNA expressing cells and no expression was found in the cells that expressed PCNA ; DNA fragmentation was often observed in the same cell layers as those in which SKALP / elafin immunoreactivity was found . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Coupling mitosis to the completion of DNA replication in cycling embryonic extracts from Xenopus eggs appears to rely on blocking the activation of the tyrosine phosphorylated p34cdc2 / cyclin B , which continues to build up when S phase is inhibited by adding unreplicated DNA ( Smythe , C . , and Newport , J . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
OE 2 effects in the uterus were determined by measuring mitotic indices , proliferating cell nuclear antigen ( PCNA ) labelling indices , DNA content , and volumes of cells , nuclei and nucleoli in luminal and glandular epithelia and stromal cells of the endometrium 24 , 36 and 48 h after the injection of OE 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Visualization of mono allelic chromosomal aberrations 3 ' and 5 ' of the cyclin D 1 gene in mantle cell lymphoma using DNA fiber fluorescence in situ hybridization . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Structure and function of the promoter region of rat cyclin D 2 gene were investigated by cloning , sequence analysis and DNA mobility shift assay using nuclear extracts of prolactin stimulated Nb 2 cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The results once more confirm that tanshinone has anti cancer activity and suggest that the mechanism of action might be associated with inhibition of DNA synthesis , PCNA expression and DNA polymerase activity of tumor cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Addition of insulin like growth factor 1 ( IGF 1 ) to quiescent breast tumor derived MCF 7 cells causes stimulation of cyclin D 1 synthesis , hyperphosphorylation of the retinoblastoma protein pRb , DNA synthesis , and cell division . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The inhibitory effect of tanshinone on cancer cell proliferation might be associated with inhibiting DNA synthesis , PCNA expression and activity of DNA polymerase delta of the tumor cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In cultured adult ventricular myocytes , adenoviral gene transfer of E2F 1 induced expression of proliferating cell nuclear antigen , cyclin dependent protein kinase 4 , cell division cycle 2 kinase , DNA synthesis , and apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The use of selective inhibitors and of the proliferating cell nuclear antigen ( PCNA ) disclosed a successive involvement of alpha DNA polymerase ( pol ) and PCNA insensitive delta DNA pol in LSS . ^^^ Those of POMS component C contained alpha DNA pol As only , while a distinct portion of DNA SAs of POMS component B was represented on expense of alpha DNA pol As by PCNA insensitive delta DNA pol ( epsilon DNA pol ) , As which represented practically all the DNA SAs of POMS component A . ^^^ Moreover , analyzing this natural model replication system , we found that the carbonyldiphosphonate ( COMDP ) , a selective inhibitor of the PCNA insensitive delta DNA pol , was a strong activator of Pr As and / or Pr alpha DNA pol As of NP complexes of POMS component C . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
At no stage in the cell cycle , however , did we observe any co localization with RPA or PCNA , which were used as initiation or elongation markers for DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen : more than a clamp for DNA polymerases . ^^^ Two of them , the proliferating cell nuclear antigen and its adapter protein replication factor C , cooperate to form a moving platform that was initially thought of only as an anchor point for DNA polymerases delta and epsilon . ^^^ It now appears that proliferating cell nuclear antigen is also a communication point between a variety of important cellular processes including cell cycle control , DNA replication , nucleotide excision repair , post replication mismatch repair , base excision repair and at least one apoptotic pathway . ^^^ The dynamic movement of proliferating cell nuclear antigen on and off the DNA renders this protein an ideal communicator for a variety of proteins that are essential for DNA metabolic events in eukaryotic cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
On the other hand , a hyperphosphorylated Rb protein , obtained from insect cells overexpressing Rb protein , cyclin E and cyclin dependent kinase 2 simultaneously , stimulated DNA polymerase alpha more strongly than the singly expressed Rb protein . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This is also supported by the finding that a recombinant GFYP 2 expressed in bacteria bound to both the Y box DNA element and the goldfish cyclin B mRNA synthesized in vitro . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Usefulness of DNA ploidy , AgNORs , PCNA and c erbB 2 as predictors of prognosis in patients with renal cell carcinoma ] . ^^^ Seventy one patients with renal cell carcinomas were examined for a variety of markers associated with tumor malignancy : nuclear DNA ploidy , AgNORs , PCNA and c erbB 2 . ^^^ In all the patients examined , DNA ploidy , AgNORs , PCNA and c erbB 2 were significant predictors of the prognosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Identification of DNA replication and cell cycle proteins that interact with PCNA . ^^^ The identity of DNA replication proteins and cell cycle regulatory proteins which can be found in complexes involving PCNA were investigated by the use of PCNA immobilized on Sepharose 4B . ^^^ The salt eluates were examined for the presence of both DNA replication proteins ( Pol alpha , delta , straightepsilon , PCNA , RFC , RFA , DNA ligase 1 , NDH 2 , Topo 1 and Topo 2 ) and cell cycle proteins ( Cyclins A , B 1 , D 1 , D 2 , D 3 , E , CDK 2 , CDK 4 , CDK 5 and p 21 ) by western blotting with specific antibodies . ^^^ The DNA replication proteins which bound to PCNA Sepharose included DNA polymerase delta and straightepsilon , PCNA , the 37 and 40 kDa subunits of RFC , the 70 kDa subunit of RPA , NDH 2 and topoisomerase 1 . ^^^ This study presents strong evidence that PCNA is a component of protein complexes containing DNA replication , repair and cell cycle regulatory proteins . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin E / Ha ras transformed cells are highly tumorigenic in synergeneic rats , are able to form colonies in soft agar and show protection towards apoptosis upon serum starvation or DNA damage compared to cells transformed by the combination of Myc , cyclin D 1 or SV 40 large T antigen and Ha ras . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using DNA gel electrophoresis , electron microscopy ( EM ) , the in situ end labeling ( ISEL ) technique at the light and EM level , and immunohistochemistry for apoptosis related proteins c Jun and proliferating cell nuclear antigen ( PCNA ) , we have investigated the mechanisms of cell death in cerebellum and substantia nigra . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cells arrested at G1 / S by lack of nimQMCM 2 contain p 34 ( cdc 2 ) / cyclin B , but p 34 ( cdc 2 ) remains tyrosine dephosphorylated , even after DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
As expected , DNA polymerase alpha and proliferating cell nuclear antigen showed relatively strong immunostaining in mitotically proliferating spermatogonia and even stronger staining in preleptotene cells undergoing meiotic DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study , we isolated a full length 5 cyclin D complementary DNA and characterized the pattern of 5 cyclin D mRNA expression in Kaposi ' s sarcoma . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The arrest distribution did not correlate with the p 53 status , and proliferating cell nuclear antigen ( PCNA ) binding activity of p 21 did not appear to be involved , since p 27 , which lacks a PCNA binding domain , produced similar arrest distributions [ corrected ] , DNA endoreduplication occurred in pRb negative but not in pRb positive cells , suggesting that functional pRb is necessary to prevent DNA replication in p 21 G2 arrested cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This multiprotein replication complex contains DNA polymerases alpha and delta , primase , replication factor C , replication protein A , helicase , poly ( ADPribose ) polymerase , proliferating cell nuclear antigen , DNA ligase 1 , and topoisomerases 1 and 2 . ^^^ We also found that DNA polymerase delta , replication factor C , and proliferating cell nuclear antigen are absent in cells that are induced to differentiate in response to 12 O tetradecanoyl phorbol 13 acetate treatment but are present in actively cycling cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein for DNA polymerase delta and epsilon involved in DNA replication and nucleotide excision repair . ^^^ To function , PCNA forms a trimeric sliding clamp which is loaded onto DNA . ^^^ The loading of PCNA onto DNA was increased in cells with low p 21 levels . ^^^ Proliferating cell nuclear antigen ( PCNA ) is an auxiliary protein for DNA polymerase delta and epsilon involved in DNA replication and nucleotide excision repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This form of DNA polymerase 3 , which could also be detected in wild type extracts , was not associated with Hys 2 protein and was not stimulated by addition of proliferating cell nuclear antigen ( PCNA ) , replication factor A ( RF A ) or replication factor C ( RF C ) . ^^^ These data suggest that the 55 kDa polypeptide encoded by the HYS 2 gene is one of the subunits of DNA polymerase 3 complex in S . cerevisiae and is required for highly processive DNA synthesis catalyzed by DNA polymerase 3 in the presence of PCNA , RF A and RF C . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Decreased expression of cyclin D 1 , pRB , and p 53 in tumors with HPV DNA is consistent with the known effects of the viral oncoproteins on the cellular protein . ^^^ Well keratinized tonsillar SCCs lack HPV DNA and are associated with overexpression of cyclin D 1 protein and / or p 53 , suggesting that mechanisms that alter the cell cycle regulatory proteins , either by interaction with viral oncoproteins or by changes in the cellular proteins themselves , is critical for tumorigenesis of tonsillar SCC . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is required for processive DNA synthesis catalyzed by DNA polymerase delta ( pol delta ) and polymerase epsilon . ^^^ We have shown that the epitope of a human PCNA inhibitory monoclonal antibody ( 74B1 ) , which inhibits the PCNA stimulation of DNA synthesis catalyzed by pol delta , maps to residues 121 135 , which overlap the interdomain connector loop of PCNA ( residues 119 133 ) . ^^^ Mutations of Val 123 , Leu 126 , Gly 127 , and Ile 128 affected the ability of PCNA to stimulate DNA synthesis by pol delta in several different assays . ^^^ This same region is involved in the binding of p 21 , and our findings support the view that the mechanism of inhibition of DNA synthesis by p 21 is due to a competition for PCNA binding to pol delta . . ^^^ Proliferating cell nuclear antigen ( PCNA ) is required for processive DNA synthesis catalyzed by DNA polymerase delta ( pol delta ) and polymerase epsilon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results indicate that AP sites can be repaired on circular DNA by the PCNA dependent pathway in addition to the polbeta dependent pathway and that the PCNA dependent repair mechanism is poorly functional on linear DNA in vitro . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The effect of expression of the p 53 gene , in the presence or absence of the p53ser246 mutation ( p53 * ) , on ploidization ( image cytometry ) , proliferation ( expression of proliferating cell nuclear antigen and radioactive thymidine histoautoradiography ) , and apoptosis ( in situ detection of DNA fragments ) is determined in hepatocytes of p 53 null and p53 * transgenic mice . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
G 1 cyclin dependent kinases are sufficient to initiate DNA synthesis in quiescent human fibroblasts . ^^^ These two G 1 cyclin Cdk complexes act on a family of E2F associated transcriptional repressors typified by the retinoblastoma protein ( Rb ) to bring about a transcriptional program that promotes passage through S phase [ 7 9 ] , but can also activate DNA replication independently of Rb E2F [ 10 12 ] . ^^^ Here , we report that serum starved ( G 0 ) diploid human fibroblasts initiate DNA synthesis upon microinjection of active G 1 cyclin Cdk complexes , but not upon microinjection of an S phase cyclin Cdk complex . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we demonstrate that the D type cyclins , cyclin D 1 and D 2 in particular , specifically inhibit transcription when activated through the 5 Myb DNA binding domain , but not the c Myb DNA binding domain . ^^^ Association of cyclin D 1 and D 2 with the Myb DNA binding domain could be demonstrated . ^^^ Increased levels of cyclin D 1 and D 2 resulted in a stabilization of the Myb proteins , but not in an alteration in binding of the Myb proteins to DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These data would suggest that delaying the onset of M phase in NIH 3T3 cells in which the rate of DNA replication is reduced , is first ensured by a mechanism that prevents the cytoplasmic relocation of inactive p34cdc2 / cyclin B 1 complexes continually forming in the nucleus once the G 1 period of mitotic cyclin instability is over . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Disruption of fibronectin binding to the alpha 5 beta 1 integrin stimulates the expression of cyclin dependent kinases and DNA synthesis through activation of extracellular signal regulated kinase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Nuclear DNA content , S phase fraction analysis and expression of proliferating cell nuclear antigen ( PCNA ) of normal and hyperplastic / neoplastic parathyroid glands . ^^^ To clarify the biological behavior , the flowcytometric nuclear DNA content , S phase fraction ( SPF ) and proliferating cells by immunostaining of proliferating cell nuclear antigen ( PCNA ) were investigated in 13 patients with hyperparathyroidism ( 10 adenomas , 2 hyperplasias and 1 cancer ) and 10 normal controls . ^^^ In conclusion , there might be some premalignant potential in the adenomas from the view of DNA flowcytometry and PCNA immunostaining . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Sulindac sulfide induces several subpopulations of colon cancer cells , defined by PCNA / Ki 67 and DNA strand breaks . ^^^ We applied a triparameter flow cytometric analysis that simultaneously determined DNA content , expression of Ki 67 or proliferating cell nuclear antigen ( PCNA ) , and extent of DNA strand breaks by TUNEL ( TdT mediated dUTP nick end labeling ) . ^^^ Another subpopulation was detected that was PCNA / Ki 67 ( + ) / TUNEL ( + ) , some had a dominant subdiploid peak and over half were in S or G2 / M phases by DNA content . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
When Xenopus cyclin D 2 is added to egg extracts , the first round of DNA replication occurs as in control extracts . ^^^ However , Xenopus cyclin D 2 blocks subsequent rounds of DNA replication and the oscillations of histone H 1 kinase activity associated with cdc 2 kinase , indicating that the cell cycle is arrested after the first S phase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These may occur either by overexpression of genes such as cyclin D 1 , mutation of regulatory genes such as p 16 , or abrogation of checkpoints following DNA damage as in the cases of mutation or deletion of the p 53 gene . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Mouse genomic DNA harboring the full coding sequence of cyclin G 1 was cloned and analyzed . ^^^ The mouse cyclin G 1 gene was mapped to bands A 5 to B 1 of chromosomes 11 ( 11A5 B 1 ) by FISH using genomic DNA clone as a biotinylated probe . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Functional studies have shown that the molecule is composed of an N terminal acidic activation domain , a central region which is necessary for interaction with a negative regulatory factor ( the cyclin Pho 80 ) and a C terminal basic helix loop helix domain , which mediates DNA binding and homodimerization . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Importantly , the Pol 2 holoenzyme complex does not contain some factors previously reported as stoichiometric components of the holoenzyme complex , most notably the proteins which function in repair of damaged DNA , such as PCNA , RFC and RPA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Despite having 4N DNA content , adapted cells are similar to G 1 cells in that they have upregulated cyclin E expression and hypophosphorylated Rb protein . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Activation of the MEK1 / ERK pathway neither triggered degradation of the CDK inhibitor kinase inhibitory protein 1 ( p 27 ( Kip 1 ) ) nor led to activation of cyclin E and A dependent CDK 2 , and such cells did not enter the DNA synthetic ( S ) phase of the cell division cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Characterization of cyclin B 1 expression in human cancer cell lines by a new three parameter BrdUrd / cyclin B1 / DNA analysis . ^^^ Flow cytometric cyclin expression / DNA content analysis , now commonly used , provides useful information on the mechanisms regulating cell cycle progression . ^^^ This paper proposes a new three parameter flow cytometric method with which to determine cyclin B 1 levels in single cells in different cell cycle phases by coupling bromodeoxyuridine ( BrdUrd ) immunodetection and DNA content . ^^^ DNA denaturation by HCl did not alter the level of cyclin B 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The function of proliferating cell nuclear antigen ( PCNA ) in DNA replication and repair is to form a sliding clamp with replication factor C ( RF C ) tethering DNA polymerase delta or epsilon to DNA . ^^^ The crystal structure of yeast PCNA shows that the protein forms a homotrimeric ring lining a hole through which double stranded DNA can thread , thus forming a moving platform for DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We demonstrate that cyclin E can drive chromosome association of DmMCM 2 and that DNA synthesis erases this association . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In these rats , hepatic regenerative activity was documented at 12 , 24 , and 60 hours post D gal by 3H thymidine incorporation into hepatic DNA and proliferating cell nuclear antigen ( PCNA ) staining . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The p 21 protein also binds to proliferating cell nuclear antigen ( PCNA ) through a separate C terminal domain affecting DNA replication and repair . ^^^ Here we show that the human p 57 protein , like p 21 , contains a PCNA binding domain within its C terminus that , when separated from its N terminal CDK cyclin binding domain , can prevent DNA replication in vitro and S phase entry in vivo . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The CDK 7 cyclin H MAT 1 complex is tightly associated with a multiprotein complex TFIIH , which plays a dual role in transcription and DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A unique feature of p 21 that distinguishes it from the other cyclin dependent kinase ( CDK ) inhibitors is its ability to associate with the proliferating cell nuclear antigen ( PCNA ) , an auxiliary factor for DNA polymerases delta and epsilon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Induction of growth arrest and cell death by overexpression of the cyclin Cdk inhibitor p 21 in hamster BHK 21 cells . p21cip1 / waf1 / sdi1 is a universal cyclin Cdk kinase inhibitor that has two functional domains ; one binds and inhibits cyclin Cdk activity and the other binds PCNA and thereby inhibits elongation by DNA polymerase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We also demonstrate that PCNA is required in human mismatch repair not only at the step of repair initiation , but also at the step of repair DNA re synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The following data and parameters were registered and / or measured : sex , stage , tumor size , histological type , mean nuclear profile area ( mA ) and pleomorphism ( standard deviation of mean nuclear profile area SDA ) nuclear grade ( NG ) and combined nuclear grade ( CNG ) , DNA index , cell proliferation , as determined by mitotic index ( MI ) , per cent of PCNA positive cells ( PCNA + cells % ) , per cent of S phase cells ( SP cells % ) , p 53 and EGFR expression , intratumoral T lymphocytes . ^^^ Higher DNA index characterizes cases with worse prognosis , as well as MI , SP cells % , PCNA + cells % , and EGFR expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Also , p21waf1 can interact with proliferating cell nuclear antigen ( PCNA ) , and as such inhibit in vitro DNA replication . ^^^ In contrast , p21waf1 does not seem to inhibit the function of PCNA in ongoing DNA replication , since cells expressing high levels of p21waf1 apparently progressed normally through S phase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We show that Ras dependent mitogenic signaling is essential for the normal stimulation of cyclin A promoter activity and DNA synthesis in VSMCs . ^^^ Moreover , c fos overexpression in serum starved VSMCs results in the induction of cyclin A promoter activity in a CRE dependent manner , and increased binding of endogenous c fos protein to the cyclin A CRE precedes the onset of DNA replication in VSMCs induced by serum in vitro and by angioplasty in vivo . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The present study analyze the importance of the integration of DNA of HPV type 18 on the proliferative capability of oral squamous cell carcinoma ( OSCC ) by the study of PCNA expression . ^^^ Statistical correlations between PCNA expression and DNA HPV 18 amplification showed a more intense PCNA expression in HPV 18 positive OSCCs ( p = 0 . 023 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We investigated the requirements for protein p 53 and the ATM gene product in radiation induced inhibition of DNA synthesis and regulation of the cyclin E / and cyclin A / cyclin dependent kinases ( Cdks ) . ^^^ The absence of p 53 had no significant effect on the inhibition or recovery of DNA synthesis throughout the S phase , as determined from BrdU labeling and flow cytometry , or the rapid inhibition of cyclin A / Cdks . ^^^ In contrast , loss of the ATM gene product abrogated transient cyclin E / Cdk2 inhibition , most inhibition of DNA synthesis and all , but a 10 15 % inhibition , of the cyclin A / Cdks . ^^^ The results indicate that neither p 53 nor p 21 is required for transient inhibition of cyclin E / Cdk2 associated with the G1 / S checkpoint or for inhibition of DNA synthesis at ' checkpoints ' within the S phase . ^^^ Conversely , the ATM gene product appears to be essential for regulation of the G1 / S checkpoint and for inhibition of DNA replication associated with the inhibition of cyclin A / Cdk2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Fifth , Mas and Rac 1 stimulated transcription from common DNA promoter elements : NF kappaB , serum response factor ( SRF ) , Jun / ATF 2 , and the cyclin D 1 promoter . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
D type cyclins associate with a region of the DMP 1 DNA binding domain immediately adjacent to the myb repeats to form heteromeric complexes which detectably interact neither with cyclin dependent kinase 4 ( CDK 4 ) nor with DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It functions to load the proliferating cell nuclear antigen ( PCNA ) , a processivity factor for polymerases delta and epsilon , onto primed DNA templates . ^^^ This process , which is ATP dependent , is carried out by 1 ) recognition of the primer terminus by RFC ( ) binding to and disruption of the PCNA trimer , and then 3 ) topologically linking the PCNA to the DNA . ^^^ Like native RFC derived from 293 cells , recombinant RFC was found to support SV 40 DNA synthesis and polymerase delta DNA synthesis in vitro and to possess an ATPase activity that was highly stimulated by DNA and further augmented by PCNA . ^^^ In addition , a stable subcomplex lacking the 140 kDa subunit , although defective for DNA replication , was found to possess DNA dependent ATPase activity that was not responsive to the addition of PCNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In differentiated TR 14 cells , okadaic acid increases the fraction of cells in the S phase , induces the appearance of cyclin B 1 and cyclin D 1 markers of the cell cycle , and triggers a time dependent increase in DNA fragmentation after release of a thymidine block . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Chromosome fragmentation resulting from an inability to repair transposase induced DNA double strand breaks in PCNA mutants of Drosophila . ^^^ Proliferating cell nuclear antigen ( PCNA ) has several roles in progression through S phase : it is required for the function of DNA polymerases delta and epsilon and physically associates with the structure specific nuclease FEN 1 that is essential for Okazaki fragment processing . ^^^ The cyclindependent kinase inhibitor p 21 appears to displace FEN 1 from PCNA to inhibit DNA replication and possibly permit participation of PCNA in nucleotide excision repair . ^^^ Here we show that PCNA is also indispensable for repair of DNA double strand breaks ( DSBs ) , lesions which are not corrected by excision repair processes . ^^^ Proliferating cell nuclear antigen ( PCNA ) has several roles in progression through S phase : it is required for the function of DNA polymerases delta and epsilon and physically associates with the structure specific nuclease FEN 1 that is essential for Okazaki fragment processing . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NGF treatment of hepatocytes did not induce expression of cyclin dependent kinase ( cdk ) inhibitor proteins , but instead stimulated cdk 2 activity and increased [ 3H ] thymidine incorporation into DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) labeling index and DNA ploidy pattern were analyzed in the resected tissue . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Involvement of the DNA replication related element ( DRE ) and DRE binding factor ( DREF ) in transcriptional regulation of the Bombyx mori PCNA gene . ^^^ Within this region , we found a sequence similar to the DNA replication related element ( DRE ) , 5 ' TATCGATA , which is a promoter activating sequence common to promoters of the Drosophila genes for DNA replication related factors , including PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our results indicate that Cyclin E activity , which triggers DNA replication , needs to be down regulated to allow a subsequent S phase in vivo . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The RAD 52 recombinational repair pathway is essential in pol 30 ( PCNA ) mutants that accumulate small single stranded DNA fragments during DNA synthesis . ^^^ We identified nine mutations that display synthetic lethality with pol 30 104 ; three mutations affected the structural gene for the large subunit of replication factor C ( rfc 1 ) , which loads PCNA onto DNA , and six mutations affected three members of the RAD 52 epistasis group for DNA recombinational repair ( rad 50 , rad 52 and rad 57 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In contrast , the endonuclease inhibitors aurintricarboxilic acid and zinc markedly inhibited taxol induced DNA ladder fragmentation without altering taxol induced cell cycle arrest , cyclin B 1 accumulation , activation of cyclin B 1 kinase activity and cytotoxicity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study , NIH3T3 cells stably transfected with a cyclin B 1 luciferase reporter vector were utilized to investigate if cyclin B 1 promoter activity is linked to either DNA replication or the activities of various cyclin cyclin dependent kinases ( cdks ) . ^^^ These results indicate that ( 1 ) cyclin B 1 promoter activity in NIH3T3 cells is linked to a DNA replication checkpoint control mechanism ; ( 2 ) the cyclin B 1 gene can be activated in the absence of functional cyclin E cdk 2 , cyclin A cdk 2 , or cyclin B cdk 2 ; and ( 3 ) cyclin B 1 gene activation can occur in G 1 arrested cells under conditions in which the arrest is not directly linked to inhibition of DNA synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factor C ( RFC ) and the proliferating cell nuclear antigen ( PCNA ) are two essential DNA polymerase accessory proteins that are required for numerous aspects of DNA metabolism including DNA replication , DNA repair , and telomere metabolism . ^^^ PCNA is a homotrimeric ring shaped sliding DNA clamp that can facilitate DNA replication by tethering DNA polymerase delta or DNA polymerase epsilon to the DNA template . ^^^ RFC is the 5 subunit multiprotein complex that loads PCNA onto DNA at primer template junctions in an ATP dependent reaction . ^^^ Mutant Rfc 1 1 complexes exhibit in vitro DNA replication defects that are sensitive to ATP concentrations , and these defects can be suppressed by mutant PCNA proteins which contain substitutions that destabilize the homotrimeric sliding DNA clamp . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
At each time interval , tissue PCNA mRNA abundance and protein levels were documented ( by Northern and Western blot analysis , respectively ) and compared with the results of PCNA immunostaining and 3H thymidine incorporation into hepatic DNA . ^^^ Changes in PCNA by immunostaining were similar but tended to occur somewhat earlier ( significant increases being detectable at 24 hours ) , whereas 3H thymidine incorporation detected the earliest increases in DNA synthesis at 12 hours and peaked at 36 hours . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We further demonstrate that : ( 1 ) persistent activation of the K+ channel in one cell embryos arrested in metaphase requires the maintenance of an active cdk 1 cyclin B complex ; and ( 2 ) both DNA synthesis inhibition with aphidicolin and DNA damage produced by mitomycin C prevent the down regulation of the channel at the start of S phase by a mechanism that requires tyrosine kinase activation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
They were the single stranded DNA binding protein , replication protein A ( RFA ) , the 3 ' primer binding complex , replication factor C ( RFC ) , and proliferating cell nuclear antigen ( PCNA ) . ^^^ AAV DNA replication could be reconstituted with purified Rep 78 , RPA , RFC , and PCNA and a phosphocellulose chromatography fraction ( IIA ) that contained DNA polymerase activity . ^^^ As both RFC and PCNA are known to be accessory proteins for polymerase delta and epsilon , we attempted to reconstitute AAV DNA replication by substituting either purified polymerase delta or polymerase epsilon for fraction IIA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Transfection of mouse cyclin D 1 complementary DNA , driven by a cytomegalovirus promoter into GH 3 cells , led to ectopic cyclin D 1 expression ; and there was a slight stimulation of cell proliferation and increased apoptosis in GH 3 cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
With giant cell differentiation , the cells switched cyclin D isoform expression from D 3 to D 1 and altered several checkpoint functions , acquiring a relative insensitivity to DNA damaging agents and a coincident serum independence . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Mammalian cells possess two distinct pathways for completion of base excision repair ( BER ) : the DNA polymerase beta ( Pol beta ) dependent short patch pathway ( replacement of one nucleotide ) , which is the main route , and the long patch pathway ( resynthesis of 2 6 nucleotides ) , which is PCNA dependent . ^^^ These DNA polymerases are also able to perform short patch BER in the absence of PCNA , although less efficiently than Pol beta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We determined by bivariate flow cytometric analysis both the DNA and cyclin protein content of individual cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Base excision repair can proceed in either one of two alternative pathways : a DNA polymerase beta dependent pathway and a proliferating cell nuclear antigen ( PCNA ) dependent pathway . ^^^ In this pathway , DNA synthesis was not required for the action of FEN 1 in the presence of PCNA and a replication factor C containing fraction . ^^^ In this pathway , FEN 1 was functional without PCNA and replication factor C but required the DNA synthesis , which led to a flap structure formation . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , in 25 of 26 cases of HCC which genomic DNA was available , 22 cases without genomic DNA amplification exhibited positive correlation , not only between protein expression of c Fos and cyclin D 1 , but also between MAPK / ERK activation and cyclin D 1 expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Because cyclin D 1 and PCNA proteins are components of many DNA synthetic and repair processes in the cell , we tested the hypothesis that preexposure of cells to low doses of ionizing radiation enabled activation of the DNA repair machinery needed for survival recovery after high dose radiation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
During DNA replication , the joining of Okazaki fragments by the LIG 1 gene product appears to be mediated by an interaction with proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
By targeting loops on the surface of the PCNA trimer and changing three or four residues at a time to alanine , we found that a region including part of the domain connecting loop of PCNA and loops on one face of the trimer , close to the C termini , is involved in binding to all of the following proteins : DNA polymerase delta , replication factor C , the flap endonuclease Fen 1 , the cyclin dependent kinase inhibitor p 21 and DNA ligase 1 . ^^^ The DNA polymerase accessory factor proliferating cell nuclear antigen ( PCNA ) has been caught in interaction with an ever increasing number of proteins . ^^^ An inhibition of DNA ligation caused by the interaction of PCNA with DNA ligase 1 was found , and we show that DNA ligase 1 and Fen 1 can inhibit DNA synthesis by DNA polymerase delta / PCNA . ^^^ We demonstrate that PCNA must be located below a 5 ' flap on a forked template to stimulate Fen 1 activity , and considering the interacting region on PCNA for Fen 1 , this suggests an orientation for PCNA during DNA replication with the C termini facing forwards , in the direction of DNA synthesis . . ^^^ Regulation of DNA replication and repair proteins through interaction with the front side of proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In diabetic rats there was jejunal hyperplasia as indicated by increases in the jejunal mucosal weight / cm and DNA content as well as increased activities of MAP K and p34cdc2 kinase and association of the latter with cyclin B as compared to corresponding values in control rats . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
MATERIALS AND METHODS : We studied 44 cases of cholesteatoma by using fluorescence in situ hybridization with specific alpha satellite DNA probes for chromosome 7 and immunohistochemical analysis of proliferating cell nuclear antigen ( PCNA ) with PC 10 monoclonal antibody . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The association of PCNA , a replication protein , with cdk cyclins during G 1 to S phase transition and with cdk cyclin inhibitors , adds an interesting complexity to regulation of DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin E / cdk2 activity is regulated at multiple levels ( by transcription , phosphorylation and inhibitor proteins ) and appears to be involved in triggering initiation of DNA replication and in regulating genes important for proliferation and progression through S phase . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Recently it has been found that B type cyclins in fission yeast regulate the activation of the cdc 2 kinase to promote the onset of both DNA replication and mitosis . cig 2 is the major G 1 cyclin while cdc 13 is the principal mitotic cyclin . cdc 13 also has an additional function in G 2 phase , preventing more than one round of DNA replication per cell cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) , the auxiliary protein of DNA polymerase delta and epsilon , is involved in DNA replication and repair . ^^^ Association with the growth arrest and DNA damage inducible proteins gadd 45 and MyD 118 , further demonstrates the role of PCNA as a component of the cell cycle control apparatus . . ^^^ Multiple roles of the proliferating cell nuclear antigen : DNA replication , repair and cell cycle control . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferation was determined by proliferating cell nuclear antigen ( PCNA ) , and DNA fragmentation indicating apoptosis was determined by in situ nick end labeling . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The results reported here unambiguously revealed that the phosphatidic acid ( generated through the activation of Receptor Ck by cholesterol ) regulates mevalonate pathway , DNA synthesis as well as expression of genes coding for c fos , c myc and cyclin ' D ' . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Consistent with our proposed model for the breast cell DNA synthesome , our data indicate that DNA polymerases alpha and delta , DNA primase , RF C , as well as proliferating cell nuclear antigen ( PCNA ) , tightly associate with each other in the complex , whereas DNA polymerase epsilon , PARP , and several other components were found to interact with the synthesome via a direct contact with only PCNA or DNA polymerase alpha . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Mutant PCNA alleles are associated with cdc phenotypes and sensitivity to DNA damage in fission yeast . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Delayed cells possessed a G 2 DNA content and elevated Clb2p mitotic cyclin levels . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In young cells , prior treatment with rapamycin inhibited the induction of DNA synthesis and activation of CDK 2 to levels similar to those seen in aged cells without inhibiting ERK activity and cyclin D 1 expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
After PH in BALB / c mice , p 21 was induced during the prereplicative ( G 1 ) phase and was maximally expressed after peak hepatocyte DNA synthesis . p 27 was present in quiescent liver and was minimally induced after PH . p 21 and p 27 immunoprecipitated with CDK 2 , CDK 4 , and cyclin D 1 in the regenerating liver . ^^^ The activity of CDK 2 , CDK 4 and cyclin D 1 associated kinases was upregulated after PH , and maximal activity of these enzyme complexes corresponded to peak DNA synthesis . ^^^ Compared to cogenic wild type mice , p 21 / mice demonstrated evidence of markedly accelerated hepatocyte progression through G 1 phase after PH : DNA synthesis , upregulation of cyclin A and PCNA , induction of cyclin D 1 and CDK 2 associated kinase activity , and appearance of a phosphorylated retinoblastoma protein ( Rb ) species occurred earlier in the p 21 / mice . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a 36 kDa protein acting as a subunit of DNA polymerase delta , and is therefore associated with DNA replication . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a 36 kDa protein acting as a subunit of DNA polymerase delta , and is therefore associated with DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The rise in aminotransferases and DNA fragmentation started after 4 h ; maximum levels were evident after 8 h . 5 Bromo 2 ' deoxyuridine staining and nuclear cyclin A expression as markers of the S phase were first detected in hepatocyte nuclei after 24 h , peaking after 48 h . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A model was proposed in which , during p 53 mediated suppression of cell proliferation following treatment with 254 nm UV radiation ( UVC ) , the enhanced expression of p 21 might inhibit DNA replication by virtue of its interactions with proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Nuclear export of cyclin B 1 and its possible role in the DNA damage induced G 2 checkpoint . ^^^ Moreover , we show that expression of the NES disrupted cyclin B 1 or LMB treatment of the cells is able to override the DNA damage induced G 2 checkpoint when combined with caffeine treatment . ^^^ These results suggest a role of nuclear exclusion of cyclin B 1 in the DNA damage induced G 2 checkpoint . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Retrospective analysis of selected tumor markers ( p 53 , PCNA , Ki 67 ; DNA ploidy ) and ultrastructure in patients with larynx carcinomas ] . ^^^ A comparison was made of the staining intensities of selected immunohistochemical proliferating antigens ( p 53 , PCNA , Ki 67 ) , DNA flow cytometry and ultrastructures of neoplastic cells from 120 cases of laryngeal cancers . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Transient transfection and needle microinjection of cyclin D 2 expression constructs demonstrated that overexpression of cyclin D 2 protein efficiently inhibited cell cycle progression and DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The DNA binding domain , the pRB pocket binding region , and the amino terminal Sp 1 binding domain of E2F 1 were required for full repression of cyclin D 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In summary , our results demonstrate tight coordination of DNA methylation and replication , which is consistent with recent observations showing that DNA methyltransferase is associated with proliferating cell nuclear antigen in the replication fork . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Evaluation of prognosis with emphasis on the study of DNA ploidy and proliferation ( PCNA and Ki 67 ) markers . ^^^ The prognostic value of gender , age , duration of symptoms , location , compartmentalization , size , adequacy of surgical margins , residual tumor , adjuvant therapy , histologic subtype , extent of necrosis , glandular differentiation , calcification , and extent of hemangiopericytic areas , mitotic rate , amount of mast cells , blood vessel invasion , histologic ( UICC and NCI ) grades , DNA ploidy , percentage of cells in S and S+G2 phases , PCNA and Ki 67 labeling indices ( LI ) , and TNM ( UICC ) stage of the tumors , were evaluated by univariate and multivariate ( Cox hazard model ) analyses . ^^^ Short duration of symptoms ( < 12 months ) , biphasic SS , scarcity of mast cells ( < 10 / 10 HPF ) , high mitotic rate ( > or =10 / 10 HPF ) , high histologic grade ( grade 3 ) , high PCNA LI ( > or =20 % ) , high Ki 67 LI ( > or =10 % ) , DNA aneuploidy , and advanced TNM stage ( stage 3 ) were features associated with significantly shorter relapse free and overall 5 year survival rates in the univariate analyses . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Investigation of p 53 , c erbB 2 , PCNA immunoreactivity , DNA content , AgNOR and apoptosis in bladder carcinoma as prognostic parameters . ^^^ The association between known prognostic variables such as TNM stage , histological grade and mutant p 53 tumor suppressor gene product , c erbB 2 oncoprotein , DNA ploidy and cell kinetic data , including mitoses , PCNA expression , AgNOR scores and apoptosis , was investigated in 29 transitional cell carcinoma ( TCC ) cases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Normally DNA repair processes set in with the expression of PCNA in the keratinocyte . ^^^ The present study indicates the differentiating keratinocytes in skin do not express PCNA but appear to be dependent on active UV responding melanocytes for DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Nuclear localization of cyclin B 1 controls mitotic entry after DNA damage . ^^^ Nuclear targeting of cyclin B 1 was particularly effective in cells arrested in G 2 by DNA damage , where it greatly reduced the damage induced G 2 arrest . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Low dose therapy consisting of cisplatin plus 5 fluorouracil was given to 20 patients with advanced gastric cancer , and specimens were obtained to evaluate levels of 5 fluorodeoxyuridine ( FdUMP ) and thymidylate synthase ( TS ) , indices of DNA , and proliferating nuclear cell antigen ( PCNA ) . ^^^ The correlation between DNA index and TS values and between PCNA labeling index and TS values were good . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The total protein and DNA contents were highest with EGF treatment , followed by combination treatment ; these observations were supported by immunohistochemical localization of proliferating cell nuclear antigen , an indication of the proliferative state of tissues . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin D1 / CCND1 oncogene ( PRAD 1 ) is amplified in 15 % of primary human breast cancers and overexpressed in 30 50 % of breast cancers , suggesting that mechanisms in addition to DNA amplification may lead to deregulated expression of this gene in breast cancer . ^^^ Polymerase chain reaction and NciI digestion ( PCR RFLP ) analysis of genomic DNA demonstrated DNA amplification of one allele in the ZR 75 1 cells and HT 29 cells and no such imbalance in cyclin D 1 gene copy number in the other cells , consistent with Southern blot analyses . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Polymerase chain reaction ( PCR ) with a set of degenerated primers produced a fragment of about 610 base pairs [ bp ] from genomic DNA of both species ; the PCR products appeared close in size to the amplified from rat PCNA and hybridized to the pCR 1 probe . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Involvement of the proliferating cell nuclear antigen ( PCNA ) in DNA repair induced by alkylating agents and oxidative damage in human fibroblasts . ^^^ The involvement of the proliferating cell nuclear antigen ( PCNA ) in the process of DNA repair induced by alkylating agents or by oxidative damage was investigated in human quiescent fibroblasts by immunofluorescence and flow cytometry . ^^^ Transition from soluble to the DNA bound form of PCNA , was taken as the parameter to determine its involvement in repair DNA synthesis . ^^^ These results indicate that agents inducing DNA base alterations in vivo , promote the nuclear binding of PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Its mode of DNA synthesis is high processive with or without proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The addition of CaM inhibitors to cultures of proliferating NRK cells blocked the activity of the cyclin dependent protein kinases 4 ( cdk 4 ) and 2 ( cdk 2 ) , which are enzymes implicated in the progression of G 1 and in the onset of DNA replication , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our results suggest that the inhibition may be due to DNA ligase 1 interaction with proliferating cell nuclear antigen ( PCNA ) and not to a direct interaction with the DNA polymerase delta itself . ^^^ The DNA polymerase delta holoenzyme ( composed of DNA polymerase delta , PCNA , and replication factor C ) was inhibited in the same way as the DNA polymerase delta core , strengthening the hypothesis of a PCNA interaction . ^^^ Contrary to DNA polymerase delta , DNA synthesis by DNA polymerase epsilon was stimulated by DNA ligase 1 in a PCNA dependent manner . ^^^ We conclude that DNA ligase 1 displays different influences on the two multipotent DNA polymerases delta and epsilon through PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The results suggest that FGF or lysophosphatidic acid induced transcription of cyclin A and cyclin E genes is mediated by calcineurin involving a MAP kinase independent mechanism and that increased expression of cyclins A and E is required for the maximal stimulatory effects of these mitogens on DNA synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Apoptosis was examined using a DNA nick end labeling assay , and cell proliferation was examined by PCNA staining . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We now show that UV irradiation of B 16 melanoma after prior exposure to the radiation sensitizer , bromodeoxyuridine ( BUdR ) leads to induction of p 53 and DNA fragmentation , and concomitant decreases in Rb , E2F , cyclin D 1 , and cell viability , with no comparable effects on irradiated unsensitized cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
MATERIALS AND METHODS : We present a study of 80 cases from the files of the Spanish neuroblastoma study group ( N 2 92 ) analysing bcl 2 protein expression by means of immunohistochemical methods and its relation with other parameters such as histopathology , PCNA expression , N myc amplification and DNA study of apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Contrarily , TGF beta 1 induced inhibition of DNA synthesis in HuCCT 1 cells is preceded by IRF 1 dependent but p 53 independent up regulation of p21 / Waf1 expression followed by inactivation of cyclin E associated kinase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have demonstrated that extracellular signal regulated kinases ( ERKs ) and cyclin D 1 are required for bovine tracheal myocyte DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
AML samples were similarly analyzed and the majority showed lower DNA synthesis cell cycle phase ( S ) fractions and lower PCNA positive fractions than normal myeloid cells , suggesting that AMLs are generally less proliferative in these culture conditions . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The inhibitory effect on DNA synthesis was associated with a delayed progression to S phase of the cell cycle , as determined by flow cytometry and detection of cyclin A and cdc 2 which are two proteins expressed during the S phase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the G 1 ( resting ) phase of the cell cycle , cyclin D 1 together with its cyclin dependent kinase ( cdk ) partner , is responsible for transition to the S ( DNA synthesis ) phase by phosphorylating the product of the retinoblastoma gene ( pRB ) , which then releases transcription factors important in the initiation of DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Subsequent Southern blot analysis showed that genomic DNA from the patient ' s cells contained an extra band in the EcoRI digest , suggesting that one allele of the cyclin D 1 gene may be altered . ^^^ Polymerase chain reaction ( PCR ) analysis of the genomic DNA and direct DNA sequencing clearly disclosed that one allele of the cyclin D 1 gene was deleted in the 3 ' untranslated region , which would contribute to an increased stability of its mRNA . ^^^ Reverse transcription polymerase chain reaction ( RT PCR ) analysis and direct DNA sequencing revealed that the cyclin D 1 mRNA was deleted at the corresponding region . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Quiescent rat thyroid cells in culture , induced to synthesize DNA by thyrotropin ( TSH ) , expressed cyclin D 1 gene after 6 hr and cyclin E gene with a peak at 18 hr from the stimulus ; K ras transformed rat thyroid cells , which grew without addition of hormones necessary for normal cell proliferation , expressed elevated levels of cyclin D 1 and cyclin E , compared with normal differentiated thyroid cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The tumor DNA content , p 53 protein expression , proliferating cell nuclear antigen labeling index , and argyrophilic proteins of nuclear organizer regions were used as markers of biological malignancy . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
IGF 1 and insulin also increased the number of cells in the S + G2 / M phases of the cell cycle , PCNA levels , and DNA synthesis at 24 h . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferative activity was also evaluated using static cytometry to assess DNA content and immunohistochemistry for proliferating cell nuclear antigen ( PCNA ) positivity . ^^^ The presence of three or more of chromosome 7 was observed in 71 % of the cases , as was a high S phase , with a triploid prevalent DNA content and a PCNA index above mean value in 66 % of the cases . ^^^ Detection of trisomy 7 with fluorescence in situ hybridization and its correlation with DNA content and proliferating cell nuclear antigen positivity in prostate cancer . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Induction of proliferating cell nuclear antigen ( PCNA ) , a marker of DNA synthesis , occurs at 24 h after PH in young rats but is delayed and reduced in old animals . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Two recent reports have identified DNA ( cytosine 5 ) methyltransferase ( MCMT ) and the DNA repair endonuclease XPG as binding to PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Transcription factor E2F and cyclin E Cdk 2 complex cooperate to induce chromosomal DNA replication in Xenopus oocytes . ^^^ Co injection of human E2F 1 and cyclin E proteins into immature oocytes allowed them to initiate DNA replication even in the absence of progesterone treatment . ^^^ Injection of cyclin E alone , which was sufficient to activate endogenous Cdk 2 kinase , failed to induce DNA replication . ^^^ Thus , like somatic cells , both activities of E2F and cyclin E Cdk 2 complex are required for induction of the DNA replication ability in maturing Xenopus oocytes , and enhancement of both activities enables oocytes to override DNA replication inhibitory mechanisms that specifically lie in maturing oocytes . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We speculate that an excessive increase in expression of PCNA which signals activation of cell proliferation creates a disorder in the signals involved with DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PARP poly ( ADP ribosyl ) ates 15 of the approximately 40 proteins of the MRC , including DNA polymerase alpha ( DNA pol alpha ) , DNA topoisomerase 1 ( topo 1 ) , and proliferating cell nuclear antigen ( PCNA ) . ^^^ Immunoblot analysis further revealed that , although PCNA and topo 1 were present in total extracts from both control and PARP antisense cells , they were present in the MRC fraction only from induced control cells , indicating that PARP may play a role in their assembly into an active DNA synthesome . ^^^ Depletion of PARP also prevented induction of the expression of the transcription factor E2F 1 , which positively regulates transcription of the DNA pol alpha and PCNA genes ; thus , PARP may be necessary for expression of these genes when quiescent cells are stimulated to proliferate . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
N terminal fragments of DNA ligase 1 and the RF C large subunit that contain the RFTS both interact with proliferating cell nuclear antigen ( PCNA ) in vitro . ^^^ Moreover , the RFTS of DNA ligase 1 and of the RF C large subunit is necessary and sufficient for the interaction with PCNA . ^^^ Both subnuclear targeting and PCNA binding by the DNA ligase 1 RFTS are abolished by replacement of the adjacent phenylalanine residues within box 1 . ^^^ Since sequences similar to the RFTS / PCNA binding motif have been identified in other DNA replication enzymes and in p 21 ( CIP1 / WAF1 ) , we propose that , in addition to functioning as a DNA polymerase processivity factor , PCNA plays a central role in the recruitment and stable association of DNA replication proteins at replication factories . . ^^^ DNA ligase 1 is recruited to sites of DNA replication by an interaction with proliferating cell nuclear antigen : identification of a common targeting mechanism for the assembly of replication factories . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The following factors were investigated : tumor size , histologic grading maximal thickness , perineural invasion , DNA ploidy and PCNA expression . ^^^ In conclusion , we found that LLSCC greater than 2 cm in diameter , with histological grading G 3 G4 , thickness of more than 6 mm , DNA aneuploidy and high PCNA expression ( PCNA LI > 0 . 48 ) , were at high risk for the development of lymph node metastases . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Among them three main accessory proteins , replication factor C ( RF C ) , proliferating cell nuclear antigen ( PCNA ) and replication protein A ( RP A ) , are essential for accurate and processive DNA synthesis by DNA polymerases . ^^^ RF C can bind to a template primer junction and , in the presence of ATP , load the PCNA clamp onto DNA , thereby recruiting DNA polymerases to the site of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA ploidy and the labeling index ( LI ) of proliferating cell nuclear antigen ( PCNA ) in gastric cancers were determined using cytofluorometry and immunohistochemistry , respectively , and the prognostic value of these two parameters was evaluated . ^^^ Thus , the combination of DNA ploidy and PCNA LI may be a useful prognostic indicator for advanced gastric cancers . . ^^^ Prognostic value of DNA ploidy and proliferating cell nuclear antigen in gastric cancer . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using these cell lines , all of which had an intact mitogenic response program to serum , we show that : ( 1 ) an increase in GTP / GDP ratio is an early event that distinguishes cells capable of entering S phase after IGF 1 from cells that do not ; ( 2 ) all cells that are induced to synthesize DNA by IGF 1 have increased phosphorylation of MAP kinases , regardless of their ability to divide ; ( 3 ) the same cell lines display a similar increase in cyclin A and B expression at early times after stimulation ; and ( 4 ) cyclin levels and cyclin B associated cdc 2 kinase activity remain elevated at later times only in cells that undergo cell division . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In driving T cell proliferation , IL 2 stimulates a new program of gene expression that includes proliferating cell nuclear antigen ( PCNA ) , a requisite processivity factor for DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our previous data demonstrated that Ras activation is necessary and sufficient for transforming growth factor beta ( TGFbeta ) mediated Erk 1 activation , and is partially required for the inhibition of cyclin dependent kinase 2 ( Cdk 2 ) activity , cyclin A expression and DNA synthesis by TGFbeta ( KM Mulder and SL Morris , J . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It recognizes a primer on a template DNA , binds to a primer terminus , and helps load proliferating cell nuclear antigen onto the DNA template . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This study concerns changes in DNA content , p 53 and PCNA expression in human colon in dysplastic , precancerous and cancerous tissues . ^^^ DNA ploidy was analyzed by flow cytometry and PCNA and p 53 expression was evaluated by immunohistochemistry using monoclonal antibodies PC 10 and PAb 1801 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA replication by Poldelta * on a natural DNA template was dependent on PCNA and on replication factor C . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
By bidirectional sequencing of the ends of T DNA linked plant DNA segments , nine T DNA inserts were thus localized in genes coding for the Arabidopsis ASK 1 kinase , cyclin 3b , J domain protein , farnesyl diphosphate synthase , ORF 02 , an unknown EST , and homologues of a copper amine oxidase , a peripheral Golgi protein and a maize pollen specific transcript . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
At various times after carcinogen and diet , and prior to carcinogenesis , we examined the percentage of proliferating cells in terminal end bud ( TEB ) epithelial structures of the rat mammary gland by proliferating cell nuclear antigen staining , mammary gland architecture by whole mounting , and PhIP DNA adduct levels in mammary epithelial cells by the 32P post labeling assay . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This is accomplished by transcriptional induction of p 21 , which mediates the inhibition of cyclin E associated protein kinase activity , pRb hypophosphorylation and inhibition of DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To test the relative efficiency of each nuclear DNA polymerase for discontinuous synthesis , equal amounts ( as measured by DNA polymerase activity ) of DNA polymerases alpha , beta , delta ( + / PCNA ) and straightepsilon ( + / PCNA ) were used in the discontinuous DNA synthesis assay . ^^^ DNA polymerase alpha showed the most discontinuous DNA synthesis activity , although small but detectable levels were seen for DNA polymerases delta ( +PCNA ) and straightepsilon ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
While preventing from apoptosis , pre conditioning led to increased number of living neurons , DNA synthesis , with persistent overexpression of Bcl 2 and proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
However , visceral glomerular epithelial cell ( vGEC ) proliferating cell nuclear antigen staining and increased glomerular histone mRNA in passive Heymann nephritis ( PHN ) , suggest that vGECs may enter the cell cycle and undergo DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 antisense oligonucleotides blocked serum stimulated induction of cyclin D 1 and DNA synthesis , whereas cyclin D 1 sense oligonucleotides had no effect . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Interestingly , Rat 1 cells coexpressing cyclin E and PSM RB could not complete DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Regulation of cyclin G 1 during murine hepatic regeneration following Dipin induced DNA damage . ^^^ To examine the cell cycle regulation of cyclin G 1 in vivo , two models of coordinated cell proliferation induced by partial hepatectomy ( PH ) in the presence or absence of DNA damage were used . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Protein PCNA interactions : a DNA scanning mechanism . ^^^ Interestingly , all of the enzymes known to interact with PCNA either recognize specific structures on DNA or have limited DNA sequence specificity . ^^^ Proteins that have low sequence specificities could utilize PCNA as an adapter in order to interact with their DNA substrates . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Polypeptides involved in proliferation and DNA repair , such as proliferating cell nuclear antigen and Ki 67 , have been found within zones of expected cell senescence . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Increased expression of cyclin G 1 and p21WAF1 / CIP1 in neurons following transient forebrain ischemia : comparison with early DNA damage . ^^^ We studied the spatial expression of the DNA damage inducible gene p 53 and its transcriptional targets p21WAF1 / CIP1 , cyclin G 1 , and Bax and compared their expression with markers of early DNA damage following 10 min of transient forebrain ischemia in rats . ^^^ Single stranded DNA breaks detected with DNA polymerase 1 mediated in situ nick translation partly overlapped with nuclear cyclin G 1 protein in the striatum , cortex , and hippocampus at 24 hr , however at 48 hr cyclin G 1 remained elevated only in neurons bordering areas exhibiting DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To investigate the possible role of p21 / WAF1 in human hepatocellular carcinomas ( HCCs ) , we examined the expression of p21 / WAF1 and its relation with PCNA and p 53 expression in 97 surgically resected HCCs by immunohistochemistry and with the mutation status of p 53 in 26 HCCs . p 53 mutation status was examined by direct DNA sequencing using 3 sets of primers covering exons 5 9 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) functions in DNA replication and DNA repair and is a component of the synthesome . ^^^ This unique form is not the result of a genetic alteration , as demonstrated by DNA sequence analysis of the PCNA gene from malignant and nonmalignant breast cells . ^^^ Proliferating cell nuclear antigen ( PCNA ) functions in DNA replication and DNA repair and is a component of the synthesome . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Data indicated that serum deprivation induced GC apoptosis characterized by DNA laddering , which was associated with decreased expression of proliferating cell nuclear antigen ( PCNA ) and increased expression of p 53 protein , Fas antigen and Fas ligand . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We show that Cdk 2 as well as its potential partner cyclin A are present in the nucleus in G 1 and S phase and therefore available for DNA replication . ^^^ Because olomoucine , DMAP , and emetine treatments did not preclude DNA synthesis , neither cyclin A / Cdk1 nor cyclin B / Cdk1 kinase activities are necessary to replace the absence of Cdk 2 kinase in promoting DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The large subunit within this complex contains a C terminal DNA binding domain which provides specificity for PCNA loading at a primer template and a second , N terminal DNA binding domain of unknown function . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The eukaryotic polymerase processivity factor , PCNA , interacts with cell cycle regulatory proteins such as p 21 ( WAF1 / Cip1 ) and Gadd 45 , as well as with proteins involved in the mechanics of DNA repair and replication . ^^^ A conserved PCNA binding motif is found in a subset of PCNA interacting proteins , including p 21 , suggesting that the regulation of these interactions is important for the co ordination of DNA replication and repair . ^^^ Two of these proteins contain the consensus PCNA binding domain : one is the Dacapo protein , a Drosophila homologue of p 21 ( WAF1 / Cip1 ) , and the second is the transposase encoded by the Pogo DNA transposon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A became detectable in the 2n DNA peak . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Prognostic significance of different biological markers ( DNA index , PCNA index , apoptosis , p 53 , karyotype ) in 126 adenocarcinoma gastric biopsies . ^^^ METHODS : One hundred twenty six preoperative cancer gastric biopsies , selected according the stage evaluated after following gastrectomy , were examined for DNA content by means the static cytometry , proliferating cell nuclear antigen ( PCNA ) , p 53 mutation , apoptosis by immunohistochemistry and karyotype using fluorescence in situ hybridization ( FISH ) techniques . ^^^ A multivariate analysis showed that the DNA content and PCNA LI were the only independent prognostic markers for survival ( p = 0 . 005 and p = 0 . 0002 respectively ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Moreover , the simultaneous flow cytometric analysis of cyclin B and DNA content showed that cyclin B expression was not only increased but also unscheduled with respect to its usual cell cycle pattern . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Hepatocellular regeneration was assessed by 3H thymidine ( 3H T ) incorporation into hepatonuclear DNA and proliferating cell nuclear antigen ( PCNA ) studies during 0 96 hr after CCl 4 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
OBJECTIVES : p 21 ( waf1 / cip1 ) protein is a cyclin dependent kinase inhibitor able to arrest the cell at the G 1 phase by inhibiting DNA replication through interaction with proliferating cell nuclear antigen ( PCNA ) . ^^^ RESULTS : The expression of p 21 ( waf1 / cip1 ) protein was significantly related to DNA ploidy , S phase fraction , mitotic index , apoptotic index , morphometric nuclear factors , and the expression of p 53 and PCNA proteins , whereas it was unrelated to grade or TNM classification . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Functional sites of human PCNA which interact with p 21 ( Cip1 / Waf1 ) , DNA polymerase delta and replication factor C . ^^^ BACKGROUND : PCNA , an eukaryotic DNA sliding clamp interacts with replication factors and the cell cycle protein , p 21 ( Cip1 / Waf1 ) and functions as a molecular switch for DNA elongation . ^^^ To understand how DNA replication is regulated through PCNA , elucidation of the precise mechanisms of these protein interactions is necessary . ^^^ Competition between p 21 and pol delta or RFC for binding to PCNA results in efficient inhibition of its stimulation of pol delta DNA synthesis and RFC ATPase but not of PCNA loading on DNA by RFC . ^^^ CONCLUSIONS : Semi saturated amounts of p 21 selectively block formation of the active pol delta complex but not the RFC PCNA complex at 3 ' ends of DNA primers . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , the major accumulation of cyclin B 1 , a cell cycle marker that is usually ascribed to G 2 , overlaps extensively with very late DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis by cyclin E overexpressing cells was higher , but optimal DNA synthesis by these cells required the presence of CGF and EGF . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RanQ69L and RanT24N prevent lamina assembly , PCNA accumulation and DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This was shown by activation of cyclin dependent kinase 4 ( Cdk 4 ) and Cdk 2 and by the induction of DNA synthesis . ( 2 ) PI 3 kinase activation alone was not , however , sufficient to provide for progression through the entire cell cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The kinetics of SA induced DNA synthesis and G 1 cyclin expression were similar to those elicited by FGF 1 , indicating that SA induces cell cycle progression . ^^^ At high cell densities , SA induced G 1 cyclin expression and DNA synthesis were more strongly inhibited than those induced by FGF 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Western immunoblot analysis of cyclins ( A , B 1 , D 1 and E ) and p27Kip1 , a cyclin dependent kinase inhibitor , indicated that TPA induced cyclin A and cyclin B 1 expression in P+ ( but not in P ) JB 6 cells and this induction coincided in time with TPA induced synthesis of DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In a subset of 129 patients , where matched tumour RNA and DNA was available , EMS 1 mRNA overexpression was associated predominantly with gene amplification ( P = 0 . 0061 ) , whereas cyclin D 1 mRNA overexpression was not ( P = 0 . 3142 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Human replication factor C ( hRFC ) is a five subunit protein complex ( p 140 , p 40 , p 38 , p 37 , and p 36 ) that acts to catalytically load proliferating cell nuclear antigen onto DNA , where it recruits DNA polymerase delta or epsilon to the primer terminus at the expense of ATP , leading to processive DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is required for completion of the DNA synthesis step of DNA replication as well as nucleotide excision repair ( NER ) of damaged DNA . ^^^ Our findings indicate an altered functional state of PCNA protein in the ischemia sensitive CA 1 neurons suggesting that DNA repair processes are affected in these post mitotic cells following ischemia . ^^^ Changes in proliferating cell nuclear antigen , a protein involved in DNA repair , in vulnerable hippocampal neurons following global cerebral ischemia . ^^^ Proliferating cell nuclear antigen ( PCNA ) is required for completion of the DNA synthesis step of DNA replication as well as nucleotide excision repair ( NER ) of damaged DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To this end , cyclin D 1 gene amplification and protein accumulation , Rb gene allelic loss and protein expression , and MTS 1 gene mutation and DNA methylation were investigated in a series of 74 esophageal carcinomas . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Nineteen specimens ( 10 jugulotympanic and 9 carotid glomus tumors ) were investigated by quantitative DNA measurements and immunohistochemical assessment of proliferation markers ( PCNA , Ki 67 ) , oncogenes ( p 53 , nm 23 ) , different cell surface antigenes ( CD 44 4 / 5 and 6 , CD 54 , CD 106 ) , and bcl 2 as a marker for apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To clarify the clinicopathological significance of argyrophilic nucleolar organizer region ( AgNOR ) , proliferating cell nuclear antigen ( PCNA ) , and DNA ploidy pattern , we studied their correlations with clinicopathological factors in colorectal cancer . ^^^ METHODS : Fifty two patients with colorectal cancer were examined by AgNOR staining , immunohistochemical study of PCNA expression , and DNA flow cytometry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Subsequently , renal ornithine decarboxylase ( ODC ) activity , a marker of G 1 phase , and labeling index ( LI ) of proliferating cell nuclear antigen ( PCNA ) , a marker of DNA synthesis ( S phase ) , reached peaks at 10 and 53 hr after the injection , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In order to evaluate the localized proliferative activity of intratumor cells in Bowen ' s disease using tissue sections , skin specimens from ten patients were compared with skin samples from seven normal individuals for their expression of proliferating cell nuclear antigen ( PCNA ) , Ki 67 immunostaining and intranuclear DNA contents , quantitated with a laser cytometer ( LCM ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Initiation of proliferation but not of differentiation was followed by a 20 to 25 fold increase in the nuclear level of the DNA polymerase associated processivity factor PCNA and of the proliferation specific transcription factor E2F1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Bcl 2 expression was compared with tumour clinicopathological features , sex steroid hormone receptors , DNA content , p 53 immunoreactivity and cell proliferative activity assessed by counts of the argyrophilic nucleolar organizer regions ( AgNORs ) , the monoclonal antibody PC 10 against proliferating cell nuclear antigen and the monoclonal antibody MIB 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The Proliferating Cell Nuclear Antigen ( PCNA ) , which is an auxiliary protein for DNA polymerase delta , is found to be essential for cellular DNA replication . ^^^ These results demonstrated that this ribozyme can inhibit the DNA replication in HeLa cells effectively and could be used as a potential tool to study the function of PCNA in cellular DNA replication and cell cycle progression . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Primary human fibroblasts infected with a retroviral vector that drives the expression of a mutant p 53 protein failed to downregulate CKsHs 1 expression , degraded cyclin B despite the absence of chromosomal segregation , and underwent DNA endoreduplication . ^^^ In addition , ectopic expression of CKsHs 1 interfered with the control of cyclin B metabolism by the mitotic spindle cell cycle checkpoint and resulted in a higher tendency to undergo DNA endoreduplication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our data also demonstrate that the human CDC 6 protein ( hCDC 6 ) is essential and limiting for DNA synthesis , since microinjection of an anti CDC 6 rabbit antiserum blocks DNA synthesis and CDC 6 cooperates with cyclin E to induce entry into S phase in cotransfection experiments . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Structure of the DNA repair and replication endonuclease and exonuclease FEN 1 : coupling DNA and PCNA binding to FEN 1 activity . ^^^ The conserved FEN 1 C terminus binds proliferating cell nuclear antigen ( PCNA ) and positions FEN 1 to act primarily as an exonuclease in DNA replication , in contrast to its endonuclease activity in DNA repair . ^^^ FEN 1 mutations altering PCNA binding should reduce activity during replication , likely causing DNA repeat expansions as seen in some cancers and genetic diseases . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Two distinct pathways for completion of base excision repair ( BER ) have been discovered in eukaryotes : the DNA polymerase beta ( Pol beta ) dependent short patch pathway that involves the replacement of a single nucleotide and the long patch pathway that entails the resynthesis of 2 6 nucleotides and requires PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The two groups were compared in terms of the clinical features , p 53 gene expression ( antiserum CM 1 ) , proliferating cell nuclear antigen ( PCNA ) labeling index , DNA ploidy ( by flow cytometry ) , histopathological features , prognosis and recurrence rate . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin dependent kinases participate in death of neurons evoked by DNA damaging agents . ^^^ Consequently , we examined whether cyclin dependent kinase inhibitors ( CKIs ) and dominant negative ( DN ) cyclin dependent kinases ( CDK ) protect sympathetic and cortical neurons against DNA damaging conditions . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we show that genistein inhibits DNA synthesis and suppresses cyclin E associated cyclin dependent kinase 2 ( CDK 2 ) activity when quiescent BALB / c 3T3 fibroblasts are stimulated with serum . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PURPOSE : The present study compared proliferative indices , i . e . incorporation of DNA precursor ( i . e . thymidine or TdR , and bromodeoxyuridine or BrdU ) and expression of proliferating cell nuclear antigen ( PCNA ) , as molecular pharmacodynamic endpoints in evaluation of anticancer drug effect in human solid tumors . ^^^ Drug effect was measured as reduction of DNA precursor labeled cells or PCNA expressing cells . ^^^ RESULTS : The results indicate that ( a ) the two DNA precursors , TdR and BrdU , labeled the same cells and resulted in identical pharmacodynamics , ( b ) the pharmacodynamics established using inhibition of DNA precursor incorporation were qualitatively and quantitatively different from the pharmacodynamics established using inhibition of PCNA expression , ( c ) the inhibition of PCNA expression was erratic in some tumors , and ( d ) the differences in pharmacodynamics established using the two end points are drug specific , with greater differences for paclitaxel than for mitomycin C . ^^^ CONCLUSIONS : The erratic results measured by the PCNA labeling method suggest that this method may be less reliable than the conventional DNA precursor labeling method . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The major in vitro defect appears to be decreased stimulation of mutant enzymes by PCNA , resulting in reduced velocity of DNA synthesis . ^^^ Mutant DNA polymerase delta from thermosensitive Schizosaccharomyces pombe strains display reduced stimulation by proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This fluctuation pattern is similar to those of genes for proteins involved in DNA replication , such as DNA polymerase alpha and proliferating cell nuclear antigen , suggesting that expression of DmMCM genes is under the regulatory mechanism which regulates expression of other genes involved in DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cells released from an S phase block were not retarded in their ability to progress through S phase by the presence of p21Waf1 / Cip1 , despite efficient inhibition of cyclin E , A and B 1 dependent kinase activity , suggesting that p21Waf1 / Cip1 is inefficient at inhibiting replicative DNA synthesis in vivo . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Southern blot analysis was performed on DNA available from 53 of 84 patients with a cyclin D 1 specific probe . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , evidence for the functional significance of tumor aromatase was indicated by a correlation between aromatase activity and expression of proliferating cell nuclear antigen ( PCNA ) in the tumor , and by increased thymidine incorporation into DNA in response to testosterone in tumors in histoculture which had high aromatase activity but not in those with low activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In yeast , the involvement of the DNA replication accessory proteins , replication protein A ( RPA 1 ) and proliferating cell nuclear antigen ( PCNA ) in NER has not been demonstrated genetically . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Such chromatin recruitment resembles that seen for PCNA , a DNA replication and repair factor . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factor C disengages from proliferating cell nuclear antigen ( PCNA ) upon sliding clamp formation , and PCNA itself tethers DNA polymerase delta to DNA . ^^^ Replication factor C ( RF C ) and proliferating cell nuclear antigen ( PCNA ) assemble a complex , called sliding clamp , onto DNA . ^^^ To determine the fate of RF C after loading of PCNA onto DNA , we tagged the RF C subunit p 37 with a protein kinase A recognition motif , so that the recombinant five subunit RF C complex could be 32P labeled and quantitatively detected in femtomolar amounts . ^^^ Using gel filtration techniques , we demonstrated that RF C dissociated from the DNA after clamp loading or pol delta holoenzyme assembly , while PCNA or PCNA . pol delta complex remained bound to DNA . ^^^ PCNA catalytically loaded onto the template primer was sufficient by itself to tether pol delta and stimulate DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Overexpression of cyclin D 1 , bcl 2 , and bax proteins , proliferating cell nuclear antigen ( PCNA ) , and DNA ploidy in squamous cell carcinoma of the oral cavity . ^^^ The prognostic role of the expression of bcl 1 , bcl 2 , bax , PCNA , and DNA ploidy in a series of 25 oral squamous cell carcinoma ( SCC ) was investigated . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis was looked at by PCNA labeling . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To evaluate the prognostic value of DNA content ploidy , agoraphilic nucleolar organizing regions ( AgNORs ) and proliferating cell nuclear antigen ( PCNA ) for survival among patients with choroidal melanoma choroidal melanomas managed by enucleation in 55 patients with a follow up of 5 years were studied . ^^^ DNA content , PCNA level , and AgNOR count each showed a clinically significant influence on patient survival . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
BACKGROUND : Proliferating cell nuclear antigen ( PCNA ) ist a 36 kD protein that is involved in DNA replication and repair . ^^^ MATERIAL AND METHODS : Using V 79 hamster cells , BrdUrd incorporation , total and DNA bound PCNA were measured for exponential cells and for confluent cells at different times ( up to 14 days ) after reaching confluence . ^^^ RESULTS : Four days after reaching confluence , DNA bound PCNA and BrdUrd content were reduced to a minimum of < 15 % positive cells while total PCNA remained essentially unchanged . ^^^ After irradiation with 1 Gy 6 days after reaching confluence , cells grown with 10 % FCS showed a moderate but distinct transient increase in DNA bound PCNA at 30 min after irradiation . ^^^ In cells that were kept with serum depleted medium for 6 days after reaching confluence , total PCNA was reduced and no changes in either DNA bound PCNA or BrdUrd uptake were observed after irradiation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The activities of cyclin D dependent kinases serve to integrate extracellular signaling during G 1 phase with the cell cycle engine that regulates DNA replication and mitosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In order to elucidate the regulation of placental growth , we have characterized the expression of proliferating cell nuclear antigen ( PCNA ) , apoptotic DNA fragmentation and bcl 2 protein in human placenta during pregnancy . ^^^ PCNA and bcl 2 protein expression were examined by immunohistochemical techniques , while the occurrence of apoptotic DNA fragmentation was assessed by in situ analysis of DNA 3 ' end labeling method . ^^^ Both PCNA expression and apoptotic DNA fragmentation were found in cytotrophoblasts ( C cells ) , being most abundant in early placenta , less abundant in midterm placenta and least abundant in term placenta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA , a multifunctional ring on DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
However , proliferating cell nuclear antigen , genetic alterations or DNA ploidy are unlikely to be reliable markers to predict the prognosis of the patient . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
G 1 cyclin E controls the initiation of DNA synthesis by activating CDK 2 , and abnormally high levels of cyclin E expression have frequently been observed in human cancers . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PDGF stimulation of mitogen activated protein kinases 1 and 2 ( MAPK 1 , 2 ) , DNA synthesis , and cyclin D 1 expression was reduced in AC 2 expressing cells as compared with control cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Tissue repair was assessed by [ 3H ] thymidine incorporation into hepatonuclear DNA and proliferating cell nuclear antigen ( PCNA ) immunohistochemistry during 0 120 h after TA injection . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Chromatographic evidence was obtained for the existence of a complex that forms during DNA synthesis and includes proliferating cell nuclear antigen in addition to xFEN 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Polymerase chain reaction of DNA extracted from 22 HNSCC primary tumors and three HNSCC cell lines did not reveal amplification of cyclin D 1 in any of the tumor samples . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
On human lymphocytes , we measured geometrical features , cell contents in DNA and in cyclin A and CDK 1 proteins , localization and colocalization of these two proteins . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this review we analyse current information on the relationships between the most widely investigated breast cancer biological markers including oestrogen and progesterone receptors , p 53 , Bcl 2 , c erbB 2 , cyclin expression , proliferative activity , DNA ploidy and the urokinase plasminogen activation system , as well as their relevance to prognosis and response to clinical treatment . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) is a highly conserved cellular protein that functions both in DNA replication and in DNA repair . ^^^ Electrophoretic mobility shift assays with nuclear extracts prepared from irradiated CREF cells produced four p 53 specific DNA protein complexes with the PCNA p 53 binding site . ^^^ These findings suggest a complex cellular response to DNA damage in which p 53 transiently activates expression of PCNA for the purpose of limited DNA repair . ^^^ In a population of nongrowing cells with diminished PCNA levels , this pathway may be crucial to survival following DNA damage . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we show that phosphorylation of purified human DNA polymerase alpha primase by purified cyclin A / cdk2 in vitro reduced its ability to initiate simian virus 40 ( SV 40 ) DNA replication in vitro , while phosphorylation by cyclin E / cdk2 stimulated its initiation activity . ^^^ Phosphopeptide maps of the p 68 subunit of DNA polymerase alpha primase from human cells , synchronized and labeled in G1 / S and in G 2 , revealed a cyclin E / cdk2 like pattern in G1 / S and a cyclin A / cdk2 like pattern in G 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) labeling index was high ( more than 80 % ) whereas the Bromo deoxyaridine labeling index of ongoing DNA synthesis varied from 10 % to 15 % . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factor C ( RF C ) is a five subunit DNA polymerase ( Pol ) delta / straightepsilon accessory factor required at the replication fork for loading the essential processivity factor PCNA onto the 3 ' ends of nascent DNA strands . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the luminal columnar epithelium , the antiestrogens depressed PCNA PI but enhanced BrdU PI , indicating a low continuous DNA synthesis in otherwise quiescent cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA expression levels markedly exceeded those of the proliferation markers and did not correlate with the latter in most cases . p 21 immunolabeling indices were also consistently augmented after UV exposure ; hence it is likely that growth inhibitory mechanisms partly compensate for the proliferative impulse , and the disproportional rise in PCNA expression probably reflects DNA repair activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Examination of cyclin A protein and its associated activity revealed that cyclin A protein levels decreased in primary but not MK cells ; suggesting the continued presence of cyclin A may allow continued DNA synthesis observed in MK cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The protein proliferating cell nuclear antigen ( PCNA ) is an auxiliary factor for DNA polymerase delta and is involved in the resynthesis step of nucleotide excision repair ( NER ) . ^^^ In DNA repair proficient cells , the PCNA complex was readily detectable within 30 min after UV irradiation by both immunofluorescence and western blot analyses . ^^^ The association of several other DNA repair proteins including XPA , RPA , TFIIH and p 53 with the insoluble PCNA complex in UV treated cells suggests a central role for PCNA in different steps of NER . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Dual mode of interaction of DNA polymerase epsilon with proliferating cell nuclear antigen in primer binding and DNA synthesis . ^^^ Proliferating cell nuclear antigen can interact with DNA polymerase epsilon on linear DNA templates , even in the absence of other auxiliary factors ( replication factor C , replication protein A ) , and thereby stimulate its primer recognition and DNA synthesis . ^^^ Using four characterized mutants of proliferating cell nuclear antigen containing three or four alanine residue substitutions on the C terminal side and the back side of the trimer , we have tested the kinetics of primer binding and nucleotide incorporation by DNA polymerase epsilon in different assays . ^^^ In contrast with what has been found in interaction studies between DNA polymerase delta and proliferating cell nuclear antigen , our data suggested that stimulation of DNA polymerase epsilon primer binding involves interactions with both the C terminal side and the back side of proliferating cell nuclear antigen . ^^^ The significance of this dual interaction is discussed with reference to the physiological roles of DNA polymerase epsilon and its interaction with the clamp proliferating cell nuclear antigen . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA content , cell cycle phase fraction and cyclin D 3 expression were assessed by flow cytometry in disaggregated tumors . ^^^ In Duke ' s stage C tumors , a higher proportion of cells expressed cyclin D 3 ( 14 . 4 vs . 8 . 8 % , mean ; p < 0 . 05 by Mann Whitney U test ) and were in DNA synthesis ( S ) phase ( 21 . 1 vs . 9 . 7 % , mean ; p < 0 . 05 by Mann Whitney U test ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin dependent kinases ( CDKs ) are essential for regulating key transitions in the cell cycle , including initiation of DNA replication , mitosis and prevention of re replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The temperature sensitive cdc 24 mutant is effectively rescued by pcn 1 ( + ) , rfc 1 ( + ) ( a fission yeast homologue of RFC 1 ) , and hhp 1 ( + ) , which encode the proliferating cell nuclear antigen ( PCNA ) , the large subunit of replication factor C ( RFC ) , and a casein kinase 1 involved in DNA damage repair , respectively . ^^^ In addition , cdc 24 ( + ) genetically interacts with the gene encoding the catalytic subunit of DNA polymerase epsilon , which is stimulated by PCNA and RFC , and with those encoding the fission yeast counterparts of Mcm 2 , Mcm 4 , and Mcm 10 . ^^^ These results indicate that Cdc 24 is an RFC and PCNA interacting factor required for DNA replication and might serve as a target for regulation . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
G 2 arrest following DNA damage is associated with inactivation of the protein kinase cyclin B cdc 2 . ^^^ METHODS : Expression of cyclin B 1 , cdc 2 , cdc25c , total protein and DNA content were examined by flow cytometry in two lung cancer cell lines . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have identified the human papillomavirus ( HPV ) DNA replication initiation protein E 1 as a tight binding substrate of cyclin E / cyclin dependent kinase ( Cdk ) complexes by using expression cloning . ^^^ Our data reveal a link between cyclin / Cdk function and activation of HPV DNA replication through targeting of Cdk complexes to the E 1 replication initiation protein and suggest a functional role for E 1 phosphorylation by Cdks . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Double staining immunohistochemistry was also used to investigate the relationship between apoptotic cell death and selective protein expression associated with DNA damage and repair ( p 53 , Bax , MDM 2 , WAF 1 , Gadd 45 , PCNA ) and cell cycle protein , Cyclin D 1 , in male Wistar rats 48 h after injury . ^^^ The differential expression of proteins associated with DNA damage , repair and the cell cycle protein Cyclin D 1 in the contused brain suggest a potential role for these proteins in cell survival and apoptosis after cortical contusion . . ^^^ Proteins associated with DNA damage and repair ( p 53 , Bax , MDM 2 , WAF 1 , Gadd 45 , PCNA ) were expressed in the cytoplasm of normal cells of naive and sham rats . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The DNA helicases acting in nucleotide excision repair , XPD , CSB and XPB , are not required for PCNA dependent repair of abasic sites . ^^^ DNA repair of abasic sites is accomplished in mammalian cells by two distinct base excision repair ( BER ) pathways : a single nucleotide insertion pathway and a proliferating cell nuclear antigen ( PCNA ) dependent pathway involving a resynthesis patch of 2 10 nucleotides 3 ' to the lesion . ^^^ The latter pathway shares some enzymatic components with the nucleotide excision repair ( NER ) pathway acting on damage induced by ultraviolet light : both pathways are strictly dependent on PCNA and several observations suggest that the polymerization and ligation phases may be carried out by common enzymatic activities ( DNA polymerase delta / epsilon and DNA ligase 1 ) . ^^^ No defect of either the PCNA dependent or the single nucleotide insertion pathways could be observed in UV 5 , UV 61 or 27 1 mutant cell extracts , thus showing that the partial enzymatic overlap between PCNA dependent BER and NER does not extend to DNA helicase activities . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We examined the effects of forskolin , an activator of adenylate cyclase , on DNA synthesis , cyclin D 1 expression , and cAMP response element binding protein ( CREB ) phosphorylation and DNA binding in bovine tracheal myocytes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A transient transfection assay demonstrated that the overexpression of cyclin D 1 inhibited DNA synthesis of TIG 1 cells . ^^^ Excessive glutathione S transferase ( GST ) cyclin D 1 inhibited DNA replication and repressed cdk 2 dependent kinase activity in vitro . ^^^ DNA synthesis of NIH 3T3 transfectants with PCNA or cdk 2 expression vectors was not inhibited by the overexpression of cyclin D 1 . ^^^ These results indicate that an excessive level of cyclin D 1 represses cell proliferation by inhibiting DNA replication and cdk 2 activity through the binding of cyclin D 1 to PCNA and cdk 2 , as it does in senescent cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Transcription factor Y box binding protein 1 binds preferentially to cisplatin modified DNA and interacts with proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The addition of new serum to arrested cells resulted in cyclin A expression and Cdk 2 activity , but not in DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Interaction between the MEC 1 dependent DNA synthesis checkpoint and G 1 cyclin function in Saccharomyces cerevisiae . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A mutation of the yeast gene encoding PCNA destabilizes both microsatellite and minisatellite DNA sequences . ^^^ The POL 30 gene of the yeast Saccharomyces cerevisiae encodes the proliferating cell nuclear antigen ( PCNA ) , a protein required for processive DNA synthesis by DNA polymerase delta and epsilon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We analysed the involvement of Crb 2 in the S / M checkpoint by blocking DNA replication with hydroxyurea , by using S phase cdc mutants , or by overexpression of the mutant PCNA L68S . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA is an accessory factor of DNA polymerases delta and epsilon that is required for DNA replication and repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Finally , we report that in neurons , cyclin D 1 expression peaks before nuclear condensation and the appearance of DNA fragmentation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , ctf 7 genetically interacts with DNA metabolism mutations pol 30 ( PCNA ) and ctf 18 ( an RF C like protein ) and ctf 7 temperature sensitivity and chromosome loss are rescued by high levels of POL 30 . ^^^ These findings provide the first evidence that links the establishment of sister chromatid cohesion to the DNA replication machinery and suggest that the assembly of cohesion ( and possibly condensation ) complexes are coupled to PCNA dependent DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We also provide new evidence that p 21 may play a role in inactivation of the DNA replication factor proliferating cell nuclear antigen during early senescence . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Both PCNA associated DNA polymerases delta and epsilon are important for gene conversion , though a temperature sensitive Pol epsilon mutant is more severe than one in Pol delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin E cdk 2 activation is associated with cell cycle arrest and inhibition of DNA replication induced by the thymidylate synthase inhibitor Tomudex . ^^^ Increased cyclin E cdk 2 protein expression was accompanied by the inhibition of DNA synthesis , with a decrease in E2F 1 expression . ^^^ These results propose that cyclin E cdk 2 kinase can negatively regulate DNA replication . ^^^ The 50 to 300 kb DNA fragmentation may be derived from the inhibition of DNA synthesis associated with cyclin E cdk 2 activation . ^^^ These results suggest that the megabase DNA fragmentation is induced as a consequence of inhibition of thymidylate synthase by Tomudex and kilobase DNA fragmentation may correlate with the reduction of p 27 ( kip 1 ) expression and the increase in cyclin E and cdk 2 kinase activities . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Sections of these valves were studied with the use of histologic and electron microscopic methods , nick end labeling and dual immunostaining for factor 8 related antigen and proliferating cell nuclear antigen , followed by counterstaining for DNA and laser scanning confocal fluorescence microscopic observation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a processivity factor required for DNA polymerase delta ( or epsilon ) catalyzed DNA synthesis . ^^^ When loaded onto primed DNA templates by replication factor C ( RFC ) , PCNA acts to tether the polymerase to DNA , resulting in processive DNA chain elongation . ^^^ Replacement of the aspartate 41 residue by an alanine , serine , or asparagine significantly impaired the ability of PCNA to ( 1 ) support the RFC / PCNA dependent polymerase delta catalyzed elongation of a singly primed DNA template ; ( 2 ) stimulate RFC catalyzed DNA dependent hydrolysis of ATP ; ( 3 ) be loaded onto DNA by RFC ; and ( 4 ) activate RFC independent polymerase delta catalyzed synthesis of poly dT . ^^^ Introduction of an alanine at position 210 in place of an arginine also reduced the efficiency of PCNA in supporting RFC dependent polymerase delta catalyzed elongation of a singly primed DNA template . ^^^ However , this mutation did not significantly alter the ability of PCNA to stimulate DNA polymerase delta in the absence of RFC but substantially lowered the efficiency of RFC catalyzed reactions . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We analysed DNA ploidy and proliferation indices of 30 cardiac myxomas which include 25 sporadic and five familial cases by image cytometry and proliferating cell nuclear antigen immunostaining . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication dependent marking of DNA by PCNA facilitates CAF 1 coupled inheritance of chromatin . ^^^ The proliferating cell nuclear antigen ( PCNA ) , a DNA polymerase clamp , is a component of the replication dependent marking of DNA for chromatin assembly . ^^^ The clamp loader , replication factor C ( RFC ) , can reverse this mark by unloading PCNA from the replicated DNA . ^^^ PCNA binds directly to p 150 , the largest subunit of CAF 1 , and the two proteins colocalize at sites of DNA replication in cells . ^^^ We suggest that PCNA and CAF 1 connect DNA replication to chromatin assembly and the inheritance of epigenetic chromosome states . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The expression of cyclin D was related to TM classification , histological differentiation , perineural invasion , DNA ploidy , S phase fraction , expression of Ki 67 , and mitotic index ( for all , P < or =0 . 01 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A number of other proteins have been implicated in MMR , including DNA polymerase delta , RPA ( replication protein A ) , PCNA ( proliferating cell nuclear antigen ) , RFC ( replication factor C ) , Exonuclease 1 , FEN 1 ( RAD 27 ) and the DNA polymerase delta and epsilon associated exonucleases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cdk inhibitor p 21 ( CIP1 / WAF1 ) inhibits the activities of cyclin dependent kinases and proliferating cell nuclear antigen , thereby repressing cell cycle progression and DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Concordant induction of cyclin E and p21cip1 in differentiated keratinocytes by the human papillomavirus E 7 protein inhibits cellular and viral DNA synthesis . ^^^ The induction of cyclin E is mutually exclusive with unscheduled cellular DNA synthesis or abundant viral DNA . ^^^ We propose that an appropriately timed induction of cyclin E / cyclin dependent kinase 2 by HPV E 7 in postmitotic cells enables S phase reentry and HPV DNA amplification , whereas prematurely induced cyclin E stabilizes p21Cip1 protein , which then inhibits cyclin E / cyclin dependent kinase 2 . ^^^ Consequently , cyclin E and p21Cip1 both fail to turn over , and DNA synthesis does not occur . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Moreover , bound his tagged PCNA was biochemically active in an in situ DNA synthesis assay with exogenous template primer and purified calf thymus DNA polymerase delta ( pol delta ) . ^^^ Ni2+ IDA paper was used to identify a PCNA point mutant that , relative to wild type PCNA , promotes increased DNA synthesis by pol delta beyond a model abasic template site . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The binding of Pb induced NF kappaB to DNA was blocked by antibodies for p 65 and p 50 but not by c Rel or nonspecific antibodies such as cyclin D 1 and preimmune serum , suggesting that NF kappaB consisted of p 65 and p 50 subunits . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Simultaneous detection of cyclin B 1 , p 105 , and DNA content provides complete cell cycle phase fraction analysis of cells that endoreduplicate . ^^^ Simultaneous flow cytometry of DNA and cyclin B 1 analytically separates these populations . ^^^ The objective here was to develop simultaneous flow cytometry of DNA , cyclin B 1 , and p 105 ( highly expressed in mitosis ) for improved , complete cell cycle phase fraction analysis of endoreduplicating cell populations . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : DU 145 cells were stained for DNA , cyclin B 1 , and a mitotic marker ( p 105 ) and analyzed by flow cytometry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Therefore , we investigated the pattern of cellular proliferation and death in the FZ and DZ of the human fetal and postnatal adrenal cortex using immunohistochemical staining for proliferating cell nuclear antigen as a marker of mitosis and in situ detection of DNA fragmentation as a marker of apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In sea urchin zygotes and mammalian cells nuclear envelope breakdown ( NEB ) is not driven simply by a rise in cytoplasmic cyclin dependent kinase 1 cyclin B ( Cdk 1 B ) activity ; the checkpoint monitoring DNA synthesis can prevent NEB in the face of mitotic levels of Cdk 1 B . ^^^ We find that cyclin B 1 GFP accumulates in nuclei that can not complete DNA synthesis and do not break down . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Anchorage dependent expression of cyclin A in primary cells requires a negative DNA regulatory element and a functional Rb . ^^^ In the experiments reported here , we show that anchorage dependent expression of cyclin A ( 1 ) is reflected by the in vivo occupancy of a negative DNA regulatory element previously shown to be instrumental in the down regulation of cyclin A transcription in quiescent cells ( Cell Cycle Responsive Element : CCRE ) ( 2 ) requires a functional Rb but neither p 107 nor p 130 ( 3 ) mutation of the CCRE abolishes both adhesion dependent regulation and response to Rb . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a 36 kD nuclear protein , and its expression is associated with DNA synthesis and cell proliferation . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a 36 kD nuclear protein , and its expression is associated with DNA synthesis and cell proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin E and E2F are needed for this differential DNA replication during Drosophila oogenesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Negative regulation of E2F 1 DNA binding function by cyclin A kinase represents part of an S phase checkpoint control system that , when activated , leads to apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We propose that agents inducing transcription blocking DNA lesions will at higher doses inhibit the progression of cells into S phase by a p 53 independent mechanism involving the attenuation of E2F mediated transcription of genes , such as cyclin E . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To elucidate the mechanism of this enhanced DNA repair , we examined the expression of p 21 and proliferating cell nuclear antigen ( PCNA ) , proteins known to be regulated by p 53 , as well as the XPA protein , which is mutated in the inherited repair deficient disorder xeroderma pigmentosum ( XP ) group A and is necessary for the recognition of UV induced DNA photoproducts . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The association with PCNA , however , did not lead to suppression of DNA replication according to the data of iododeoxyuridine ( IdUr ) incorporation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Altered regulation of cyclin G in human breast cancer and its specific localization at replication foci in response to DNA damage in p53+ / + cells . ^^^ Following DNA damage in normal p53+ / + cells , cyclin G is triggered to cluster in discrete nuclear DNA replication foci that contain replication associated proteins such as proliferating cell nuclear antigen ( PCNA ) . ^^^ While p 53 / cells displayed a faint cyclin G nuclear staining pattern , there was no increased expression and no change in distribution of the staining pattern after DNA damage . ^^^ The specific subcellular localization of cyclin G at DNA replication foci provides an additional link between p 53 mediated growth arrest and cell cycle regulation and suggests that cyclin G may act as an effector of p 53 mediated events by functional association with replication foci protein ( s ) . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cellular proliferating cell nuclear antigen ( PCNA ) gene product regulates DNA replication and repair pathways , including NER . ^^^ We propose that overexpression of PCNA , and disruption of NER induced by Tax , predisposes cells to accumulate DNA damage and contributes to HTLV 1 transformation . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 antisense ( D1AS ) transfected lung epithelial cell lines were serum deprived and then analyzed for three hallmarks of apoptosis : appearance of single strand DNA breaks , alteration of apoptosis related protein expression , and induction of chromatin condensation . ^^^ Additionally , proliferating cell nuclear antigen expression is completely suppressed in the D1AS cells , indicating a mechanism to explain the reduced capacity for DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
By addressing the cell cycle regulatory mechanisms involved in HGF mediated release of Mv1Lu cells from TGF beta inhibition , we show that increased DNA replication is accompanied by phosphorylation of the retinoblastoma protein and alternative regulation of cyclin Cdk inhibitor complexes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Most cyclin E cdk 2 complexes associated with p 21 and became inactive , expression of cyclin A was curtailed , and DNA synthesis was strongly inhibited . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These vectors directed the efficient expression of each of the cyclin kinase inhibitors and induced growth arrest , inhibited DNA synthesis , and prevented phosphorylation of the retinoblastoma protein ( pRb ) in cell lines expressing functional pRb . ^^^ In pRb deficient cells , expression of the cyclin kinase inhibitors was not effective in inhibiting DNA replication or growth arrest . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Analysis of individual nimA transfectants revealed that the DNA content per cell rose in cells expressing high levels of nimA and that the level of cyclin B was reduced as compared to the mock transfected cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This anti Fen 1 antiserum is well suited to the analysis of proliferation in histological material , since ( 1 ) the proportion of labelled cells equals the experimentally determined growth fraction in an experimental xenograft system and ( 2 ) unlike markers such as PCNA , Fen 1 is not induced by DNA damage . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using proliferating cell nuclear antigen affinity chroma tography and glycerol gradient centrifugation of partially purified fractions from mouse FM3A cells we have been able to isolate novel complexes of DNA polymerase delta and DNA ligase 1 containing clearly defined subunit compositions . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
BACKGROUND : p 21 ( waf1 / cip1 ) protein is a cyclin dependent kinase inhibitor able to arrest the cell cycle at the G 1 phase by inhibiting DNA replication . ^^^ RESULTS : The expression of p 21 ( waf1 / cip1 ) protein was significantly associated with high Gleason score ( P = 0 . 001 ) , DNA aneuploidy ( P = 0 . 013 ) , high S phase fraction ( P = 0 . 019 ) , and expression of Ki 67 ( P = 0 . 021 ) and bcl 2 ( P = 0 . 001 ) as well as cyclin A ( P = 0 . 035 ) and D proteins ( P < 0 . 001 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The examinations included morphologic multifactorial tumor front grading , quantitative DNA analysis , and immunohistochemical assessment of proliferation markers ( i . e . proliferating cell nuclear antigen [ PCNA ] and MIB 1 ) and of oncogene products ( i . e . p 53 ; nm 23 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunocytochemical studies revealed that RPA , DNA pol alpha , PCNA , and topo 1 levels are higher in the immortal cell types used in these studies . ^^^ In the HF cells , levels of DNA pol alpha cat and PCNA are higher ( per mg protein ) in the low passage than in the senescent cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The incidence of lymph node metastasis was relatively higher in DNA aneuploid and high PCNA LR ( > or = 50 % ) groups . ^^^ CONCLUSIONS : Our study suggests that DNA aneuploid and high PCNA LR are unfavorable characteristics and that p 53 expression may not have a prognostic value . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression of the gammaHV 68 5 cyclin significantly increased the number of thymocytes in cell culture , as determined by measuring both DNA content and incorporation of 5 bromo 2 deoxyuridine following in vivo pulse labeling . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , also known as a cofactor of DNA polymerase delta , is required for eukaryotic cell DNA synthesis and nucleotide excision repair . ^^^ Proliferating cell nuclear antigen ( PCNA ) , also known as a cofactor of DNA polymerase delta , is required for eukaryotic cell DNA synthesis and nucleotide excision repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This was accompanied by a block in replicative DNA synthesis , as detected by proliferating cell nuclear antigen immunostaining . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Quiescent myoblasts treated with bFGF in combination with IGF 1 did not express myogenin , but expressed proliferating cell nuclear antigen and underwent DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The large subunit of RFC ( RFC p 140 ) has been suggested to be associated with the 3 ' end of elongating DNA primer and to recruit proliferating cell nuclear antigen ( PCNA ) onto DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
ERK activity was approximately 2 fold higher in cycling BMM compared with growth arrested BMM ; in addition , CSF 1 stimulated BMM DNA synthesis was partially inhibited by PD 98059 , a specific inhibitor of MEK activation , suggesting a role for a mitogen activated protein ERK kinase ( MEK ) / ERK pathway in the control of DNA synthesis but surprisingly not in the control of cyclin D 1 mRNA or c myc mRNA expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Two evolutionarily conserved kinases , the cyclin B ( Clb ) / cyclin dependent kinase ( Cdk / Cdc28p ) and Cdc7p along with its interacting factor Dbf4p , are required late in G 1 to initiate DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PARP , a component of the multiprotein DNA replication complex ( MRC ) that catalyzes viral DNA replication in vitro , poly ( ADP ribosyl ) ates 15 of approximately 40 MRC proteins , including DNA pol alpha , DNA topo 1 , and PCNA . ^^^ Surprisingly , there was no new expression of PCNA and DNA pol alpha , as well as the transcription factor E2F 1 in PARP antisense cells during entry into S phase , suggesting that PARP may play a role in the expression of these proteins , perhaps by interacting with a site in the promoters for these genes . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Morphological features of apoptosis , necrosis and mitosis were scored under fluorescence microscopy after nuclear staining with 4 , 6 diamidino 2 phenylindole , and the expression profile of proliferating cell nuclear antigen , a cofactor for DNA polymerase , was analysed by immunohistochemistry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cultures were analyzed for total cell counts , proliferating cell nuclear antigen ( PCNA ) , and apoptotic DNA fragmentation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) is an essential eukaryotic DNA replication factor that is transcriptionally regulated by the adenovirus oncoprotein E1A 243R . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Both DNA synthesis and expression of proliferating cell nuclear antigen markedly increased after 5 h of sAPP 695 addition . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression of p 53 , K ras , and proliferating cell nuclear antigen ( PCNA ) and mutations of p 53 and K ras genes in lung lesions of Han / Wistar rats were investigated by immunohistochemistry and direct DNA sequencing following a long term exposure of animals to neutron activated UO 2 particles . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , which is a nuclear protein and a component of the DNA replication process , is also involved in growth regulation . ^^^ Proliferating cell nuclear antigen ( PCNA ) , which is a nuclear protein and a component of the DNA replication process , is also involved in growth regulation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We investigated the clinicopathological and genetic characteristics including patients ' gender , age , tumour location , growth pattern , Dukes ' stage , DNA ploidy , S phase fraction , PCNA , apoptosis , c erbB 2 , bcl 2 , K ras , p 53 , DCC and heat shock protein in 32 mucinous carcinomas versus 261 non mucinous carcinomas in the colorectum . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The significance of expression of proliferating cell nuclear antigen in the cardiovascular system : mitosis or DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In contrast , the cell cycle arrest caused by mutations that induce DNA damage ( cdc 13 ) , inactivate the cyclin proteolysis machinery ( cdc 16 and cdc 23 ) , or arrest cells in anaphase ( cdc 15 ) is independent of the spindle checkpoint . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis ( proliferating cell nuclear antigen , bromodeoxyuridine staining ) , VEC proliferation ( multilayers of cells in Bowman ' s space ) , matrix accumulation ( periodic acid Schiff , silver staining ) , apoptosis ( TUNEL ) , and renal function ( serum urea nitrogen ) were studied on days 5 and 14 ( N = 6 per time point ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) functions as a processivity factor for DNA polymerase delta , and is expressed at high levels in growing normal and tumor cells . ^^^ Proliferating cell nuclear antigen ( PCNA ) functions as a processivity factor for DNA polymerase delta , and is expressed at high levels in growing normal and tumor cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA is essential for processivity of both DNA polymerase delta and epsilon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Nucleosomes are preferentially assembled on replicating DNA by chromatin assembly factor 1 ; recent studies have shown that replicated DNA is marked for assembly into chromatin by the replication fork associated protein PCNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Repetitive chromosome 11 specific alpha satellite DNA probe and chromosome 11q13 specific probe cyclin D 1 were used for the FISH analysis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
BACKGROUND / AIMS : The aim of the present study is to assess the nuclear DNA ploidy patterns , the fraction of cells in the various phases of the cell cycle as determined by flow cytometry and to evaluate Proliferative cell nuclear antigen ( PCNA ) expression in order to examine the relationships between phase two molecular factors , clinicopathological aspects and outcome of patients with cancers of the ampulla of Vater . ^^^ Because of the wide range of all variables , more data are needed to establish the relationships between pathological factors , DNA ploidy and PCNA rate and their significance as molecular predictors of prognosis in ampulla of Vater cancers . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In non papillary renal cell carcinomas , high cyclin D 1 expression was associated with a diploid DNA profile and smaller tumour size , but there was no association between cyclin D 1 expression and tumour stage or nuclear grade . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This study explores the roles of the Grb 2 and Syp binding motifs of IRS 1 in relation to the inhibitory effects of ethanol on insulin stimulated DNA synthesis , proliferating cell nuclear antigen ( PCNA ) and glyceraldehyde 3 phosphate dehydrogenase ( GAPDH ) expression , and activation of mitogen activated protein kinase ( MAPK ) , which is known to be essential for cell proliferation . ^^^ Cells transfected with IRS 1 had increased levels of DNA synthesis , PCNA , GAPDH , and activated MAPK . ^^^ In contrast , the IRS 1deltaSyp and IRS 1deltaGrb2deltaSyp transfectants had reduced levels of DNA synthesis , PCNA , and activated MAPK . ^^^ Ethanol exposure decreased insulin stimulated DNA synthesis , PCNA , GAPDH , and activated MAPK levels in all clones , but the wild type IRS 1 transfectants were relatively resistant , and the IRS 1deltaGrb2 transfectants were extraordinarily sensitive to these inhibitory effects of ethanol . ^^^ The findings suggest that insulin stimulated DNA synthesis and PCNA expression are mediated through the Syp binding domain , whereas GAPDH expression and MAPK activation are modulated through both the Grb 2 and Syp motifs of IRS 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
For comparison , in quiescent cells , all four of the inhibitors of cell cycle progression tested ( anti Ras , anti cyclin D 1 , serum removal , and cycloheximide ) became ineffective at essentially the same point in G 1 phase , approximately 4 h prior to the beginning of DNA synthesis . ^^^ Anti cyclin D 1 , on the other hand , was an efficient inhibitor when introduced up until just before the initiation of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 3 up regulation and stabilization is inhibited by adenovirus E1A , and this correlates with the ability of E1A to promote pRb phosphorylation ; conversely , the overexpression of cyclin D 3 in differentiated myotubes counteracts the E1A mediated reactivation of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The purpose of our study was to examine the prognostic significance of different biomarkers [ DNA content , proliferating cell nuclear antigen labeling index ( PCNA LI ) , p 53 mutation and apoptosis ] , in 152 surgically resected non small cell lung cancer ( NSCLC ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These findings , therefore , indicate that expression of cyclin D 1 following DNA damage is essential for cell cycle re entry and p 53 mediated apoptosis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We propose that an excessive increase in PCNA and a marked decrease in c myc protein of luteal cells lead to a disorder in the signals concerned with DNA synthesis , causing mitotic catastrophe and inducing apoptosis in luteal cells , and that structural luteolysis may be triggered . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PD 98059 ( 10 microM ) , an inhibitor of MEK 1 activation , markedly attenuated thrombin stimulation of ERK activity and phosphorylation , DNA synthesis , and cyclin D 1 levels . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The sliding clamps of bacteriophage T 4 ( gp 45 ) , Escherichia coli ( beta clamp ) , and yeast ( PCNA ) are required for processive DNA synthesis by their cognate DNA polymerases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cell proliferation was determined by cell number , DNA synthesis , and proliferating cell nuclear antigen expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The fission yeast Schizosaccharomyces pombe can be induced to perform multiple rounds of DNA replication without intervening mitoses by manipulating the activity of the cyclin dependent kinase p 34 ( cdc 2 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To compare CAG repeats to other simple repeats and palindromic sequences , we examined the effect of DNA replication mutations , including alleles of pol alpha , pol delta , pol epsilon , and PCNA ( proliferating cell nuclear antigen ) , on tract stability . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The relative positions of components of the DNA dependent DNA polymerase delta ( pol delta ) . proliferating cell nuclear antigen ( PCNA ) . ^^^ Based on these results , we conclude that PCNA is located `` behind ' ' pol delta in the polymerization complex during DNA synthesis and that only the large subunit of pol delta ( two subunit form ) interacts directly with DNA . ^^^ Architecture of the active DNA polymerase delta . proliferating cell nuclear antigen . template primer complex . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Transfection with the cyclin D 1 vector but not a control vector resulted in hepatocyte DNA synthesis in the absence of growth factor that was similar to that seen in mitogen treated cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Base excision repair ( BER ) is initiated by a DNA glycosylase and is completed by alternative routes , one of which requires proliferating cell nuclear antigen ( PCNA ) and other proteins also involved in DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Arteries were assessed by histomorphometry , and vascular smooth muscle cell death and proliferation were examined 24 h and 14 days after balloon injury by in situ terminal deoxynucleotidyl transferase mediated dUTP nick end labeling ( TUNEL ) of fragmented DNA and expression of proliferating cell nuclear antigen , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Unreplicated or damaged DNA blocks the progression of the cell cycle at checkpoints , including a late G 1 checkpoint regulated by the dephosphorylated retinoblastoma protein and a late G 2 checkpoint regulated by the phosphorylation of cyclin dependent kinase 1 complexed with cyclin B . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The protein p 21 ( Cip 1 , Waf 1 , Sdi 1 ) is a potent inhibitor of cyclin dependent kinases ( CDKs ) . p 21 can also block DNA replication through its interaction with the proliferating cell nuclear antigen ( PCNA ) , which is an auxiliary factor for polymerase delta . ^^^ A 50 % inhibition of in vitro NER occurred at a 50 : 1 molar ratio of p 21 C terminus fragment to PCNA monomer . p 21 differentially regulates DNA repair and replication , with repair being much less sensitive to inhibition than replication . ^^^ We further demonstrate that the inhibition of DNA repair is mediated via binding of p 21 to PCNA . ^^^ The N terminus of p 21 had no effect on DNA repair , and the inhibition of DNA repair by the C terminus of p 21 was relieved by the addition of purified PCNA protein . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferation was assessed using immunocytochemical detection of proliferating cell nuclear antigen ( PCNA ) or 5 bromo 2 ' deoxy uridine ( BrdU ) incorporation into DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This article reviews recent studies evaluating molecular markers , including p 53 , angiogenesis related markers , cyclin D 1 , epidermal growth factor receptor , loss of heterozygosity , DNA ploidy , and cell kinetic markers . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Further analysis revealed that LY 294002 , a selective inhibitor of phosphatidylinositol 3 kinase , suppressed DNA synthesis and cyclin D 1 expression in a dose dependent manner without affecting platelet derived growth factor receptor beta expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
TNM tumor staging , the number of diseased lymph nodes ( N < or = 3 or N > 3 ) , degree of cell differentiation , DNA ploidy , SPF , and lymphovascular invasion were more useful than biological markers , such as PCNA , EGFR , HER 2 / neu , and p 53 , for the prognosis of ESCC . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Detection of chromatin bound PCNA in mammalian cells and its use to study DNA excision repair . ^^^ Compelling evidence indicates that proliferating cell nuclear antigen ( PCNA ) is an indispensable factor not only in DNA replication but in nucleotide excision repair ( NER ) , alternative pathway of base excision repair ( BER ) , and mismatch repair . ^^^ The common function of PCNA in each of these is to assist in the initiation of DNA synthesis by providing a scaffolding clamp as a trimer catalyzed by RF C at the 3 ' OH terminus of a nascent DNA strand , to which DNA polymerase delta or epsilon can bind . ^^^ Furthermore , several proteins , XPG , FEN 1 , and DNA ligase 1 , recently were shown to competitively bind to the same region of PCNA , the interdomain connector loop , to which DNA polymerase delta or epsilon also binds . ^^^ PCNA therefore seems to have a regulatory role in these DNA transactions . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Inhibition of DNA synthesis by downregulation of cyclin A but not Skp 2 overexpression in human hepatocellular carcinoma cells . ^^^ By [ 3H ] thymidine incorporation assay , we found that downregulation of cyclin A but not Skp 2 overexpression could inhibit the DNA synthesis ability of HCC 36 cells , suggesting that abnormal Skp 2 expression is not directly correlated with the HCC proliferation . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A novel role in DNA metabolism for the binding of Fen1 / Rad27 to PCNA and implications for genetic risk . ^^^ Fen1 / Rad27 nuclease activity , which is important in DNA metabolism , is stimulated by proliferating cell nuclear antigen ( PCNA ) in vitro . ^^^ Furthermore , the PCNA binding mutation resulted in lethality when combined with a homozygous or even a heterozygous pol 3 01 mutation in the 3 ' > 5 ' exonuclease domain of DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Lovastatin suppressed DNA synthesis and reduced the expression of cyclin D 1 and cyclin E , whereas p27Kip1 expression was strongly induced by lovastatin pretreatment . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Flow cytometry ( the simultaneous analysis of cellular DNA and cyclin B 1 content ) revealed that the percentage of 4c ( tetraploid ) cells with a high level of cyclin B 1 increased after continuous 6 h exposure to ethanol ( > or =82 . 5 mM ) and decreased after 24 h exposure , which supports the idea of a transient M phase block . ^^^ To determine the sub M phase of 4c cells with high levels of cyclin B 1 based on spindle microtubules and their karyotype , we viewed immunofluorescent images by double staining with Hoechst 33258 ( bis benzimide trihydrochloride ) for DNA and with fluorescein isothiocyanate labelled antibody for cyclin B 1 or beta tubulin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The animal cell cycle is controlled by the periodic variation of two cyclin dependent protein kinases , cdk 1 and cdk 2 , which govern the entry into the M ( mitosis ) and S ( DNA replication ) phases , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferation associated antigens Ki 67 ( immunohistochemistry ) and proliferative cell nuclear antigen ( PCNA ) ( immunohistochemistry and immunoblotting ) were analysed together with DNA synthesis ( 3H thymidine incorporation ) and cell cycle distribution ( tumour specific S phase fraction determined by flow cytometry ) in lymph node suspensions from 63 patients with newly diagnosed B Cell non Hodgkin ' s lymphomas . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Increase in proliferation , measured by increased thymidine incorporation into DNA and by PCNA immunostaining in response to testosterone was observed in histocultures of breast cancer samples . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Antioxidant treatment also inhibited PDGF induced cyclin D ( 1 ) protein expression and DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Paired tumour and normal DNA samples from 26 oesophageal adenocarcinomas and 19 squamous cell carcinomas were analysed by Southern blotting with specific DNA probes for cyclin D 1 and MDM 2 , and for a control gene ( alpha lactalbumin ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Several other genes observed to be differentially expressed by homocysteine are known to mediate cell growth and differentiation ( ie , GADD 45 , GADD 153 , Id 1 , cyclin D 1 , FRA 2 ) , a finding that supports the observation that homocysteine causes a dose dependent decrease in DNA synthesis in HUVEC . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA staining was extensive in the epidermis underneath the layers where abundant HPV DNA staining was shown in HPV DNA positive verrucas . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In contrast , sublytic C5b 9 attack ( group 1 ) augmented growth factor induced DNA synthesis by 50 % compared to controls ( groups 2 and 3 ; P < 0 . 001 ) , and was accompanied by increased levels of cyclin A and CDK 2 , and a decrease in the cyclin kinase inhibitor p 27 ( but not p 21 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To this end , immunohistochemistry and immunoblotting for PCNA , Cdk 4 , cyclin D , cyclin A , and the Cdk inhibitor p27 / kip1 , as well as in situ end labeling for apoptotic DNA fragmentation , were applied to cerebella of P 7 P21+ / + , wv / + , and wv / wv mice . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Ongoing DNA synthesis was monitored by biotin 16 dUTP incorporation as well as proliferating cell nuclear antigen expression and localization . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA is essential for processivity of both DNA polymerase delta and epsilon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Variables examined included patient age , morphologic type , preoperative performance score , extent of surgery , solitary versus multiple mitoses , DNA flow cytometric and image morphometric parameters , and expression of proliferating cell nuclear antigen , MIB 1 , and p 53 expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Overexpressing Cdc25C together with cyclin B 1 does shorten the G 2 phase and can override the unreplicated DNA checkpoint , but much less efficiently than overexpressing Cdc25B . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Pds 1 is also required for the mitotic arrest and inhibition of cyclin destruction that occurs after DNA damage . ^^^ Even in anaphase cells , where Pds 1 levels are normally low , DNA damage stabilizes Pds 1 and prevents cyclin destruction and mitotic exit . ^^^ Mutations in ESP 1 delay cyclin destruction ; overexpression of ESP 1 causes premature cyclin destruction in cells arrested in metaphase by spindle defects and in cells arrested in metaphase and anaphase by DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunohistochemical measurement of proliferating cell nuclear antigen revealed that hepatic DNA labeling indices were similar in normal control animals and diabetic rats 30 or 90 days post diabetic induction , but were reduced to 45 to 50 % of control in insulin treated diabetic animals , perhaps due to altered receptor activity or to partial insulin resistance , as reported previously . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factor C ( RF C ) is a eukaryotic heteropentameric protein required for DNA replication and repair processes by loading proliferating cell nuclear antigen ( PCNA ) onto DNA in an ATP dependent manner . ^^^ Prior to loading PCNA , RF C binds to DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression of proliferating cell nuclear antigen , a marker for DNA synthesis , was examined by immunohistochemistry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , the processivity factor ( sliding clamp ) of DNA polymerases ( Pols ) , plays essential roles in DNA metabolism . ^^^ The ability of the mutant PCNA proteins to stimulate DNA synthesis by Poldelta and Polepsilon also was studied in vitro . ^^^ All mutant PCNA proteins , however , were assembled around DNA by the clamp loader , replication factor C , efficiently . ^^^ Thus , the C terminal region of PCNA is important for interactions with both Poldelta and Polepsilon and for cell survival after DNA damage . ^^^ The C terminal region of Schizosaccaromyces pombe proliferating cell nuclear antigen is essential for DNA polymerase activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the presence of MEK inhibitor , cyclin D 1 mRNA accumulation was inhibited , DNA replication was totally abolished , and the MEK 1 isoform was preferentially targeted by this inhibition . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here , we use proliferating cell nuclear antigen ( PCNA ) of S . pombe to demonstrate how the function of this protein in both DNA replication and repair can be assessed by genetic and biochemical approaches . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The aim of this study was to analyze certain prognostic factors , i . e . , p 53 , Ki 67 , proliferating cell nuclear antigen ( PCNA ) , DNA ploidy and cell proliferating activity , as well as the degree of morphological differentiation and cell maturity evaluated on an ultrastructural level in patients with laryngeal cancers in connection with data obtained from follow up examinations and the clinical course of the disease . ^^^ The degree of clinical progression ( S ) was intercorrelated with T , N , p 53 , Ki 67 , PCNA , DNA ploidy , site and laryngectomy . ^^^ The occurrence of oncoprotein p 53 in neoplastic cells was measured by the staining degree of their nuclei and was correlated with T , S , DNA ploidy , metastases to lymph nodes , PCNA and site . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The protein fraction PC FII ( phosphocellulose fraction 2 ) , which does not contain RPA and PCNA but otherwise contains all core BER proteins required for PCNA dependent BER ( AP endonuclease , DNA polymerases delta , beta and DNA ligase , and FEN 1 endonuclease ) , had reduced ability to repair plasmid DNA containing AP sites . ^^^ Replication protein A stimulates proliferating cell nuclear antigen dependent repair of abasic sites in DNA by human cell extracts . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Nucleotide sequence analysis of the exact junction region and the corresponding germline DNA showed that the translocation at 12p13 occurred in the negative regulatory region of the cyclin D 2 gene at the nt 1602 , and a pentamer consisting of nts 1603 to 1599 was lost at the break site . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A concordance of DNMT 1 expression with the expression of PCNA and other cell proliferation markers , such as Ki 67 and DNA topoisomerase IIalpha , was observed in normal colonic epithelial cells and in cells comprising other normal epithelia and lymphoid tissues . ^^^ The polypeptide p 21 , which has been reported to undermine DNMT 1 binding to proliferating cell nuclear antigen at DNA replication sites , was not expressed by normal colonic cells containing DNMT 1 and other cell proliferation markers . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using proliferating cell nuclear antigen ( PCNA ) staining and 5 bromo 2 ' deoxyuridine ( BrdU ) incorporation into newly replicated DNA , the effect of calcitonin ( CT ) on cellular proliferation in the rat anterior pituitary gland ( AP ) was examined . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The present data suggest that in fish eggs , DNA replication as well as the synthesis and phosphorylation of proteins , especially cyclin B , are required for normal formation of metaphase chromosomes at the first cleavage , but not for fertilization events from sperm penetration through to nuclear migration resulting in syngamy . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin G was previously identified as a target gene of the p 53 tumor suppresser protein , and levels of cyclin G are increased after induction of p 53 by DNA damage . ^^^ Cyclin G protein levels induced by the retroviruses were within the range seen after DNA damage induction of p 53 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Image cytometric DNA analysis and proliferating cell nuclear antigen ( PCNA ) expression in transitional cell carcinoma of the bladder . ^^^ The proliferation rate as determined by Proliferating Cell Nuclear Antigen ( PCNA ) immunostaining and the DNA ploidy status as measured by static cytometry were studied in 70 transitional cell carcinomas of the bladder ( TCCB ) in relation to grade , stage , and recurrence . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Certain components of the DNA repair / replication system , including Ku70 / 80 , DNA topoisomerase 1 and PCNA , are also associated with the RPI complex . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The formation of a complex between DNA polymerase delta ( pol delta ) and its sliding clamp , proliferating cell nuclear antigen ( PCNA ) , is responsible for the maintenance of processive DNA synthesis at the leading strand of the replication fork . ^^^ In this study , the ability of the p 125 catalytic subunit of DNA polymerase delta to engage in protein protein interactions with PCNA was established by biochemical and genetic methods . p 125 and PCNA were shown to co immunoprecipitate from either calf thymus or HeLa extracts , or when they were ectopically co expressed in Cos 7 cells . ^^^ Direct interaction of proliferating cell nuclear antigen with the p 125 catalytic subunit of mammalian DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The results suggest that in human skin diseases , the extent of staining for PCNA , which is a cofactor of DNA polymerase delta and is essential for cell proliferation , correlates with the extent to which the disease is treatment resistant . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Morphologic restoration of the liver after hepatectomy was evaluated on the basis of remnant liver weight , proliferating cell nuclear antigen labeling index , and the DNA content of the regenerating liver . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
MAIN OUTCOME MEASURES : The DNA from tumor and healthy tissue was evaluated for loss of heterozygosity at p 53 , retinoblastoma , and chromosome 16q and for amplification of cyclin D 1 . ^^^ RESULTS : DNA analysis showed that loss of heterozygosity occurred at p 53 in 21 % of tumors , at retinoblastoma in 35 % , and at 16q in 21 % , and that cyclin D 1 was amplified in 42 % . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A together with ORC , Cdc 6 and MCM proteins is bound to sperm chromatin in DNA replicating pseudonuclei . ^^^ We conclude that chromatin bound cyclin A kinase controls DNA replication by protein phosphorylation and chromatin release of Cdc 6 and MCM , whereas soluble cyclin E kinase prevents rereplication during the cell cycle by the inhibition of premature MCM chromatin association . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study we compared expression of DNA topoisomerase IIalpha , a marker of cellular proliferation , c myc , and cyclin D 1 in lung biopsy specimens showing diffuse alveolar damage ( DAD ) with control lung tissues . ^^^ We subsequently correlated DNA topoisomerase IIalpha , c myc , and cyclin D 1 expression with survival . ^^^ Immnuohistochemical stains for c myc , cyclin D 1 , and DNA topoisomerase IIalpha were performed on 10 cases of DAD ( 15 cases for DNA topoisomerase IIalpha ) and 10 control lungs . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The time dependent activation of cyclin D 1 and cdk 5 preceded both the induction of ladder type DNA fragmentation and increased keratin pearl formation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The inhibition of DNA synthesis by replication protein A from M . thermoautotrophicum can be relieved by the addition of M . thermoautotrophicum homologs of replication factor C and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA / Ki67 ratio excess , possibly reflecting DNA excision repair , is of additional interest to drug resistance in MTT testing . ^^^ CONCLUSIONS : PCNA / Ki67 ratio excess may not reflect DNA excision repair activity but rather slow degradation of antigen bearing structures limiting relevance to drug resistance study . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results suggest that cyclin H may have functions in neurons other than cell cycle regulation , including other known functions such as DNA repair . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Hence , the ability to drive quiescent Swiss 3T3 cells into S phase results from the capacity of large T antigen to transactivate DNA synthesis enzymes by its interaction with retinoblastoma type proteins and from the potential of the large and the small T antigens together to stimulate cyclin A synthesis and cyclin A and cyclin E dependent protein kinase activity . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The replication factory targeting sequence / PCNA binding site is required in G ( 1 ) to control the phosphorylation status of DNA ligase 1 . ^^^ The recruitment of DNA ligase 1 to replication foci in S phase depends on a replication factory targeting sequence that also mediates the interaction with proliferating cell nuclear antigen ( PCNA ) in vitro . ^^^ The analysis of epitope tagged DNA ligase 1 mutants demonstrates that dephosphorylation of Ser 66 requires both the nuclear localization and the PCNA binding site of the enzyme . ^^^ Finally , we show that DNA ligase 1 and PCNA interact in vivo in G ( 1 ) and S phase but not in G ( 2 ) / M . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : DNA ploidy pattern , Ki 67 labeling index ( LI ) , and cyclin D 1 and p 53 protein expression were examined and detailed pathologic examinations were conducted on tumors from 53 patients ( 46 males and 7 females with a mean age of 66 years [ range , 47 85 years ] ) with surgically resected esophageal squamous cell carcinoma and the prognostic value of these factors was evaluated . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RESULTS : No correlation of DNA ploidy , S phase fraction by flow cytometry , or PCNA with malignancy was observed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This implies that even after induction of stable nuclear cyclin D 3 CDK4 complexes , dog thyrocytes still depend on cAMP for RB phosphorylation and commitment to DNA synthesis , which suggests that a key labile event responsible for a last control of restriction point passage remains to be uncovered , in the cAMP dependent cell cycle of dog thyrocytes and possibly other systems . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the younger rabbits , c Myc co localised with proliferating cell nuclear antigen , whereas in the hypertrophic zone of older rabbits , it was present in some chondrocytes the nuclei of which also contained DNA breaks . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In asynchronous cultures , Ras activity has been found to be required only during G 2 phase to promote passage through the entire upcoming cell cycle , whereas cyclin D 1 is required through G 1 phase until DNA synthesis begins . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Inhibition of thrombin stimulated DNA synthesis by albuterol ( 1 100 nM ) , 8 bromo cAMP ( 300 microM ) , or prostaglandin E ( 2 ) ( 1 microM ) was accompanied by a reduction in cyclin D 1 protein levels . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , a processivity factor for DNA polymerases delta and epsilon , is essential for both DNA replication and repair . ^^^ In this study , we have examined the involvement of PCNA in the repair of oxidative DNA damage . ^^^ PCNA complex formation was studied in normal human cells after treatment with hydrogen peroxide , which generates a variety of oxidative DNA lesions . ^^^ We observed that PCNA redistributes from a soluble to a DNA bound form during the repair of oxidative DNA damage . ^^^ PCNA complex formation was analyzed in two human natural mutant cell lines defective in DNA repair : xeroderma pigmentosum group A ( XP A ) and Cockayne syndrome group B ( CS B ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We examined the effects of increasing intracellular cyclic AMP on the catalytic ( cdks ) and regulatory ( cyclins and ckis ) components of cyclin dependent protein kinases , which regulate progression of the cell cycle before completion of DNA synthesis , in primary cultured astrocytes and in an astrocytic cell line C . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is an essential component of the DNA replication and repair machinery in the domain Eucarya . ^^^ These results strongly support the idea that the PCNA homolog works as a sliding clamp of DNA polymerases in P . furiosus , and the basic mechanism for the processive DNA synthesis is conserved in the domains Bacteria , Eucarya , and Archaea . ^^^ The stimulatory effect of PfuPCNA on the DNA synthesis was observed by using a circular DNA template without the clamp loader ( replication factor C [ RFC ] ) in both Pol 1 and Pol 2 reactions in contrast to the case of eukaryotic organisms , which are known to require the RFC to open the ring structure of PCNA prior to loading onto a circular DNA . ^^^ Because RFC homologs have been found in the archaeal genomes , they may permit more efficient stimulation of DNA synthesis by archaeal DNA polymerases in the presence of PCNA . ^^^ Functional interactions of a homolog of proliferating cell nuclear antigen with DNA polymerases in Archaea . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The results suggest that zinc and EtOH promote insulin induced DNA synthesis by different mechanisms ; while zinc acts by enhancing the effects of insulin on MAP kinase activation , EtOH may act by ensuring timely zinc dependent insulin induced expression of cyclin E . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Following this , DNA polymerase delta assembles with PCNA for processive extension . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : The variables analyzed included clinical and histologic factors , immunohistochemical expression of proliferating cell nuclear antigen and p 53 , and adjusted DNA index measurements . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA binding activity of the transcription factor upstream stimulatory factor 1 ( USF 1 ) is regulated by cyclin dependent phosphorylation . ^^^ We show that the affinity of recombinant USF 1 for DNA is greatly increased by treatment with active cyclin A 2 p34 ( cdc 2 ) or cyclin B 1 p34 ( cdc 2 ) complexes and that its interaction with DNA is dependent on p 34 ( cdc 2 ) mediated phosphorylation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the present experiment , we investigated expression of cell cycle related proteins , i . e . , cyclin B 1 , cyclin D 1 , cdk 4 , and PCNA , in rat brain after transient MCA occlusion , and compared the temporal profile of the results with that of TUNEL study , which detects double strand breaks in DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our data indicated that efficient repair is dependent on six components including AP endonuclease , replication factor C , proliferating cell nuclear antigen , DNA polymerases delta or epsilon , flap endonuclease 1 , and DNA ligase 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In higher eukaryotes , there are two alternative pathways for base excision repair : a DNA polymerase beta dependent pathway and a proliferating cell nuclear antigen ( PCNA ) dependent pathway . ^^^ Here we have reconstituted PCNA dependent repair of AP sites with six purified human proteins : AP endonuclease , replication factor C , PCNA , flap endonuclease 1 ( FEN 1 ) , DNA polymerase delta , and DNA ligase 1 . ^^^ Disruption of the PCNA binding site of either FEN 1 or DNA ligase 1 significantly reduced efficiency of AP site repair but did not affect repair patch size . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
STUDY DESIGN : In 38 cases of NSCLC ( 21 squamous cell carcinomas and 17 adenocarcinomas ) we analyzed apoptosis by nuclear morphology and in situ DNA fragmentation end labeling and the cell kinetics by an autoradiographic method with tritiated thymidine and by immunohistochemistry with anti proliferating cell nuclear antigen ( anti PCNA ) antibodies . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 ( a cell cycle marker ) was increased after 24 h of overloading and corresponded with changes in muscle DNA content . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This liver regeneration phenotype is associated with protracted expression of cyclin D 1 and C / EBPbeta , which are involved in stimulating DNA replication and premature expression of M phase promoting cyclin B 1 and cdc 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
After poly ( A ) RNA isolation , RT cPCR was performed on single embryos using an introduced , truncated cyclin B 1 DNA competitor . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The Drosophila proliferating cell nuclear antigen promoter contains multiple transcriptional regulatory elements , including upstream regulatory element ( URE ) , DNA replication related element , E2F recognition sites , and three common regulatory factor for DNA replication and DNA replication related element binding factor genes recognition sites . ^^^ Although GRH has been thought to be involved in regulation of differentiation related genes , this study demonstrates , for the first time , involvement of a GRH binding site in regulation of the DNA replication related proliferating cell nuclear antigen gene . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Another G 1 cyclin , cyclin E , and a transcription factor E2F are situated the furthest downstream of known G 1 regulators and seem to be directly involved in the initiation of chromosomal DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Thus , E2F target gene products and cyclin E dependent kinase activity apparently co operate to initiate replication of DNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RFC 1 , RFC 2 , and RFC 3 encode three of the five subunits of the replication factor C complex , which is required to load PCNA onto DNA in reconstituted DNA replication reactions . ^^^ Biochemical analysis of the wild type and mutant PCNA and RFC 3 proteins shows that mutant RFC3p enhances the production of long DNA products in pol delta dependent DNA synthesis , which is consistent with an increase in processivity . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cotreatment with EGF and GH versus EGF alone resulted in a 35 % decline in acute ErbB 2 tyrosine 1248 autophosphorylation , a marked decline ( approximately 50 % ) in DNA synthesis , and substantially decreased cyclin D 1 expression . ^^^ We conclude that in 3T3 F442A cells , 1 ) the GH induced decrease in ErbB 2 tyrosine phosphorylation correlates with MEK1 / mitogen activated protein kinase activity and 2 ) GH antagonizes EGF induced DNA synthesis and cyclin D 1 expression in a pattern consistent with its alteration in ErbB 2 phosphorylation status . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Exogenous platelet derived growth factor restored expression of the IGFI R and IGFI R dependent DNA synthesis as well as induction of cyclin A , thymidine kinase , and p 107 in insulin stimulated Sparc / cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study , we asked whether YB 1 expression is enhanced in human colorectral carcinoma and if it is associated with the expression of target genes such as MDR 1 , DNA topoisomerase 2 alpha and PCNA . ^^^ YB 1 , DNA topoisomerase 2 alpha , PCNA and MDR 1 expression were assessed by Western blotting , Northern blotting and immunohistochemistry in 26 human colorectal carcinomas . ^^^ YB 1 expression correlated well with both DNA topoisomerase 2 alpha and PCNA expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cell cycle modulation of cyclin A expression is due to the periodic relief of a transcriptional repression mediated by a bipartite negative DNA regulatory region . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In three patients with translocations between chromosomes 2 and 7 , the cloning of the breakpoints at 7q21 revealed that each was located within a small region of DNA 3 . 6 kb upstream of the transcription start site of cyclin dependent kinase 6 ( CDK 6 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The decrease in RB expression and phosphorylation , which is essential in triggering DNA synthesis and Cyclin A expression , leads to a deficiency in transcriptionally active E2F complex formation after hepatectomy . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The Werner syndrome gene product co purifies with the DNA replication complex and interacts with PCNA and topoisomerase 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Examining cell size and the protein : DNA ratio can differentiate between the growth response patterns , but it is proposed that the degree of activation of cyclin D kinase in the late G 1 phase of the cell cycle differentiates between hyperplasia and hypertrophy . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NeuT induction of the cyclin D 1 promoter required the E2F and Sp 1 DNA binding sites and was inhibited by dominant negative E2F 1 or DP 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Significantly decreased DNA synthesis and proliferating cell nuclear antigen labeling index were also found on day 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Pretreatment of obese animals with rIL 6 normalized PCNA expression ( G ( 1 ) phase ) in steatotic hepatocytes but failed to increase DNA synthesis ( BrdU , S phase ) , mitosis ( mitotic index and regenerated liver weight , M phase ) , and animal survival . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunohistochemistry was used for detecting Bcl 2 , P 53 and PCNA proteins associated with apoptosis / DNA damage . ^^^ Nor could we find any evidence of substantial expression of Bcl 2 , P 53 or PCNA , a result indicative of the absence of apoptotic threat or DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Activation of cyclins and cyclin dependent kinases , DNA synthesis , and myocyte mitotic division in pacing induced heart failure in dogs . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
When treated with the DNA methylating carcinogen N methylnitrosourea ( MNU ) that provokes the development of T cell lymphomas , CD 2 cyclin E transgenic animals came down with T cell neoplasia showing a significant higher incidence ( 54 % ) than normal non transgenic controls ( 31 % ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Double staining for DNA fragmentation detection , using terminal deoxynucleotdyl transferase mediated biotinylated deoxyuridine triphosphate nick end 3 ' OH labeling ( TUNEL ) and antibodies for expression of Cyclin D 1 and cdk 4 was also performed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using immunohistochemistry , expression of p 53 , transforming growth factor alpha ( TGF alpha ) , epidermal growth factor receptor ( EGFR ) , c erbB 2 / neu and proliferating cell nuclear antigen ( PCNA ) was examined in 26 fresh frozen tissue specimens of oropharyngeal squamous cell carcinomas ( SCCs ) . p 53 gene mutations were examined by polymerase chain reaction ( PCR ) / DNA sequencing methods in 22 carcinomas . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 induction is one of the earlier events in hepatocyte proliferation induced by the primary mitogen TCPOBOP and suggests that a direct effect of the mitogen on this cyclin may be responsible for the rapid onset of DNA synthesis observed in TCPOBOP induced hyperplasia . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Dynamics of beta and proliferating cell nuclear antigen sliding clamps in traversing DNA secondary structure . ^^^ This report examines the Escherichia coli beta and human proliferating cell nuclear antigen clamps for their ability to slide over various DNA secondary structures . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We hypothesized that spinal motor neurons might be lost by programmed cell death and investigated a possible mechanism of neuronal death by detection of double strand breaks in genomic DNA and immunohistochemical analysis for cyclin D 1 and cyclin dependent kinases ( Cdk ) 4 . ^^^ In situ terminal deoxynucleotidyl transferase ( TdT ) mediated dUTP biotin nick end labeling ( TUNEL ) , DNA fragment with gel electrophoresis , Western blot analysis for cyclin D 1 and Cdk 4 , and temporal profiles of cyclin D 1 and Cdk 4 immunoreactivity were investigated . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A / CDK2 regulates 5 ( D ) J recombination by coordinating RAG 2 accumulation and DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Addition of the sliding DNA clamp PCNA , the clamp loader RFC , and ATP caused a drastic 30 fold increase in translesion replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A novel DNA damage checkpoint involving post transcriptional regulation of cyclin A expression . ^^^ Mitogenic signaling events involving cyclins D and E , Rb phosphorylation , and transcriptional activation of E2F responsive genes ( including cyclin E and cyclin A ) were unaffected in cells containing PAH damaged DNA . ^^^ Overall , our results suggest the existence of a DNA damage checkpoint pathway that arrests cell cycle progression via post transcriptional control of cyclin A expression . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In recent years , many elegant experiments on budding yeast have dissected the roles of cyclin molecules ( Cln 1 3 and Clb 1 6 ) in coordinating the events of DNA synthesis , bud emergence , spindle formation , nuclear division , and cell separation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Indirect immunofluorescence experiments in both CHO and HeLa cells showed that all three RPA subunits associated specifically with sites of ongoing DNA synthesis , similar to the replication fork protein proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A CAF 1 PCNA mediated chromatin assembly pathway triggered by sensing DNA damage . ^^^ The binding of both PCNA and CAF 1 to this damaged DNA was dependent on the number of DNA lesions and required ATP . ^^^ This defect was rescued by complementation with recombinant PCNA , arguing for role of PCNA in mediating chromatin assembly linked to DNA repair . ^^^ We discuss the importance of the PCNA CAF 1 interaction in the context of DNA damage processing and checkpoint control . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This paper addresses both manual assay techniques , including the use of hemocytometers , phase contrast microscopy , cell staining , and the immunofluorescent antibody assay ( IFA ) , and automated assays for cell activity , including stained optical density , proliferating cell nuclear antigen , creatine kinase assay , DNA quantification , electronic cell counting , flow cytometry , magnetic cell sorting , image analysis , chemiluminescence , radioisotope labeling , precursor incorporation , in situ hybridization / ligand binding , and enzyme linked immuno culture assay ( ELICA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
STUDY DESIGN : Forty five uterine smooth muscle neoplasms were assessed for DNA ploidy ; silver staining nucleolar organizer regions ( AgNORs ) ; percent nuclear proliferating cell nuclear antigen ( PCNA ) ; expression of p 53 , Her 2 / neu , and MDM 2 protein ; mitotic rate ; and nuclear grade . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factor C displaces DNA polymerase alpha prior to PCNA loading . ^^^ Based on these results , a model is proposed in which RF C induces the pol switching by sequestering the 3 ' OH end from pol alpha and subsequently recruiting PCNA to DNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Finally PCNA can be loaded onto a DNA template carrying a RNA primer , suggesting that a DNA moiety is not necessarily required for the loading of the clamp . ^^^ Thus we propose a model where RF C , upon binding to the RNA / DNA primer , influences primer synthesis and sets the conditions for a polymerase switch after recruiting PCNA to DNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Second , cyclin dependent kinases regulate DNA replication in both a positive and a negative way by inducing the initiation of DNA replication at G ( 1 ) / S transition and preventing further rounds of origin firing within the same cell cycle . ^^^ Our results indicate that Xenopus ORC and Cdc 2 10 cyclin A 1 physically interact and demonstrate a physical link between an active cyclin dependent kinase and proteins involved in the initiation of DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Both three and four subunit complexes required replication factor C and proliferating cell nuclear antigen for DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Complete repair was achieved by including highly purified human DNA polymerase delta or epsilon , PCNA , RFC , and DNA ligase 1 in reaction mixtures , reconstituting adduct repair for the first time with recombinant incision factors and human replication proteins . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cells ( leukemic cell line Jurkat or PHA stimulated human T lymphocytes ) were stained for DNA and cyclin B 1 and analyzed by FCM . ^^^ We hypothesize that after passage through a restriction point differing in T lymphocytes and in leukemic cells , the rate of cyclin B 1 synthesis becomes constant in the S and G ( 2 ) / M phases and independent from the DNA replication cycle . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Flow cytometric DNA ploidy , p 53 , PCNA , and c erbB 2 protein expressions as predictors of survival in surgically resected gastric cancer patients . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Marker for proliferation is proliferating cell nuclear antigen ( PCNA ) immunohistochemical staining , apoptotic cell death was detected using DNA in situ terminal deoxynucleotidyl transferas mediated dUTP biotin nick ending labeling ( TUNEL ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using PC 10 , an antibody to proliferating cell nuclear antigen ( PCNA ) and a standard immunohistochemical staining the authors examined 11 cases of simple hyperplasia of epithelium ( SHE ) , 32 cases of atypical hyperplasia of epithelium ( AHE ) and 42 cases of laryngeal squamous cell carcinoma ( LSCC ) for expression of PCNA , a protein associated with DNA polymerase dalta and DNA replication , a marker for tumor cell proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Requirement for PCNA and RPA in interstrand crosslink induced DNA synthesis . ^^^ Proliferating nuclear cell antigen ( PCNA ) and replication protein A ( RPA ) have proven to be essential elements in many aspects of DNA metabolism including replication , repair and recombination . ^^^ Using this assay we have investigated the roles of PCNA and RPA in crosslink induced DNA synthesis . p 21 , a potent inhibitor of PCNA , was found to strongly inhibit crosslink induced incorporation . ^^^ These results indicate that both PCNA and RPA are required for efficient in vitro DNA resynthesis induced by interstrand crosslinks . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This immortal cell line showed enhanced DNA synthesis in the form of BrdU incorporation , increased presence of proliferating cell nuclear antigen ( PCNA ) , bcl 2 and p 53 proteins by immunohistochemistry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
HeLa cells are phenotypically limiting in cyclin E / CDK2 for efficient human papillomavirus DNA replication . ^^^ Further analyses of the regulation of HPV E 1 and HPV replication by cyclin E may shed light on the roles of cyclin E / CDK2 in cellular DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Also referred to as a sliding DNA clamp , gp 45 is similar in its function to the processivity factors of bacterial and eukaryotic DNA polymerases , the beta clamp and PCNA , respectively . ^^^ Crystallographic analysis has shown that the beta clamp and PCNA form highly symmetrical ring shaped structures through which duplex DNA can be threaded . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Essential interaction between the fission yeast DNA polymerase delta subunit Cdc 27 and Pcn 1 ( PCNA ) mediated through a C terminal p 21 ( Cip 1 ) like PCNA binding motif . ^^^ Direct interaction between DNA polymerase delta and its processivity factor proliferating cell nuclear antigen ( PCNA ) is essential for effective replication of the eukaryotic genome , yet the precise manner by which this occurs is unclear . ^^^ We show that the 54 kDa subunit of DNA polymerase delta from Schizosaccharomyces pombe interacts directly with Pcn 1 ( PCNA ) both in vivo and in vitro . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factor C ( RFC , also called activator 1 ) , in conjunction with proliferating cell nuclear antigen ( PCNA ) , is responsible for processive DNA synthesis catalyzed by the eukaryotic replicative DNA polymerases delta and epsilon . ^^^ Although mthRFC differs in organization from its eukaryotic counterpart , it was shown to be functionally similar to eukaryotic RFC in : ( 1 ) catalyzing DNA dependent ATP hydrolysis ; ( 2 ) binding preferentially to DNA primer ends ; ( 3 ) loading mthPCNA onto singly nicked circular DNA ; and ( 4 ) supporting mthPolB catalyzed PCNA dependent DNA chain elongation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using a human lymphoblastoid cell line , we have analysed , following gamma irradiation ( 0 . 5 , 1 , 2 , 4 , 8 , 16 and 32 Gy , at 0 . 5 , 24 , 48 and 72 h after treatment ) , the correlation between proliferation , cell cycle analysis , apoptosis and micronuclei frequency with the expression of TP 53 , WAF 1 , DNA LIGASE 1 , PCNA , BAX , BLC 2 , BAK , DAD 1 , ICH 1 Long and Short forms mRNAs . ^^^ We have found that whereas TP 53 , BAK , ICH 1 Short form , and DAD 1 were expressed at constant levels , WAF 1 , PCNA , BAX were up regulated , ICH 1 Long form , DNA LIGASE 1 , and BCL 2 were down regulated . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A base mispair containing substrate is repaired in a reaction requiring S . pombe Uve1p , Rad2p , DNA polymerase delta , replication factor C , proliferating cell nuclear antigen , and T 4 DNA ligase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Liver function and hepatic regenerative activity were documented 24 h post partial hepatectomy by serum bilirubin determinations and a combination of 3 [ H ] Thymidine incorporation into hepatic DNA and proliferating cell nuclear antigen ( PCNA ) quantitation , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : We examined a sequential expression of c fos and c jun after I / R in rat small intestine using reverse transcription polymerase chain reaction and Northern blot analysis , and compared the patterns with coexistent two parameters : ( 1 ) regeneration determined by immunohistochemical detection of proliferating cell nuclear antigen , ( 2 ) programmed cell death determined with the terminal deoxynucleotidyltransferase mediated dUTP biotin nick end labeling ( TUNEL ) method and DNA fragmentation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It also increased thymidine incorporation , in line with induction of the cofactor for DNA polymerase , proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Entry into mitosis is controlled by the cyclin dependent kinase CDK 1 and can be delayed in response to DNA damage . ^^^ Interestingly , we find that other genes , including those for CDC25C , cyclin A 2 , cyclin B 1 , CENP A , and topoisomerase IIalpha , that are normally expressed preferentially in G ( 2 ) and whose promoter regions include putative CDE and CHR elements are also downregulated in response to DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
D cyclin cdk activity is required for Rb phosphorylation in 5 Jun transformed cells , since ectopic expression of the cdk 4 and cdk 6 specific inhibitor p 16 ( INK4A ) inhibits both DNA synthesis and cell proliferation . ^^^ In particular , hormonal activation of a conditional 5 Jun estrogen receptor fusion protein in quiescent , growth factor deprived cells stimulates cyclin E cdk 2 activity and triggers Rb phosphorylation and DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Fluorescence in situ hybridization ( FISH ) on dissociated nuclei and paraffin sections with DNA probes for 20q13 . 2 and cyclin D 1 , as well as immunohistochemistry ( cyclin D 1 ) , were applied to formalin fixed tissue of 69 invasive ovarian carcinomas , mainly of serous type . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Paraffin wax sections from a total of 65 histologically confirmed HD tumours were used to derive apoptotic index ( AI ) and DNA fragmentation index ( DFI ) scores , which were compared with the expression of various cell cycle regulating proteins , including p27KIP1 ( p 27 ) , p21WAF1 / CIP1 ( p 21 ) and cyclin D 1 , and with Epstein Barr virus ( EBV ) status . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Several studies have attempted to determine the proliferation potential of meningiomas , including immunohistochemical labelling with monoclonal antibodies to Ki 67 , proliferating cell nuclear antigen ( PCNA ) , and bromodeoxyuridine ( BUdR ) ; flow cytometric DNA analysis ; or argyrophilic nucleolar organizer regions ( AgNORs ) counting [ 9 , 10 , 15 , 19 , 22 , 26 , 31 , 35 , 53 ] . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DEVELOPMENT : This work is focussed on the analysis of different methods , all of them employed to study the cell proliferation : immunostaining of proliferating cell nuclear antigen ( PCNA ) and Ki 67 , DNA content and ploidy by flow cytometry , in vitro incorporation of bromodeoxyuridine ( BrdU ) and the identification of apoptotic cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Increase in proliferation , as measured by proliferating cell nuclear antigen immunostaining in tumor sections and by thymidine incorporation into DNA in response to testosterone , was observed in histocultures of breast cancer samples . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Prostaglandin F ( 2alpha ) ( PGF ( 2alpha ) ) induces cyclin D 1 expression and DNA synthesis via early signaling mechanisms in Swiss mouse 3T3 cells . ^^^ Thus , it appears that PGF ( 2alpha ) triggers cyclin D 1 expression via two independent signaling events that complement with TGF ( beta 1 ) triggered events to induce DNA synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Normal and dysplastic human cervical tissues ( 3 10 2 mm ) were placed subcutaneously in SCID beige mice and later assessed by in situ hybridization for HPV 16 / 18 DNA and by immunohistochemistry for expression of CD 31 , keratin , proliferating cell nuclear antigen , HPV 16 E 6 , p 53 , and Notch 1 ( a binary cell fate determination protein ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We found that transfection of several lines of vascular smooth muscle cells with antisense oligodeoxynucleotide specific to p 21 ( Waf1 / Cip1 ) correlates with decreased cyclin D1 / cdk 4 , but not cyclin E / cdk 2 , association , yet , unexpectedly , results in dose dependent inhibition of platelet derived growth factor BB stimulated DNA synthesis and cell proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we show that c Myc can directly bind to the carboxyl terminal region of the cyclin dependent kinase inhibitor p 21 ( cip1 / waf1 / sdi1 ) and thus partially relieves the p 21 of the inhibitory effect on DNA synthesis directed by the proliferating cell nuclear antigen dependent DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) functions in DNA replication as a processivity factor for polymerases delta and epsilon , and in multiple DNA repair processes . ^^^ We describe two temperature sensitive lethal alleles ( mus 209 ( B 1 ) and mus 209 ( 2735 ) ) of the Drosophila PCNA gene that , at temperatures permissive for growth , result in hypersensitivity to DNA damaging agents , suppression of position effect variegation , and female sterility in which ovaries are underdeveloped and do not produce eggs . ^^^ Proliferating cell nuclear antigen ( PCNA ) functions in DNA replication as a processivity factor for polymerases delta and epsilon , and in multiple DNA repair processes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The role of the pol delta accessory protein , proliferating cell nuclear antigen ( PCNA ) , on DNA replication by pol delta was also examined by kinetic analysis . ^^^ DNA complex was measured in the absence of PCNA . ^^^ PCNA appears to affect pol delta replication in this model mainly by decreasing the dissociation of the polymerase from the DNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A strong body of evidence indicates that cyclin dependent protein kinases are required not only for the initiation of DNA replication but also for preventing over replication in eukaryotic cells . ^^^ It has been reported that Mcm proteins are phosphorylated by the cyclin dependent kinases in vivo , suggesting that these two factors are cooperatively involved in the regulation of DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In contrast , cells engineered to co express Wnt 1 and activated MEK 1 accumulated high levels of cyclin D 1 and entered the DNA synthetic phase in the absence of serum derived growth factors , a characteristic of neoplastic transformation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The fidelity of Schizosaccharomyces pombe DNA polymerase delta was measured in the presence or absence of its processivity subunits , proliferating cell nuclear antigen ( PCNA ) sliding clamp and replication factor C ( RFC ) clamp loading complex , using a synthetic 30 mer primer / 100 mer template . ^^^ Processive synthesis occurred in the presence of PCNA , RFC , and Escherichia coli single strand DNA binding protein ( SSB ) and required the presence of ATP . `` Passive ' ' self loading of PCNA onto DNA takes place in the absence of RFC , in an ATP independent reaction , which was strongly inhibited by SSB . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It was established with the help of confocal microscopy that XPA foci in detergent treated UV irradiated cell were partially colocalized with the focal sites of PCNA , an auxiliary protein of DNA polymerases delta and epsilon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this report , we present data implicating the cyclin B 1 protein as a regulator of apoptotic fate following DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Myeov was mapped to chromosome 11q13 and localized by DNA fiber fluorescence in situ hybridization ( FISH ) 360 kilobase ( kb ) centromeric of cyclin D 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
STUDY DESIGN : Representative archived specimens of benign keratosis , sanguinaria associated keratosis , and keratosis with dysplasia were used for computerized image analysis and biomarker immunohistochemical assays to assess ploidy , DNA content , and p 53 and proliferating cell nuclear antigen immunoreactivity of nuclei . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This study of primary resectable non small cell lung cancer ( NSCLC ) was designed to examine p 21 functions in association with the expression of cyclin D 1 ( including its subcellular localisation ) , p16INK4a and pRb . p 21 expression was examined in 50 NSCLC ( stage 1 IIIA ) and in several normal lung samples all of which had previously been studied for cyclin D 1 ( DNA , RT PCR , immunostaining ) , p16INK4a ( DNA , RT PCR , immunostaining ) , and pRb ( immunostaining ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It has recently been found that Cdk 2 cyclin E is involved in the initiation of centrosome duplication , and that constitutive activation of Cdk 2 cyclin E results in the uncoupling of the centrosome duplication cycle and the DNA replication cycle . ^^^ Through examination of cells derived from Waf 1 null mice , we further found that Waf 1 , a potent inhibitor of Cdk 2 cyclin E and a major target of p 53 ' s transactivation function , is involved in coordinating the initiation of centrosome duplication and DNA replication , suggesting that Waf 1 may act as a molecular link between p 53 and Cdk 2 cyclin E in the control of the centrosome duplication cycle . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , the levels of proteins involved in cellular responses to hypoxia , ROS and nuclear DNA damage ; hypoxia inducible factor 1alpha ( HIF 1alpha ) , p 53 , p 21 and PCNA were also modulated temporally . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Besides mitogenic stimulation , cyclin kinase inhibition , the G 1 restriction point and the prb pathway , accuracy of DNA replication and DNA repair , the G 2 to M transition , apoptosis and the p 53 pathway , proteolytic , in particular ubiquitin dependent mechanisms involved in the initiation of DNA synthesis in the separation of sister chromatids and in the telophase to GO / G1 transition , are discussed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Neuronal death evoked by DNA damage requires cyclin dependent kinase 4 ( Cdk 4 ) and 6 activity and is accompanied by elevation of cyclin D 1 associated kinase activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
On the other hand , mitogen stimulated cells deprived of E2F activity can still maintain physiologically relevant levels of cyclin E dependent kinase activity and gradually enter S phase , suggesting the existence of a DNA synthesis inducing mechanism parallel to the pRb / E2F axis . ^^^ Here we show that regulatable ectopic expression of cyclin E or transcriptionally active Myc can rapidly induce DNA synthesis in U2OS derived cell lines whose E2F activity is blocked by a constitutively active pRb ( pRbDeltacdk ) mutant . ^^^ Whereas ectopic Myc and E2F1 rescue the G ( 1 ) / S delay caused by pRbDeltacdk ( or dnDP 1 ) and MadMyc , respectively , cyclin E or Cdc25A can restore DNA replication even in cells concomitantly exposed to pRbDeltacdk and MadMyc . ^^^ Finally , proper transcription of cyclin E and Cdc25A at the G ( 1 ) / S transition requires both Myc and E2F activities , and subthreshold levels of ectopic cyclin E and Cdc25A synergistically restore DNA synthesis in cells with silenced Myc and E2F activities . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
WRN increases the rate of nucleotide incorporation by pol delta in the absence of proliferating cell nuclear antigen ( PCNA ) but does not stimulate the activity of eukaryotic DNA polymerases alpha or epsilon , or a variety of other DNA polymerases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin dependent kinase inhibitor p 21 ( cip 1 ) regulates cell cycle progression , DNA replication , and DNA repair by binding to specific cellular proteins through distinct amino and carboxyl terminal protein binding motifs . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , DNA replication factor C ( RFC ) , a protein complex that facilitates the loading of PCNA onto DNA , is also part of BASC . ^^^ We find that BRCA 1 , the BLM helicase , and the RAD 50 MRE11 NBS 1 complex colocalize to large nuclear foci that contain PCNA when cells are treated with agents that interfere with DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin dependent kinase ( Cdk ) inhibitors roscovitine and olomoucine inhibit initiation of DNA replication , indicating a dependence of initiation on Cdk activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A activates the DNA polymerase delta dependent elongation machinery in vitro : A parvovirus DNA replication model . ^^^ In cell extracts , we found that complementary strand synthesis was inhibited by the cyclin dependent kinase inhibitor p 21 ( WAF1 / CIP1 ) and rescued by the addition of proliferating cell nuclear antigen , arguing for the involvement of DNA polymerase ( Pol ) delta in the conversion reaction . ^^^ In vivo time course analyses using synchronized MVM infected A 9 cells allowed initial detection of MVM RF DNA at the G ( 1 ) / S phase transition , coinciding with the onset of cyclin A expression and cyclin A associated kinase activity . ^^^ Addition of recombinant cyclin A stimulated DNA conversion in G ( 1 ) cell extracts , and correlated with a concomitant increase in cyclin A associated kinase activity . ^^^ Conversely , a specific antibody neutralizing cyclin A dependent kinase activity , abolished the capacity of S cell extracts for DNA conversion . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the accumulated region , PCNA labeled cells undergoing DNA synthesis were also detected . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cell cycle of the lutein cells was measured by the flow cytometric quantification of DNA in single cells , using propidium iodide staining after ethanol fixation and RNAse treatment , and by the detection of the proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The investigations included routine histology and quantitative DNA measurements , along with immunohistochemical identification of proliferation markers ( i . e . , MIB 1 ; proliferating cell nuclear antigen , PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
At the replication fork , the five subunit RF C complex functions to load the trimeric polymerase accessory factor PCNA onto DNA . ^^^ PCNA then acts as a sliding clamp , tethering Pol delta to the DNA to maximise its processivity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have used three color ( 3C ) assays , with FITC labeled anti BCL 2 and PE labeled anti proliferating cell nuclear antigen ( PCNA ) antibodies , and the DNA dye 7 aminoactinomycin , to characterize primary leukemia cells identified in DNA 10 side light scatter ( SSC ) histograms . ^^^ In modeling this assay strategy , PE / Cy5 labeled anti CD 34 antibody was used to detect blasts , with FITC labeled anti BCL 2 , PE labeled anti PCNA antibodies , and Hoechst 33342 ( H 33342 ) DNA dye . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Eukaryotic replication factor C ( RF C ) is a heteropentameric complex that is required to load the replication clamp proliferating cell nuclear antigen onto primed DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
STUDY DESIGN : DNA ploidy and intracellular localization of PCNA in renal cell carcinoma were determined using LSC and immunohistochemistry . ^^^ After DNA ploidy analysis , the glass slides were restained by immunohistochemistry of PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Quiescent ( G 0 ) cells did not express c fos , c jun , c myc and cyclin A , but upon stimulation with mitogens ( fetal calf serum ( FCS ) , u PA , t PA ) the cyclin A mRNA expression was observed in concomitance with the activation of DNA synthesis . ^^^ Therefore u PA , t PA and FCS similarly modulate the expression of c fos , c jun , c myc , p 53 , p21CIP1 and cyclin A with only slight differences likely related to the time required for activation of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In short , cell growth was reduced , homeostasis occurred , cell morphology became enlarged and flat , the cell cycle was arrested at G 1 phase , cyclin B 1 and cdc 2 expression was down regulated , and DNA synthesis was suppressed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Then , we studied the expression of two p 53 downstream genes that could participate in the glutamate induced pro apoptotic pathway : p 21 , which codes for an inhibitor of different cyclin dependent kinases , and MSH 2 , which codes for a protein involved in the recognition and repair of DNA mismatches . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In situ analysis for DNA fragmentation and proliferating cell nuclear antigen ( PCNA ) was performed simultaneously by TdT mediated dUTP biotin nick end labeling ( TUNEL ) and immunohistochemistry , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Base excision repair ( BER ) is carried out by two distinct pathways in mammalian cells , one dependent on DNA polymerase beta ( Polb ) and the other on proliferating cell nuclear antigen ( Pcna ) . ^^^ Together with evidence accumulated in vitro , these results strongly support the idea that the Pcna dependent pathway predominantly acts in BER of radiation induced DNA damage in vivo . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
MyD 118 and Gadd 45 are related proteins that previously were shown to interact with proliferating cell nuclear antigen ( PCNA ) , implicated in DNA replication , DNA repair , and cell cycle progression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Tissue sections were prepared for hematoxylin eosin staining and immunohistochemistry for PCNA protein or 3 ' OH DNA fragments to assess cell proliferation and apoptosis , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
AIM : The study analyses the expression of DNA ploidy , ki 67 , PCNA and p 53 and their role as potential markers of the development of colorectal adenomas . ^^^ Flow cytometric analysis was carried out to calculate the DNA index and immunohistochemical tests were used to evaluate ki 67 , PCNA and p 53 . ^^^ PCNA , which was also pathological ( > 40 % ) in 4 ( 23 . 5 % ) aneuploid adenomas with severe dysplasia ( 2 villous and 2 tubulo villous ) , appeared to be significantly correlated with the DNA index ( p < 0 . 005 ) , showing a proliferative index of exceptional clinical importance . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cooperative effect of ACV and IFN gamma against the glioblastomas appears to be due to direct inhibition of DNA synthesis by ACV in the S phase of the cell cycle and induction by IFN gamma of the tumor suppressor gene p21wAF1 / CIP1 , which in turn acts at the level of proliferating cell nuclear antigen ( PCNA ) and cyclin E / cyclin dependent kinase 2 ( Cdk 2 ) binding and inhibition of function . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The Proliferating Cell Nuclear Antigen ( PCNA ) is an auxiliary protein of the DNA polymerase delta , belonging to the cyclin family , which attains appreciable levels only in those phases of the cell cycle in which DNA synthesis occurs . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Binding of the DQ 65 79 peptide to PCNA did not block polymerase delta ( pol delta ) dependent DNA replication in vitro . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , bioinformatics analysis of the protein sequences of Hus 1 , Rad 1 , and Rad 9 , three checkpoint Rad proteins that form a complex , revealed that they all contain a putative proliferating cell nuclear antigen ( PCNA ) fold , raising the possibility that these factors may bind to DNA in a PCNA like ring structure . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin E is essential for progression through the G 1 phase of the cell cycle and initiation of DNA replication by interacting with , and activating its catalytic partner , the cyclin dependent kinase 2 ( Cdk 2 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The human cyclin B 1 protein modulates sensitivity of DNA mismatch repair deficient prostate cancer cell lines to alkylating agents . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA expression was examined by the avidin / biotin immunoperoxidase method with a monoclonal antibody to PCNA , and apoptosis was assessed by in situ DNA 3 ' end labeling method and DNA fragmentation analysis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , a processivity factor of DNA synthesis , has often been used as a marker that reveals proliferating cells . ^^^ Proliferating cell nuclear antigen ( PCNA ) , a processivity factor of DNA synthesis , has often been used as a marker that reveals proliferating cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) plays an essential role in DNA replication , repair , and control of cell proliferation , and its activity can be modulated by interaction with p 21 ( Waf1 / Cip1 ) [ Cox , L . ^^^ Alanine mutation of Met 147 or Asp 149 completely abolished or significantly decreased , respectively , the level of the PCNA binding and the inhibition of SV 40 DNA replication . ^^^ Consensus motif 1 peptide and p 21 ( 141 160 ) have similar affinities for binding PCNA and abilities to inhibit in vitro replication of DNA originated from SV 40 . ^^^ Proliferating cell nuclear antigen ( PCNA ) plays an essential role in DNA replication , repair , and control of cell proliferation , and its activity can be modulated by interaction with p 21 ( Waf1 / Cip1 ) [ Cox , L . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The primary targets of p21WAF1 ( hereafter referred to as p 21 ) are the cdk cyclins which regulate the progression of eukaryotic cells through the cell cycle , and proliferating cell nuclear antigen ( PCNA ) , an accessory protein of DNA polymerase delta . p 21 forms complexes with a class of cdk cyclins to inhibit their kinase activity and with PCNA to inhibit DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To evaluate the relationship between cell proliferation and apoptosis , immunohistochemistry for proliferating cell nuclear antigen ( PCNA ) , Ki 67 , and in situ DNA nick labeling ( TUNEL ) for identifying apoptotic cells , were performed on paraffin sections from prostate samples with PIN lesions . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In mirror sections , all of the TUNEL positive myocytes in DCM simultaneously expressed proliferating cell nuclear antigen , which is required for both DNA replication and repair , but Ki 67 , a replication associated antigen , was completely negative in all cases , which appeared to rule out cell proliferation activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Each of these families was found to share a common protein fold with that of PCNA , the sliding clamp protein that tethers DNA polymerase to its template . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Deletion analysis revealed that the N terminal 166 amino acids of E 1 , which encompass a nuclear localization signal and a cyclin E binding motif , are dispensable for E 1 dependent DNA replication and for recruitment of pol alpha primase to the origin in vitro . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Plants inoculated with the KEE 146 mutant , which retains 16 % pRBR binding activity , only developed chlorosis along the veins , and viral DNA , AL 1 protein and the host DNA synthesis factor , proliferating cell nuclear antigen , were localized to vascular tissue . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Herpes simplex virus DNA polymerase is a heterodimer composed of a catalytic subunit , Pol , and an unusual processivity subunit , UL 42 , which , unlike processivity factors such as PCNA , directly binds DNA . ^^^ The structure and previous data suggest that the UL 42 monomer interacts with DNA quite differently than does multimeric toroidal PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
One of the well established functions for PCNA is its role as the processing factor for DNA polymerase delta and epsilon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RESULTS : Using Xenopus egg extracts , we have investigated the role of Cdc 45 in the loading of various replication proteins onto chromatin at the onset of S phase , and found that Cdc 45 , which required MCM for its loading , was essential for the sequential loading of replication protein A ( RPA ) , DNA polymerase alpha and proliferating cell nuclear antigen ( PCNA ) onto chromatin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We found that Mdm 2 expression rescues the temperature sensitive phenotype of tsBN 462 cells , as shown by activation of cell cycle regulated gene promoters ( B myb , cyclin A , and cdc25C ) , increased cell growth and DNA synthesis , and inhibition of apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is essential for the function of DNA polymerases delta and epsilon . ^^^ Because proliferating cell nuclear antigen is required for DNA replication and repair , PCNA is abundantly expressed in proliferating cells . ^^^ Proliferating cell nuclear antigen ( PCNA ) is essential for the function of DNA polymerases delta and epsilon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Lung levels of PTHrP were significantly decreased between 4 and 8 days of hyperoxia , concurrent with increased expression of proliferating cell nuclear antigen and increased incorporation of 5 bromo 2 ' deoxyuridine ( BrdU ) into DNA in lung corner cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Measurement of DNA synthesis in platelet derived growth factor stimulated VSMC treated with DBcAMP revealed that cells became refractory to growth inhibition by 12 16 h , consistent with blockade in mid G 1 . cAMP treatment blunted the serum induced rise in cyclin D 1 during cell cycle progression without altering levels of the cyclin dependent kinase cdk 4 or cyclin E and its associated kinase , cdk 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results suggest that increases in the levels of p 27 ( Kip 1 ) and its binding to cyclin A , as well as reduction of Cdk 3 protein expression , are strong candidates for the cell cycle regulator that prevents the entry into the S phase in RA treated CH 27 cells , with prolongation of G 1 phase and inhibition of DNA synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To better characterize the cell cycle regulatory mechanisms of this process as well as determine whether this process would occur in cells of human origin , we treated human pulmonary artery endothelial cell ( HPAEC ) cultures with MCTP and determined , by flow cytometry , the expression of cyclin B 1 and p 53 in conjunction with DNA content . ^^^ In addition , a second population of cells expressing cyclin B 1 had continued incorporation of BrdU and DNA content consistent with 8 N chromosomes . ^^^ We conclude that HPAEC treated with low concentrations of MCTP develop G 2 arrest in association with persistent cyclin B 1 expression , failure to completely activate cdc 2 , and continued DNA synthesis through a pathway that is unrelated to altered expression of p53 . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , considerable evidence indicates that mutated p 53 plays a significant role in the development of cisplatin resistance since several genes implicated in drug resistance and apoptosis ( e . g . mismatch repair , bcl 2 , high mobility group proteins , DNA polymerases alpha and beta , PCNA , and insulin like growth factor ) are known to be regulated by the p 53 oncoprotein . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Two modes of FEN 1 binding to PCNA regulated by DNA . ^^^ When PCNA was loaded onto a DNA substrate coupled to magnetic beads , it stabilized retention of FEN 1 on the DNA . ^^^ In this DNA dependent binding assay , pcna 79 also stabilized retention of FEN 1 , but pcna 90 was inactive . ^^^ Therefore , in the absence of DNA , FEN 1 interacts with PCNA mainly through the IDCL . ^^^ However , when PCNA encircles the DNA , the C terminal domain of PCNA rather than its IDCL is important for binding FEN 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Presence of human herpesvirus 8 DNA sequences and overexpression of human IL 6 and cyclin D 1 in inflammatory myofibroblastic tumor ( inflammatory pseudotumor ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RESULTS : Multiparameter flow cytometry shows that the dye can rapidly report the cellular DNA content of live and fixed cells at a resolution level adequate for cell cycle analysis and the cycle specific expression of cellular proteins ( e . g . , cyclin B 1 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Mitogen dependent , cyclin D dependent kinases ( cdk 4 and cdk 6 ) phosphorylate the retinoblastoma ( Rb ) tumor suppressor protein , helping to cancel its growth inhibitory effects and enabling E2F transcription factors to activate genes required for entry into the DNA synthetic phase ( S ) of the cell division cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , we also demonstrated that the concentration of the CDK inhibitor p 21 ( CIP1 / WAF1 ) induced after DNA damage is sufficient to overcome the cyclin CDK 2 complexes in MCF 7 cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The relationship between apoptosis and cellular proliferative activity in human non small cell lung cancer ( 25 cases ) was investigated using the in situ DNA nick end labeling method and immunohistochemistry for both proliferating cell nuclear antigen ( PCNA ) and Ki 67 antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We show that DNA damage causes an immediate and p 53 independent G 1 arrest , caused by rapid proteolysis of cyclin D 1 . ^^^ Interference with cyclin D 1 degradation prevents initiation of G 1 arrest and renders cells more susceptible to DNA damage , indicating that cyclin D 1 degradation is an essential component of the cellular response to genotoxic stress . ^^^ Thus , induction of G 1 arrest in response to DNA damage is minimally a two step process : a fast p 53 independent initiation of G 1 arrest mediated by cyclin D 1 proteolysis and a slower maintenance of arrest resulting from increased p 53 stability . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This ternary PCNA Cdk 2 cyclin A complex was able to phosphorylate the PCNA binding region of the large subunit of replication factor C as well as DNA ligase 1 . ^^^ Based on our results , we propose the model that PCNA brings Cdk 2 to proteins involved in DNA replication and possibly might act as an `` adaptor ' ' for Cdk 2 cyclin A to PCNA binding DNA replication proteins . . ^^^ Furthermore , PCNA appears to be a connector between Cdk 2 and DNA ligase 1 and to stimulate phosphorylation of DNA ligase 1 . ^^^ Proliferating cell nuclear antigen is best known as a DNA polymerase accessory protein but has more recently also been shown to have different functions in important cellular processes such as DNA replication , DNA repair , and cell cycle control . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis of alveolar epithelial cells , as identified by proliferating cell nuclear antigen ( PCNA ) staining , was 3 fold higher in the reperfused lung than in the sham operated lung . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The combined measurement of DNA and cyclins showed a higher cyclin expression in aneuploid ( 11 . 5 + / 2 . 0 % , 4 . 3 + / 1 . 1 % , and 19 . 5 + / 3 . 4 % positive cells for cyclins A , B , and D 1 , respectively ) than in diploid carcinomas ( 3 . 9 + / 1 . 2 % , 1 . 1 + / 0 . 4 % , and 5 . 0 + / 1 . 2 % positive cells for cyclins A , B , and D 1 , respectively ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Effective growth inhibition by L 744 , 832 correlated with accumulation of cells with a tetraploid ( 4N ) DNA content and high levels of cyclin B1 / cdc2 kinase activity , implying cell cycle arrest downstream from the DNA damage inducible G2 / M cell cycle checkpoint . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Requirement of Cyclin / Cdk2 and protein phosphatase 1 activity for chromatin assembly factor 1 dependent chromatin assembly during DNA synthesis . ^^^ Inhibitor studies and add back experiments indicated requirements of cyclin A / Cdk2 , cyclin E / Cdk2 , and protein phosphatase type 1 ( PP 1 ) activities for nucleosome assembly during DNA synthesis by chromatin assembly factor 1 ( CAF 1 ) . ^^^ The p 60 subunit of CAF 1 is a molecular target for reversible phosphorylation by cyclin / Cdk complexes and PP 1 during nucleosome assembly and DNA synthesis in vitro . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Perturbation of EGF activated MEK 1 and PKB signal pathways by TGF beta 1 correlates with perturbation of EGF induced cyclin D 1 and DNA synthesis by TGF beta 1 in C3H 10T1 / 2 cells . ^^^ In mouse C3H 10T1 / 2 cells , we previously reported that TGF beta 1 first delays and later potentiates EGF induced DNA synthesis corresponding to an inhibition of EGF induced cyclin D 1 expression at t = 13 h . ^^^ We report here that in accord with DNA synthesis kinetics , TGF beta 1 initially suppresses EGF induced cyclin D 1 expression then later releases the inhibition . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The temporal relationship between cyclin A accumulation and the onset of DNA replication was analyzed in detail . ^^^ We show that the onset of cyclin A accumulation and the start of DNA replication occurs at the same time , or deviating by a few minutes at the most . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA polymerase alpha ( but not DNA polymerase beta ) and the characteristic nuclear expression of PCNA were both inhibited in the n butyrate treated IDL and C2C12 cells . n Butyrate , therefore , inhibited host and viral DNA synthesis in the undifferentiated cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : DNA ploidy and cell proliferation were analyzed by flow cytometry , and the expression of proliferating cell nuclear antigen ( PCNA ) and Ki 67 were analyzed immunohistochemically on paraffin embedded tissue . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In gastric cancers , the rate of cyclin D 1 mRNA expression ( an index of the density of DNA bands ) was significantly higher in patients with tumors invading beyond the submucosal layer , regional lymph nodes and lymphatic vessels ( i . e . , patients with stage 3 or 4 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D1 / cdk4 and 6 complexes , which functions as a G 1 S checkpoint and cyclin B1 / cdc2 complexes , a G 2 M checkpoint are essential for DNA synthesis and mitosis , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Interaction between PCNA and DNA ligase 1 is critical for joining of Okazaki fragments and long patch base excision repair . ^^^ DNA ligase 1 belongs to a family of proteins that bind to proliferating cell nuclear antigen ( PCNA ) via a conserved 8 amino acid motif [ 1 ] . ^^^ Inactivation of the PCNA binding site of DNA ligase 1 had no effect on its catalytic activity or its interaction with DNA polymerase beta . ^^^ In contrast , the loss of PCNA binding severely compromised the ability of DNA ligase 1 to join Okazaki fragments . ^^^ Thus , the interaction between PCNA and DNA ligase 1 is not only critical for the subnuclear targeting of the ligase , but also for coordination of the molecular transactions that occur during lagging strand synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The importance of ERK activity in the regulation of cyclin D 1 levels and DNA synthesis in human cultured airway smooth muscle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Complete cDNA sequences encoding two novel proliferating cell nuclear antigens ( designated TgPCNA 1 and 2 ) were isolated from a Toxoplasma gondii tachyzoite cDNA library , and Southern analysis using cDNA probes confirmed the presence of two PCNA genes in T . gondii genomic DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our results showed that the ability of E 7 binding to pRb correlated with the activation of DNA polymerase alpha or cyclin E to various extents in differentiated keratinocytes of organotypic cultures but was insufficient to induce the proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Human DNA demethylating activity : a glycosylase associated with RNA and PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Moreover , the DNA instability test positive dysplasia cases showed statistically significant increased values of PCNA index , AgNOR parameters , mean chromosome index , p 53 and bcl 2 expression in comparison to those of DNA instability test negative dysplasia cases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have cloned 1 . 8kb of DNA sequence upstream of the rat cyclin B 1 gene translation start site from Rattus norvegicus liver genomic DNA and a commercial rat testis genomic library . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It was suggested that a population of malgun cells , which were positive for PCNA only , were in the process of active DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Inhibition of neointimal formation was accompanied by ( 1 ) a reduction in collagen synthesis and mRNA expression of collagen 1 and 3 and ( 2 ) a significant decrease in DNA synthesis as assessed by proliferating cell nuclear antigen staining . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin E / Cdk2 acts at the G1 / S phase transition to promote the E2F transcriptional program and the initiation of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Activation of p 38 in these cultures , via transient transfection with a constitutively active form of its upstream kinase MKK 6 , also inhibited DNA synthesis as well as reducing cyclin D 1 content . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Unexpectedly , although constitutively assembled APC Cdh 1 also delayed G ( 1 ) / S transition and lowered the rate of DNA synthesis during S phase , some of the activities essential for DNA replication became markedly amplified , mainly due to a progressive increase of E2F dependent cyclin E transcription and a rapid turnover of the p 27 ( Kip 1 ) cyclin dependent kinase inhibitor . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
FGF 2 elicits a strong mitogenic response in G0 / G1 arrested Y 1 adrenocortical cells , that includes a ) rapid and transient activation of extracellular signal regulated kinases mitogen activated protein kinases ( ERK MAPK ) ( 2 to 10 min ) , b ) transcription activation of c fos , c jun and c myc genes ( 10 to 30 min ) , c ) induction of c Fos and c Myc proteins by 1 h and cyclin D 1 protein by 5 h , and d ) onset of DNA synthesis stimulation within 8 h . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Fluorescence in situ hybridization ( FISH ) analysis of dissociated nuclei with DNA probes for MYC ( 8q24 ) / # 8 , cyclin D 1 gene ( CCND 1 ; 11q13 ) / # 11 , ERBB 2 ( 17q13 ) / # 17 , the androgen receptor gene ( AR ; Xq 12 ) / # 10 , and the retinoblastoma gene ( RB ; 13q14 ) was applied to formalin fixed tissue from 63 patients with advanced PC after androgen deprivation therapy ( ADT ) ; matched tumor tissue before ADT was also available in 22 of these cases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Eukaryotic DNA mismatch repair requires the concerted action of several proteins , including proliferating cell nuclear antigen ( PCNA ) and heterodimers of MSH 2 complexed with either MSH 3 or MSH 6 . ^^^ When human MSH 3 or MSH 6 peptides containing the PCNA binding motif were added to a human cell extract , mismatch repair activity was inhibited at a step preceding DNA resynthesis . ^^^ Thus , MSH 3 and MSH 6 interactions with PCNA may facilitate early steps in DNA mismatch repair and may also be important for other roles of these eukaryotic MutS homologs . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Twenty five tumors ( 31 % ) accumulated ( presumably mutant ) p 53 and 28 ( 35 % ) overexpressed cyclin D 1 ; 7 carcinomas ( not including any pure lobular cancers ) abnormally expressed both proteins . p 53 accumulation correlated with nuclear , mitotic , and overall grade , but not with tumor size , lymph node involvement , or DNA ploidy . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Several types of cyclins have been identified and among these , cyclin A 2 is synthesized in somatic cells at the onset of DNA synthesis as well as during the G2 / M transition associated with cyclin dependent protein kinases 1 and 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These include genes involved in DNA replication and repair ( e . g . , PCNA , XRCC 1 , B MYB , and GADD 45 ) , transcriptional regulators associated with stress response , and cell cycle checkpoint control ( e . g . , YB 1 , DBPA , and ATF 4 ) , and genes for signal transduction proteins ( e . g . , protein tyrosine phosphatase 1B and regulatory subunits alpha and beta of cAMP dependent protein kinase ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Regulation of cyclin D ( 1 ) expression and DNA synthesis by phosphatidylinositol 3 kinase in airway smooth muscle cells . ^^^ These inhibitors also decreased cyclin D ( 1 ) promoter activity , protein abundance , and DNA synthesis . ^^^ Together , these data suggest that in airway smooth muscle ( ASM ) cells , PI 3 kinase regulates transcription from the cyclin D ( 1 ) promoter and DNA synthesis in an ERK independent manner . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Recently , we have shown that both MyD 118 and GADD 45 interact with proliferating cell nuclear antigen ( PCNA ) , a protein that plays a central role in DNA replication , DNA repair , and cell cycle progression , as well as with the universal cyclin dependent kinase inhibitor p 21 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we show that exposure of aphidicolin arrested Chinese hamster ovary ( CHO ) cells to the protein kinase inhibitors 2 aminopurine or caffeine results in initiation of replication at successively later replicating chromosomal domains , loss of the capacity to synthesize DNA at earlier replicating sites , release of Mcm 2 proteins from chromatin , and redistribution of PCNA and RPA from early to late replicating domains in the absence of detectable elongation of replication forks . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We also found that two other proteins , the cyclin dependent kinase inhibitor p 21 and DNA mismatches repair MSH 2 , whose encoding genes are well known target of p 53 , were upregulated by glutamate . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The PCNA from Thermococcus fumicolans functionally interacts with DNA polymerase delta . ^^^ The purified Tfu PCNA was tested first with recombinant Tfu DNA polymerase 1 ( Tfu pol ) and second with calf thymus DNA polymerase delta ( pol delta ) . ^^^ When tested with the homologous Tfu pol on bacteriophage lambda DNA , large amounts of Tfu PCNA were required to obtain two to threefold stimulation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Special attention was given to the association of Bcl 2 expression with the grade of the lesion , proliferative activity ( expression of nuclear antigen of proliferative cells PCNA ) and human papillomavirus ( HPV ) DNA positivity . ^^^ Bcl 2 and PCNA were investigated using immunohistochemical staining and detection of HPV DNA was performed by hybridization in situ . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Three critical points of the cell ' s life cycle were evaluated : the G 1 checkpoint [ proliferating cell nuclear antigen ( PCNA ) expression ] , DNA synthesis ( ( 3 ) H thymidine incorporation ) , and the prevalence of mitosis . ^^^ RESULTS : Cell populations exposed to a high glucose concentration showed an initial acceleration of their life cycle , as sustained by a peak of mitosis at two hours , an early increase of DNA incorporation sustained during the first 24 hours , as well as a top level of PCNA expression after three to four hours . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , in contrast to cyclin G 1 , cyclin 1 expression was stable during cell cycle progression after partial hepatectomy in both the absence and presence of DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA is involved in many aspects of DNA replication and processing , forming a sliding platform that can mediate the interaction of proteins with DNA . ^^^ It is striking that many proteins bind to PCNA through a small region containing a conserved motif ; these include proteins involved in cell cycle regulation as well as those involved in DNA processing . ^^^ Sequential and regulated binding of motif containing proteins to PCNA may contribute to the ordering of events during DNA replication and repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA has been implicated to act in MMR before and during the DNA synthesis step , although the biochemical basis for the role of PCNA early in MMR is unclear . ^^^ The association of PCNA with Msh2p Msh6p stimulated the preferential binding of Msh2p Msh6p to DNA containing mispaired bases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This pathway also inhibits DNA replication by merit of p 21 ' s interaction with PCNA , but it has also been shown that this same inhibitory interaction with p 21 does not affect PCNA DNA repair abilities . ^^^ This last result may indicate that the mechanism by which PCNA controls the DNA repair is the most important activity of this protein during lung cancer progression and development , compared to its contribution to cell proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We report that RA enhances p 27 expression , which results in increased association with cyclin E / cyclin dependent kinase 2 complexes and suppression of their activity ; however , antisense clones , which have greatly reduced RA dependent p 27 inducibility ( NT 2 p27AS ) , continue to synthesize DNA and are unable to differentiate properly in response to RA as determined by lack of neurite outgrowth and by the failure to modify surface antigens . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In DLD 1 colorectal adenocarcinoma cells ( DLD 1 tet off p 53 ) cyclin B 1 and B 2 mRNA levels drop after expression of wild type p 53 but not after induction of a DNA binding deficient mutant of p 53 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we report for the first time the ultrastructural localization of DNA replication sites in the nucleus of plant cells and the timing of replication through the pollen developmental programme by proliferating cell nuclear antigen ( PCNA ) immunogold labelling . ^^^ Replication sites were identified by labelling with anti PCNA antibodies in fibrils of the interchromatin region close to the condensed chromatin , defining a perichromatin subdomain in the interchromatin space where DNA replication takes place . ^^^ Double immunogold labelling for PCNA and DNA show colocalization on these perichromatin structures . ^^^ DNA replication was also monitored at different phases during pollen development by PCNA immunoelectron microscopy , revealing two peaks of DNA synthesis , at the beginning ( early tetrad ) , and the end ( late vacuolate ) , of microspore interphase . ^^^ In the bicellular pollen grain , PCNA immunogold labelling revealed that DNA replication in the generative cell starts at an intermediate stage of pollen maturation , whereas the vegetative nucleus does not replicate and is arrested in G 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Six melanocytic tumours from five horses ( two metastatic and four benign ) were examined by Ki 67 , PCNA and p 53 immunostaining , DNA nick end labelling ( Tunel ) and Feulgen staining . ^^^ The resulting parameters of growth fraction ( Ki 67 ) , S phase index ( PCNA ) , p 53 index , apoptotic index , DNA index , nuclear diameter , ploidy balance , proliferation index ( Feulgen ) and hyperploidy were analysed . ^^^ No differences were found in growth fraction , S phase index ( PCNA ) nor in DNA configuration between the metastatic and the benign tumours . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA interacts with hHus1 / hRad9 in response to DNA damage and replication inhibition . ^^^ Using a yeast two hybrid system to detect protein protein interactions , we found that human proliferating cell nuclear antigen ( PCNA ) , a protein known to function in both DNA replication and repair , interacts with the human checkpoint related protein Hus 1 ( hHus 1 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have previously demonstrated that Tax activates expression of the cellular gene , proliferating cell nuclear antigen ( PCNA ) , and that Tax suppresses DNA repair . ^^^ In this study we tested the ability of previously described Tax mutants to activate PCNA gene expression and their ability to interfere with DNA repair . ^^^ The results revealed a strong correlation between Tax trans activation of PCNA gene expression and its ability to inhibit DNA repair via the nucleotide excision repair ( NER ) pathway . ^^^ Thus , a consequence of activated PCNA gene expression appears to be reduced DNA repair capacity . ^^^ Suppression of DNA repair by HTLV type 1 Tax correlates with Tax trans activation of proliferating cell nuclear antigen gene expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is one of the cell cycle related proteins directly involved in DNA synthesis . ^^^ Proliferating cell nuclear antigen ( PCNA ) is one of the cell cycle related proteins directly involved in DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It interacts like many other proteins involved in DNA metabolic events with proliferating cell nuclear antigen ( PCNA ) , and its enzymatic activity is stimulated by PCNA in vitro . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cellular proteins directly involved in DNA replication , such as PCNA , have long been known to accumulate in cells expressing Rep tomato golden mosaic geminivirus . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA connects DNA replication to epigenetic inheritance in yeast . ^^^ Here we show that mutations in the proliferating cell nuclear antigen ( PCNA ) , an essential component at the DNA replication fork , reduced repression of genes near a telomere and at the silent mating typelocus , HMR . ^^^ Thus , PCNA participates in inheritance of both DNA and epigenetic chromatin structures during the S phase of the cell cycle , the latter by at least two mechanisms . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Recovery from adenovirus infection was marked by elevation of sorbitol dehydrogenase , a marker for hepatocyte necrosis , as well as an 8 to 10 fold increase in expression of proliferating cell nuclear antigen , a marker for DNA synthesis , indicating significant hepatocyte turnover . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The human MutY homolog ( hMYH ) is a DNA glycosylase involved in the removal of adenines or 2 hydroxyadenines misincorporated with template guanines or 7 , 8 dihydro 8 oxodeoxyguanines . hMYH is associated in vivo with apurinic / apyrimidinic endonuclease ( APE 1 ) , proliferating cell nuclear antigen ( PCNA ) , and replication protein A ( RPA ) in HeLa nuclear extracts as shown by immunoprecipitation and Western blotting . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The products of proliferating cell nuclear antigen ( PCNA ) and flap endonuclease ( FEN 1 ) genes are multifunctional proteins that are involved in DNA replication and damage repair . ^^^ Our results suggest that the coding regions of the PCNA and FEN 1 genes are highly conserved when compared with other DNA repair genes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Knockout animals lacked detectable NF kappaB DNA binding activity in isolated epithelial cells and had significantly longer crypts with a more extensive proliferative zone than their wild type counterparts ( as determined by proliferating cell nuclear antigen staining and in vivo bromodeoxyuridine labeling ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) is a highly conserved protein required for the assembly of the DNA polymerase delta ( pol delta ) holoenzyme . ^^^ These PCNA variants were tested for stimulation of pol delta and in vitro replication of M 13 and SV 40 DNA as well as to stimulate the ATPase activity of replication factor C ( RF C ) . ^^^ PCNA mutants and hybrids that stimulated pol delta and RF C were deficient in M 13 and SV 40 DNA replication assays , indicating that PCNA induced pol delta stimulation and RF C mediated loading are not sufficient for coordinated DNA synthesis at a replication fork . . ^^^ Human Saccharomyces cerevisiae proliferating cell nuclear antigen hybrids : oligomeric structure and functional characterization using in vitro DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The present study was designed to determine the spatial correlation among extent of DNA synthetic activity , expressions of G ( 1 ) / S phase cyclins , cyclin dependent kinases ( CDKs ) and CIP / KIP family of CDK inhibitors ( CKIs ) , and activities of G ( 1 ) / S phase CDKs in glomeruli and outer medullae of kidneys during the active regeneration period after ischemic injury . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Morphometric features were compared with tumor histological grade , size , nodal status , DNA ploidy evaluated by flow cytometry and cell proliferative activity assessed by the quantity of argyrophilic nucleolar organizer region associated proteins ( AgNORs ) , monoclonal antibody ( MAb ) PC 10 against proliferating cell nuclear antigen and MAb MIB 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the absence of processivity factors ( PCNA , RF C , and ATP ) , pol delta elongated primers on single stranded DNA templates in a distributive manner . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In steady state reactions with the accessory protein proliferating cell nuclear antigen ( PCNA ) , pol delta preferred to incorporate dCTP opposite 8 oxoG with an efficiency of incorporation an order of magnitude lower than incorporation into unmodified DNA ( mainly due to an increased K ( m ) ) . ^^^ The presence of PCNA was found to be a more essential factor for nucleotide incorporation opposite 8 oxoG adducts than unmodified DNA , increased pre steady state rates of nucleotide incorporation by > 2 orders of magnitude , and was essential for nucleotide extension beyond 8 oxoG . pol delta replication fidelity at 8 oxoG depends upon contributions from K ( m ) , K ( d ) ( dNTP ) , and rates of phosphodiester bond formation , and PCNA is an important accessory protein for incorporation and extension at 8 oxoG adducts . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin dependent kinase ( CDK ) activating kinase ( CAK ) is involved in cell cycle control , transcription , and DNA repair ( E . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Western blot analyses show that the expression of Rb , a key regulatory protein in G1 / S transition , and PCNA , integrally involved in mammalian cell DNA replication , were significantly reduced by treatment with YZ in PC 3 and DU 145 cells , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
However , the degree of lymphatic dissection and the patterns of biological markers ( DNA ploidy , p 53 staining and PCNA labeling ) were not different . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Mitogenic stimulation causes activation of cyclin dependent kinases ( cdk ) that phosphorylate both pRb and p 130 , thereby releasing E2F factors which stimulate the transcription of a number of genes that are required for DNA synthesis and for regulating the cell cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The main tumorogenic mechanisms currently proposed are a DNA rearrangement in the PTH locus ( transposition of the PTH promoter upstream to Cyclin D1 / PRAD 1 gene ) and a mutation of the gene responsible for multiple endocrine neoplasia type 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results suggest that p 53 and p 21 do not have special roles in the S and G 2 phase checkpoints and that CDK 2 : cyclin A could be the target of the G 2 phase DNA damage checkpoint . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The eukaryotic DNA sliding clamp that keeps DNA polymerase engaged at a replication fork , called proliferating cell nuclear antigen ( PCNA ) , is loaded onto the 3 ' ends of primer DNA through its interaction with a heteropentameric protein complex called replication factor C ( RFC ) . ^^^ We further observe that PCNA is held between the two fingers of RFC and propose that the RFC structure change we observe during ATP hydrolysis causes the attached PCNA to form its active ring like clamp on DNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
VCAM 1 ligation activated extracellular signal regulated kinase 2 and resulted in increased expression of cyclin D 1 , yet there was neither p 27 ( kip 1 ) degradation nor an increase in smooth muscle cell DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Thus , it can be hypothesized that continued exposure to environmental carcinogens ( ie , longstanding history of smoking and drinking ) , loss of proper cell cycle control ( eg , inactivation of p 53 or p 16 tumor suppressor genes or amplification of the proto oncongene cyclin D 1 ) , and impaired DNA repair capacity ( both inherited and acquired ) are prerequisites in head and neck carcinogenesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Increases occurred in oxidative stress responsive genes HO 1 , QR , HSP 70 , GADD 45 , GADD 153 , p 21 ( WAF1 / CIP16 ) , GST ' s , GAPDH , TPX , and GPX 1 ( 0 ) ; transcriptional regulators c jun , c fos , jun B , c myc , and IkappaB ; protein repair components Rdelta , RC 10 2 , C 3 , RC 7 , HR6B ubiquitin conjugating enzyme and ubiquitin ; DNA repair components PCNA , msh 2 , and O 6 methylguanine DNA methyltransferase ; lipid peroxide excision enzyme PLA 2 ; and apoptogenic components TNFalpha , iNOS 1 and FasL . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Viral cyclin cyclin dependent kinase 6 complexes initiate nuclear DNA replication . ^^^ Using mammalian in vitro replication systems , we show that viral cyclin cdk 6 complexes can directly trigger the initiation of DNA synthesis in isolated late G ( 1 ) phase nuclei . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Previous work has shown that cyclin A can be cleaved at Arg 70 / Arg 71 by a proteolytic activity present in an in vitro coupled transcription / translation system by using rabbit reticulocyte lysate programmed by plasmid DNA encoding p 27 ( KIP 1 ) , a cyclin dependent kinase inhibitor , but not by plasmid DNAs encoding other cyclin dependent kinases inhibitors . ^^^ Here we report that cyclin A is also cleaved by translation product programmed by plasmid DNA encoding cyclin B . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is an essential component of the DNA replication and repair machinery in the domain Eucarya . ^^^ Proliferating cell nuclear antigen ( PCNA ) is an essential component of the DNA replication and repair machinery in the domain Eucarya . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The expression of proliferating cell nuclear antigen ( PCNA ) , a DNA polymerase delta auxiliary protein , in spermatogonia was weak in G 1 , highest during DNA synthesis ( S ) , decreased in G 2 and was not detectable in dividing cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RESULTS : PCNA LI , DNA index and S + G 2 ratio were all higher in chronic gastritis than in the normal epithelium , and were further increased in carcinoma . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The post MBT survival mechanism arrests cells in G ( 1 ) phase by increasing expression of the cyclin dependent kinase inhibitor p 27 ( Xic 1 ) . p 27 ( Xic 1 ) associates with cyclin D / Cdk4 and cyclin A / Cdk2 complexes to cause G ( 1 ) / S arrest , perhaps allowing more time for DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Two other TATA less promoters , cyclin D 3 and DNA polymerase alpha , were also found to be repressed by Tax . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cells arrested by loss of Sda 1 function have a 1N DNA content , fail to produce the G 1 cyclin Cln 2 , and remain responsive to mating pheromone , indicating that they arrest in G 1 before Start . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The SE injected eggs showed degradation of cyclin B 1 and DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Double immunostaining for NP 95 and chromatin bound PCNA , a marker of DNA replication sites , revealed that NP 95 was almost exclusively colocalized with chromatin bound PCNA throughout the nucleus in early S phase and partly in mid S phase . ^^^ Chromatin bound PCNA was observed as a pre DNA replication complex at the G1 / S boundary synchronized by hydroxyurea treatment , while NP 95 was detected in nucleolar regions as unique large foci . ^^^ Taken together , our results indicate that NP 95 is assigned to a late growth regulated gene and suggest that NP 95 does not take a direct part in DNA replication as part of the DNA synthesizing machinery , like PCNA , but is presumably involved in other DNA replication linked nuclear events . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Treatment with a combination of HGF and EGF , in comparison with that of either HGF or EGF , induced tyrosine phosphorylation of both c Met and EGF receptor ( EGFR ) independently and additively stimulated MAPK activity and cyclin D 1 expression , resulting in additive stimulation of DNA synthesis . ^^^ On the other hand , although TGF beta 1 treatment did not affect tyrosine phosphorylation of c Met and EGFR , MAPK activity , and cyclin D 1 expression , which were stimulated by HGF and EGF , DNA synthesis was completely inhibited through a marked decrease in cyclin E expression . ^^^ These results indicate that potent mitogens , such as HGF , TGF alpha , and HB EGF , could induce the additive enhancement of liver regeneration cooperatively through an increase in Ras / MAPK activity followed by cyclin D 1 expression , and that TGF beta 1 suppresses the growth factor induced signals between cyclin D 1 and cyclin E , resulting in the inhibition of DNA synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA damage leads to a Cyclin A dependent delay in metaphase anaphase transition in the Drosophila gastrula . ^^^ CONCLUSIONS : DNA damage delays metaphase anaphase transition in Drosophila by stabilizing Cyclin A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PD 98059 ( 10 microM ) , the specific inhibitor of MAPK kinase , completely blocked TPA stimulated cyclin D 1 induction and DNA synthesis , confirming that MAPK activation plays an essential role in TPA stimulated cell cycle progression . ^^^ However , corresponding to a rapid loss of cyclin D 1 protein , vanadate treatment resulted in a significant shut out of 3H thymidine incorporation into DNA regardless of TPA cotreatment . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : The following parameters were calculated in the ventral prostatic lobe of normal rats and rats that received cadmium in drinking water during 18 months : total volume , epithelial volume , total number of epithelial cells , numerical density of epithelial cells , percentage of cells that immunostained to the proliferating cell nuclear antigen ( PCNA ) , percentage of apoptotic cells ( evaluated by a DNA fragmentation method ) , and absolute volume and volume fraction of immunostaining to bcl 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Both PCNA and beta form a ring around DNA , which is made up of two subunits of three domains each in beta but three subunits of two domains each in PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Targeting of PCNA to sites of DNA replication in the mammalian cell nucleus . ^^^ We have examined the targeting of proliferating cell nuclear antigen ( PCNA ) , an integral component of the mammalian replicative enzyme DNA polymerase delta , with sites of DNA replication by using confocal microscopy and computer image analysis . ^^^ Labeling ( 5 min pulse ) of DNA replication sites in normal human diploid fibroblast cells ( NHF 1 ) with BrdU was followed by immunostaining with PCNA antibodies . ^^^ A striking degree of colocalization was seen between PCNA and the characteristic patterns of DNA replication sites of early , middle and late S phase ( Nakayasu and Berezney [ 1989 ] J . ^^^ These observations were confirmed by quantitative computer image analysis which revealed that approximately 90 % of the PCNA stained area overlapped with DNA replication sites in early S phase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These data support our view that the progression in G 1 phase stimulated by cAMP consists of at least two essential actions that are clearly dissociated : in a first stage , depending on the supportive activity of an agent that stimulates the required cyclin D 3 accumulation , cAMP induces the assembly and nuclear translocation of cyclin D 3 cdk4 complexes , and then cAMP can exert alone the last crucial control that determines the cell commitment toward DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Indeed , like p 53 , p 73 as well ( 1 ) can bind mdmX , mdm 2 , p300 / CAF and adenovirus E 4 orf6 proteins , ( 2 ) can trigger several promoters including p 21 , bax , mdm 2 , gadd 45 , cyclin G , IGFBP 3 , 14 3 3 sigma , ( 3 ) is able to trigger cell death , ( 4 ) is involved in the DNA damage response , although through a different pathway . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
But , the MEK 1 inhibitor , PD 98059 ( 50microM ) , inhibits cFos and cyclin D 1 induction and DNA synthesis stimulation by both ACTH 39 and FGF 2 , suggesting that ERK1 / 2 activation mediates the strong and the weak mitogenic effect of , respectively , FGF 2 and ACTH 39 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Operative specimens of three patients who underwent surgery for a paraganglioma of the nasal cavity ( one case ) or paranasal sinuses ( two cases ) were investigated by routine histology , quantitative DNA analysis , and immunohistochemical assessment of proliferation markers ( i . e . , Proliferating Cell Nuclear Antigen , PCNA ; Ki 67 MIB 1 ) , the expression of cell surface antigens , which reflect the tumor stroma interaction ( i . e . , CD 44 v0 . 4 / 5 and 6 , CD 54 , CD 106 ) , oncogene products ( nm 23 ; p 53 ) , and bcl 2 as a marker of apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
MAIN OUTCOME MEASURES : Cell number , expression of proliferating cell nuclear antigen , and DNA damage after one , four or seven days of treatment . ^^^ CONCLUSION : Cell growth , proliferating cell nuclear antigen expression and DNA damage are dependent on oestrogen or fetal calf serum , but independent of gonadotrophin releasing hormone agonist or progesterone . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
FISH demonstrated increasing DNA copy of numbers of c erbB 2 , 20q13 . 2 ( AIB ) , c myc and cyclin D 1 during the development of Barrett ' s adenocarcinoma , and LOH confirmed DNA losses on 5q21 ( APC ) and 18q ( DCC ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The antibodies against cyclin B 1 and MAD 2 indeed attenuated paclitaxel induced cytotoxicity and DNA fragmentation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
There was an increase in both DNA synthesis and proliferating cell nuclear antigen levels in the adult transgenic hearts . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The human cytomegalovirus immediate early 2 protein dissociates cellular DNA synthesis from cyclin dependent kinase activation . ^^^ Then these cells fail to undergo substantial DNA replication although they have entered S phase , and the induction of DNA replication observed after overexpression of cyclin E or D can be antagonized by IE 2 without impinging on cyclin associated kinase activities . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Thus , when AT ( 1 ) receptors are stimulated in vivo , DNA synthesis is enhanced in blood vessels by activation of cyclin D 1 and cdk 4 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
MSH MLH complexes formed at a DNA mismatch are disrupted by the PCNA sliding clamp . ^^^ In support of this idea , we found that the replication processivity factor proliferating cell nuclear antigen ( PCNA ) , which plays a critical role in MMR at step ( s ) prior to DNA resynthesis , disrupted preformed ternary complexes . ^^^ These observations , in conjunction with experiments performed with streptavidin end blocked mismatch substrates , suggested that PCNA interacts with an MSH MLH complex formed on DNA mispairs . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Chromatin bound PCNA complex formation triggered by DNA damage occurs independent of the ATM gene product in human cells . ^^^ Proliferating cell nuclear antigen ( PCNA ) , a processivity factor for DNA polymerases delta and epsilon , is involved in DNA replication as well as in diverse DNA repair pathways . ^^^ In quiescent cells , UV light induced bulky DNA damage triggers the transition of PCNA from a soluble to an insoluble chromatin bound form , which is intimately associated with the repair synthesis by polymerases delta and epsilon . ^^^ In this study , we investigated the efficiency of PCNA complex formation in response to ionizing radiation induced DNA strand breaks in normal and radiation sensitive Ataxia telangiectasia ( AT ) cells by immunofluorescence and western blot techniques . ^^^ We also analyzed the PCNA complex induced by a radiomimetic agent , Bleomycin ( BLM ) , which produces predominantly single and double strand DNA breaks . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Insulin treatment for 24 h produced mitogenesis , as demonstrated by the increase in ( ( 3 ) H ) thymidine incorporation , DNA content , the expression of PCNA and cyclin D 1 proteins , and the proportion of cells in S + G2 / M phases of the cell cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the attempt to elucidate whether this compound might affect genes playing a role in G1 / S phase transition , the expressions of p 53 , p 21 ( WAF 1 ) , cyclin D 1 and Rb , mainly involved in response to DNA damaging stress , were analyzed by Western blot . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Recent studies support a model in which CAF 1 can be targeted to newly synthesized DNA through a direct interaction with proliferating cell nuclear antigen ( PCNA ) and can act synergistically with a newly identified histone chaperone . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The mechanism of suberoylanilide hydroxamic acid in cell growth inhibition involved induction of pRb 2 / p130 interaction and nuclear translocation with E2F 4 , followed by significant repression in E2F 1 and PCNA nuclear levels , which led to inhibition in DNA synthesis in mammary epithelial cell lines . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In germinal arrest , there is a significantly lowered PCNA PI , which is an indication of DNA synthesis deterioration , suggesting the use of therapies be different from those for hypospermatogenesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA complexes in turn reacted with murine anti DNA mAbs , as well as with Abs against p 21 , replication protein A , DNA helicase 2 , cyclin dependent kinases 4 and 5 , and topoisomerase 1 . ^^^ These findings suggest that the PCNA complexes purified using anti PCNA mAbs comprise the `` protein machinery ' ' for DNA replication and cell cycle regulation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin E uses Cdc 6 as a chromatin associated receptor required for DNA replication . ^^^ In the first phase , the origin recognition complex and Cdc 6 prereplication proteins , but not the minichromosome maintenance complex , are necessary and biochemically sufficient for ATP dependent binding of cyclin E Cdk 2 to DNA . ^^^ Thus , the cyclin E Cdc 6 interaction that localizes the Cdk 2 complex to chromatin is important for DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 and E2F 1 immunoreactivity in bone marrow biopsy specimens of multiple myeloma : relationship to proliferative activity , cytogenetic abnormalities and DNA ploidy . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Deletion analysis of the cyclin D 2 promoter revealed that removal of sequences containing E box c myc consensus DNA binding sequences did not reduce EBNA 2 mediated activation of the cyclin D 2 promoter in the transient transfection assay . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) is now recognized as one of the key proteins in DNA metabolic events because of its direct interactions with many proteins involved in important cellular processes . ^^^ Crystal structure of an archaeal DNA sliding clamp : proliferating cell nuclear antigen from Pyrococcus furiosus . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Epidermal growth factor ( EGF ) or hepatocyte growth factor ( HGF ) stimulated increase of cyclin D 1 protein after 12 hours and increased DNA content after 3 days in culture . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here , we show that enhanced binding of proteins involved in DNA replication ( PCNA , RPA , and cyclin A ) , with the nuclear matrix , correlates with lethality of S phase cells following heat shock under four different experimental conditions . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Transcription coactivator p 300 binds PCNA and may have a role in DNA repair synthesis . ^^^ Here we show that p 300 may have a role in DNA repair synthesis through its interaction with proliferating cell nuclear antigen ( PCNA ) . ^^^ Furthermore , the endogenous p 300 PCNA complex stimulates DNA synthesis in vitro . ^^^ Our results suggest that p 300 may participate in chromatin remodelling at DNA lesion sites to facilitate PCNA function in DNA repair synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PATIENTS AND METHOD : Tissue samples from 48 patients with cholesteatomas were analyzed by : routine histology , quantitative DNA cytometry with the DNA indices : 2cDeviation Index ( 2cDI ) and 5c Exceeding Rate ( 5c ER ) , immunhistochemical analysis of proliferation rate ( ki 67 MIB1 and PCNA ) , cell adhesion molecules , cell cell interaction : E Cadherin , alpha 1 beta 6 Integrin , Inter Cellular Adhesion Molecule ( 1 CAM ) , cell matrix interaction : CD44v4 / 5 , CD 44v6 , alpha 5 , beta 3 Integrinchains and vascular Cell Adhesion Molecule ( 5 CAM ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We postulate that PCNA plays a role in repair initiation by guiding the mismatch repair proteins to free termini in the newly replicated DNA strands . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factor C ( RFC ) and proliferating cell nuclear antigen ( PCNA ) are accessory proteins essential for processive DNA synthesis in the domain Eucarya . ^^^ The function of RFC is to load PCNA , a processivity factor of eukaryotic DNA polymerases delta and epsilon , onto primed DNA templates . ^^^ Highly purified RFCS possesses an ATPase activity , which was stimulated up to twofold in the presence of both single stranded DNA ( ssDNA ) and P . furiosus PCNA ( PfuPCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin dependent kinase 2 ( Cdk 2 ) is essential for initiation of DNA synthesis in higher eukaryotes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) has recently been identified as a target for the binding of proteins involved in DNA replication , DNA repair , and cell cycle control . ^^^ This sequence was found to be present on DNA polymerase delta , and a peptide conforming to this sequence was demonstrated to bind to PCNA . ^^^ Proliferating cell nuclear antigen ( PCNA ) has recently been identified as a target for the binding of proteins involved in DNA replication , DNA repair , and cell cycle control . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Genomic DNA was extracted from laser microdissected lesional tissue and a duplex , quantitative PCR assay was used to determine the amplification of the cyclin D 1 gene relative to interferon gamma . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The recruitment of cyclin A points to a role for this cell cycle factor in MVM DNA replication beyond its involvement in activating the conversion of virion single stranded DNA to the duplex replicative form . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Either DNA copy number loss or cyclin D 1 overexpression was present in 13 ( 81 % ) of the 16 adenomas . ^^^ We conclude that DNA copy number loss and cyclin D 1 overexpression are common in parathyroid adenomas . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The early increase in cyclin D 1 expression was associated with accelerated onset of DNA synthesis , as demonstrated by a 20 fold increase of bromodeoxyuridine positive hepatocytes at 12 h after T 3 treatment and by a 20 fold increase in mitotic activity at 18 h . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA replication and centrosome duplication have to be strictly synchronized to guarantee genomic stability . p 53 , pRb , cyclin E , and cyclin A are reported to be involved in the synchronizing process . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The effect on various aspects of DNA replication can be analyzed after the readdition of PCNA and other purified proteins . ^^^ Using this system , we have shown that replication of single stranded M 13 DNA is entirely dependent upon PCNA . ^^^ By adding exogenous T 7 DNA polymerase to PCNA depleted extracts , we have uncoupled processive DNA replication from PCNA activity and so created an experimental system to analyze the dependence of postreplicative processes on PCNA function . ^^^ However , systems for analyzing the far more complex mechanisms required for the replication of nuclear double stranded DNA have proved so far to be refractory to specific PCNA depletion . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Consistent with these data , incorporation of [ ( 3 ) H ] thymidine or BrdUrd into DNA was significantly inhibited , as was cyclin dependent kinase 2 activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In order to evaluate the roles both of cell proliferation and programmed cell death ( PCD ) in WD induced tumorigenesis , immunohistochemical detection of proliferating nuclear antigen ( PCNA ) , in situ end labeling ( TUNEL ) of DNA breaks , and p 53 protein were carried out in mouse colonic mucosa during prolonged feeding of two WDs . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The best explored link between NF kappaB activation and cell cycle progression involves cyclin D ( 1 ) , a cyclin which is expressed relatively early in the cell cycle and which is crucial to commitment to DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is an essential protein in both DNA replication and DNA damage repair . ^^^ Proliferating cell nuclear antigen ( PCNA ) is an essential protein in both DNA replication and DNA damage repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the G 2 phase checkpoint arrest initiated in response to various forms of DNA damage , the cdc 25 dependent activation of both cyclin A / cdk2 and cyclin B1 / cdc2 is blocked . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cell cycle arrest induced by r hu IFNgamma seems to depend on cyclin regulation through p 21 ( WAF1 / CIP1 ) and p 27 ( Kip 1 ) independent mechanisms and is not directly related to the induced DNA damage . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The second injection of CDDP induced significant increases in the number of p 21 , p 53 , and PCNA positive nuclei within 2 d but did not affect the incorporation of BRDU : These findings suggested that ( 1 ) CDDP induced two peaks of the increase in p 21 ; ( 2 ) the first peak occurred shortly after CDDP and was accompanied by overexpression of p 53 and PCNA but not with BrdU incorporation , possibly reflecting G 1 arrest and DNA repair ; ( 3 ) the second peak of p 21 occurred through an p 53 independent pathway and may contribute to cell differentiation ; and ( 4 ) the overexpression of p 21 and PCNA in rechallenge injury may contribute to acquired resistance in CDDP induced ARF via enhanced DNA repair . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , an auxiliary factor for DNA polymerase delta and epsilon , is involved in both DNA replication and repair . ^^^ Induction of repair patches in NER deficient XP A cells suggests that the 10 ray induced lesions are largely repaired via the BER pathway involving PCNA as one of the key components of this pathway . 10 ray induced repair synthesis was greatly inhibited by treatment of cells with DNA polymerase inhibitors aphidicolin and cytosine arabinoside . ^^^ Proliferating cell nuclear antigen ( PCNA ) , an auxiliary factor for DNA polymerase delta and epsilon , is involved in both DNA replication and repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
An essential eukaryotic DNA polymerase , DNA polymerase delta ( pol delta ) , synthesizes DNA processively in the presence of proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To determine whether cell cycle regulation or alteration plays a role in oncogenesis and cytodifferentiation of odontogenic epithelium , cell cycle related factors , including cyclin D 1 , p16INK4a , p 21 ( WAF1 / Cip1 ) and p27Kip1 proteins , DNA topoisomerase IIalpha and histone H 3 mRNA , were examined in 8 tooth germs and 31 ameloblastomas . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study we found that HDL acts as a potent and specific mitogen in vascular smooth muscle cells ( VSMC ) by stimulating entry into S phase and DNA synthesis in a time and concentration dependent manner , induction of cyclins D 1 , E , and A , as well as activation of cyclin D dependent kinases as inferred from phosphorylation of the retinoblastoma protein ( pRb ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
WRN has been shown to bind to and / or functionally interact with other proteins , including replication protein A ( RPA ) , proliferating cell nuclear antigen ( PCNA ) , DNA topoisomerase 1 , Ku 86 / 70 , DNA polymerase delta and p 53 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Fibroblast nuclei showing PCNA staining identified those fibroblasts that were capable of synthesizing DNA and contributing to pressure ulcer repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
However , activation of RB in S phase cells disrupts the chromatin tethering of PCNA , a requisite component of the DNA replication machinery . ^^^ The action of RB was S phase specific and did not inhibit the DNA damage mediated association of PCNA with chromatin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
As we reported previously ( Li et al , Cancer Res 1998 ; 58 : 4282 4287 ) , that increase led to the decreased expression of proliferating cell nuclear antigen ( PCNA ) and to the loss of proliferation associated DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Inhibitory effect of octreotide ( a somatostatin analogue ) was observed on proliferation of in vitro cultured TT cells and confirmed by evaluating levels of PCNA and Ki 67 proliferation associated antigens and examining the extent of DNA damage using the comet assay . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Activating transcription factor 3 induces DNA synthesis and expression of cyclin D 1 in hepatocytes . ^^^ Furthermore , DNA binding studies demonstrate that ATF 3 binds directly to the AP 1 site within the cyclin D 1 promoter . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Flow cytometric DNA analysis , and immunohistochemical p 53 , PCNA and histopathologic study in primary achalasia : preliminary results . ^^^ METHODOLOGY : We studied DNA ploidy by flow cytometry and p 53 and PCNA index by immunohistochemical technique and studied histopathology in the esophageal mucosa of primary achalasia and control patients . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Olomoucine , a specific inhibitor of cyclin dependent kinases , did not affect DNA fragmentation in the target cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Since efficient initiation of viral DNA replication requires cyclin E and cdk 2 , its inhibition accounts for heterogeneous viral activities in productively infected lesions . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the current study , by the use of antibodies against prekinetochores and DNA polymerase ( a PCNA antigen ) , we showed that in murine L 929 cells chromocentres remain spatially associated with prekinetochores during the entire interphase , including the late S period , when DNA chromocentres replicate . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA ploidy and cyclin D 1 expression in basal cell carcinoma of the head and neck . ^^^ To identify prognostic factors useful for planning therapy , we studied cyclin D 1 immunohistochemical expression , DNA ploidy , and epiluminescence light microscopic ( ELM ) patterns in 60 cases of BCC ( 30 BCC 1 and 30 BCC 2 ) in the head and neck region , half of which were hyperpigmented . ^^^ The analysis of cyclin D 1 expression and DNA ploidy may help identify BCC with an aggressive phenotype and a poor clinical outcome . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis was measured as [ 3H ] thymidine uptake , and cyclin D 1 and E levels were determined by Western analysis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Transgene expression was assessed by reverse transcription polymerase chain reaction ( RT PCR ) , hepatocyte proliferation was assessed by bromodeoxyuridine incorporation and RT PCR for proliferating cell nuclear antigen , and apoptosis was assessed by in situ nick end labeling of DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The role of different biomarkers ( DNA , PCNA , apoptosis and karyotype ) in prognostic evaluation of superficial transitional cell bladder carcinoma . ^^^ BACKGROUND : In order to clarify the variable behaviour of transitional cell bladder carcinomas ( TCBC ) with same clinico pathologic pattern , we investigated the prognostic significance of various biomarkers ( PCNA , DNA , apoptosis , karyotype ) . ^^^ Analysis of biological indicators was performed on serial paraffin sections : DNA by static cytometry , karyotype by fluorescence in situ hybridisation ( FISH ) , PCNA and apoptosis by immunohistochemistry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A is essential for regulating key transitions in the eukaryotic cell cycle including initiation of DNA replication and mitosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Earlier studies showed that TGMV induces the accumulation of proliferating cell nuclear antigen ( PCNA ) , the processivity factor for DNA polymerase delta , in mature cells of Nicotiana benthamiana . ^^^ Developmental studies established a strong relationship between symptom severity , viral DNA accumulation , PCNA promoter activity , and endogenous PCNA mRNA levels . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Deletion of either HIR 1 or ASF 1 eliminated telomeric gene silencing in combination with pol 30 8 , encoding an altered form of the DNA polymerase processivity factor PCNA that prevents CAF 1 from contributing to silencing . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis was investigated using the antibody to proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We analyzed a series of Hurthle cell neoplasms of the thyroid to evaluate the diagnostic and prognostic utility of numerical anomalies by DNA fluorescent probes for cyclin D 1 and p 53 gene loci and chromosomes 5 , 7 , 11 , 12 , 17 , and 22 . ^^^ Directly labeled fluorescent DNA probes for the centromere region of chromosomes 7 , 11 , 12 , and 17 and locus specific probes for chromosomes 5 and 22 , cyclin D 1 , and p 53 were utilized for dual probe hybridizations . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Analysis of MC proliferation [ proliferating cell nuclear antigen ( PCNA ) positivity ] and apoptosis ( in situ end labeling of DNA ) showed these cells to be terminally differentiated . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Both sterols caused a similar reduction in DNA content and proliferating cell nuclear antigen protein expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Since cyclin dependent kinase 2 ( CDK 2 ) / cyclin E triggers DNA synthesis as well as centrosome duplication , we tested whether Waf 1 , a CDK inhibitor and a major target of p 53 ' s transactivation function , is an effector of p 53 mediated regulation of centrosome duplication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin G 1 is involved in G2 / M arrest in response to DNA damage and in growth control after damage recovery . ^^^ Cyclin G 1 is one of the target genes of the transcription factor p 53 , and is induced in a p 53 dependent manner in response to DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Inhibition of cyclin A / Cdk2 phosphorylation impairs B Myb transactivation function without affecting interactions with DNA or the CBP coactivator . ^^^ Although transactivation by B Myb was severely dependent on hyperphosphorylation , neither inhibiting this activity by co transfecting Cdk2DN nor augmenting it with cyclin A resulted in significant effects on DNA binding . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Growth arrest and DNA damage inducible protein 45alpha ( GADD45alpha ) is an important cell cycle checkpoint protein that arrests cells at G2 / M phase by inhibiting the activity of G 2 specific kinase , cyclin B / p34cdc2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Eukaryotic replication factor C is the heteropentameric complex that loads the replication clamp proliferating cell nuclear antigen ( PCNA ) onto primed DNA . ^^^ Interactions of yeast RFC with PCNA and DNA were studied by surface plasmon resonance . ^^^ However , when RFC and PCNA together were flowed across the DNA chip in the presence of ATP , a signal was observed suggesting loading of PCNA by RFC . ^^^ ATP mediated interaction with DNA and with proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
However , when either PCNA or primer template DNA were also present 2 . 6 or 2 . 7 ATPgammaS molecules , respectively , were bound . ^^^ When both PCNA and DNA were present 3 . 6 ATPgammaS molecules were bound per RFC . ^^^ Order of addition experiments using surface plasmon resonance indicate that RFC forms an ATP mediated binary complex with PCNA prior to formation of a ternary DNA . ^^^ An ATP mediated complex between RFC and DNA was not competent for binding PCNA , and the RFC . ^^^ Multiple stepwise ATP binding events are required to load proliferating cell nuclear antigen onto primed DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we show that etoposide , an anticancer drug that induces double strand breaks , triggers the redistribution of DNA ligase 1 and proliferating cell nuclear antigen from replicative patterns and the ensuing dephosphorylation of DNA ligase 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Co localization of chicken DNA topoisomerase IIalpha , but not beta , with sites of DNA replication and possible involvement of a C terminal region of alpha through its binding to PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In order to evaluate biological and genetic properties of early breast carcinomas we analyzed microdissected tissue from 33 primary breast carcinomas stage T1b and T1c with respect to the nuclear DNA content , the expression pattern of Ki 67 , cyclin A , p27KIP1 , p 53 and p21WAF1 , and chromosomal gains and losses . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These include PCNA , a processivity clamp for some DNA polymerases , Trf4 / Pol final sigma ( formerly Trf4 / Pol kappa ) , a novel and essential DNA polymerase , and a modified Replication Factor C clamp loader complex . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Further studies have shown that the eukaryotic clamp , PCNA , interacts with several other proteins that are involved in excision repair , mismatch repair , cellular regulation , and DNA processing , indicating a much wider role than replication alone . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Deletion of the CDK interacting domain of Cdc 6 does not inhibit the function of origins of DNA replication during S phase , but instead causes a delay in mitotic exit ; this delay is accentuated in the absence of Sic 1 or of cyclin degradation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It is shown here that overexpression of highly active cyclin E and cdk 2 in myotubes induces phosphorylation of pRb but can not reactivate DNA synthesis , underscoring the tightness of cell cycle control in postmitotic cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Akt dependent phosphorylation of p 21 ( Cip 1 ) at Thr 145 prevents the complex formation of p 21 ( Cip 1 ) with PCNA , which inhibits DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This cell cycle dependent repression correlates with the periodic binding of an atypical G ( 1 ) specific high molecular weight p 107 E2F complex ( Cyclin E Repressor Complex : CERC 2 ) that differs in both size and DNA binding behaviors from known p 107 E2F complexes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Although the RFC complex consists of RFCS and RFCL in vivo , RFCS alone , together with PCNA , substantially enhanced the DNA synthesizing activity of P . furiosus DNA polymerase 1 in vitro . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To further determine the role of Akt in PDGF induced DNA synthesis , we investigated its effect on cyclin dependent kinase 2 ( CDK 2 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Clonal S lines , with BTEB 1 mRNA and protein levels higher than in corresponding parent ( N ) and As lines , displayed enhanced DNA synthesis upon 3 [ H ] thymidine incorporation , in serum containing but not in serum free medium , and increased cell cycle kinetics , concomitant with the induction in expression of the genes for the cell cycle associated components cyclin D 1 , PCNA , cyclin dependent kinase ( Cdk ) inhibitor p 21 , and Cdk 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Interaction between human flap endonuclease 1 ( hFEN 1 ) and proliferating cell nuclear antigen ( PCNA ) represents a good model for interactions between multiple functional proteins involved in DNA metabolic pathways . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A molecular beacon strategy for the thermodynamic characterization of triplex DNA : triplex formation at the promoter region of cyclin D 1 . ^^^ We studied the formation of triplex DNA in the purine pyrimidine rich promoter site sequence of cyclin D 1 , located at 116 to 99 from the transcription initiation site , with a molecular beacon comprised of a G rich 18 mer triplex forming oligodeoxyribonucleotide . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To ensure proper timing of the G 1 S transition in the cell cycle , the cyclin E Cdk 2 complex , which is responsible for the initiation of DNA replication , is restrained by the p 21 ( Cip 1 ) / p27 ( Kip 1 ) / p57 ( Kip 2 ) family of CDK ( cyclin dependent kinase ) inhibitors in humans and by the related p 27 ( Xic 1 ) protein in Xenopus . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The Mre 11 complex colocalized with PCNA at replication forks throughout S phase , both prior to and coincident with the appearance of nascent DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In super shift experiments we found that DNA oligomers covering the area of this SNP formed a complex with proteins amongst which we identified the proliferating cell nuclear antigen ( PCNA ) protein . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression of DNA mismatch repair proteins hMSH 2 and hMLH 1 and the cyclin G 1 inhibitor , p 21 ( waf1 / cip1 ) in pediatric tumors : correlation with response to therapy . ^^^ The expression of the DNA mismatch repair proteins hMSH 2 and hMLH 1 and p 21 ( waf 1 ) the cyclin G 1 inhibitor , may determine response of adult cancers to anti cancer drugs , that include alkylating agents and platinum based drugs . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A Cdk 2 physically interacts with pol prim and phosphorylates N terminal amino acids of the p 180 and the p 68 subunits , leading to an inhibition of pol prim in initiating cell free SV 40 DNA replication . ^^^ In contrast to wild type pol prim these mutants were no longer inhibited by Cyclin A Cdk 2 in the initiation of viral DNA replication . ^^^ Together these results suggest that Cyclin A Cdk 2 executes both stimulatory and inhibitory effects on the activity of pol prim in initiating DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A CDK 2 phosphorylated MEF protein in vitro more efficiently than cyclin D CDK 4 or cyclin E CDK 2 , and phosphorylation of MEF by cyclin A CDK 2 reduced its ability to bind DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Dna damage induced G ( 1 ) arrest in hematopoietic cells is overridden following phosphatidylinositol 3 kinase dependent activation of cyclin dependent kinase 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
E2F independent activation of histone H 4 gene expression combines contributions of several promoter factors , including HiNF M / IRF2 and the HiNF D / CDP cut complex which contains pRB , CDK 1 , and cyclin A as non DNA binding subunits . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The dimeric ring shaped sliding clamp of E . coli DNA polymerase 3 ( beta subunit , homolog of eukaryotic PCNA ) is loaded onto DNA by the clamp loader gamma complex ( homolog of eukaryotic Replication Factor C , RFC ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The gamma complex , an AAA+ ATPase , is the bacterial homolog of eukaryotic replication factor C ( RFC ) that loads the sliding clamp ( beta , homologous to PCNA ) onto DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The following biological parameters were analysed in the tumour tissue using flow cytometry : DNA ploidy , proportion of S phase cells , BrdU labelling index ( LI ) , DNA synthesis time ( T ( s ) ) , potential tumour doubling time ( T ( pot ) ) , proliferating cell nuclear antigen ( PCNA ) and Ki 67 LI . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These parameters comprised DNA cytometric examinations , histological grading of the tumor front and immunohistochemical staining for proliferation markers ( MIB 1 , PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In eukaryotic DNA replication , proliferating cell nuclear antigen ( PCNA ) works in clamping DNA polymerases on the DNA template and accomplishes a processive DNA synthesis . ^^^ Archaea encode PCNA homologues in their genomes and Pyrococcus furiosus PCNA ( PfuPCNA ) stimulates the DNA synthesizing activities of the DNA polymerases , Pol 1 and Pol 2 , in this organism . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Ras adenoviruses modulate cyclin E protein expression and DNA synthesis after partial hepatectomy . ^^^ These mechanisms result in an earlier activation of an active CDK2 / Cyclin E complex which , in turn , triggers DNA synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Interaction with PCNA is essential for yeast DNA polymerase eta function . ^^^ Thus , in addition to having a pivotal role in the targeting of Poleta to the replication machinery stalled at DNA lesions , interaction with PCNA would promote the bypass of certain DNA lesions . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We quantitatively evaluate the changes of the proliferative cell populations in the adult tench retinas maintained at 6 degrees C and 20 degrees C by both PCNA antigen detection and flow cytometry based DNA measurements . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In higher eukaryotes , base excision repair can proceed by two alternative pathways : a DNA polymerase beta dependent pathway and a proliferating cell nuclear antigen ( PCNA ) dependent pathway . ^^^ Recently , we have reconstituted the PCNA dependent AP site repair reaction with six purified human proteins : AP endonuclease , replication factor C ( RFC ) , PCNA , flap endonuclease 1 ( FEN 1 ) , DNA polymerase delta ( pol delta ) , and DNA ligase 1 . ^^^ PCNA can directly interact with RFC , pol delta , FEN 1 and DNA ligase 1 . ^^^ PCNA functions as a molecular adaptor for recruiting these factors to the site of DNA repair . ^^^ Two DNA N glycosylases among those so far cloned from human , UNG 2 and MYH , are found to have the same PCNA binding motif . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA ligase 1 interacts directly with proliferating cell nuclear antigen ( PCNA ) and DNA polymerase beta ( Pol beta ) , linking this enzyme with both short patch and long patch BER . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To preserve genomic beta DNA from common endogenous and exogenous base and sugar damage , cells are provided with multiple base excision repair ( BER ) pathways : the DNA polymerase ( Pol ) beta dependent single nucleotide BER and the long patch ( 2 10 nt ) BER that requires PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
After treatment with bleomycin , non S phase cells also displayed heterogeneous nuclear foci containing tightly bound proliferating cell nuclear antigen ( PCNA ) , suggesting an ongoing process of unscheduled DNA synthesis . ^^^ PCNA is known to be involved in base excision repair , but a fraction of the PCNA foci may also be associated with DNA synthesis occurring during the repair of DSBs . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
TdT interacts with PCNA in its DNA polymerization domain ( DPD ) , but not in its BRCA 1 C terminal ( BRCT ) domain . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Three cell lines , ACHN , RCC10RGB and OS RC 2 , were incubated with IFN alpha and evaluated using MTT assay for cell proliferation and two color flow cytometry for cell cycle specific cyclin expressions coupled with DNA ploidy analysis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We found that expression of wild type p 21 ( p 21 ( WT ) ) , not mutant p 21 ( p 21 ( PCNA ) ) lacking the interaction with proliferating cell nuclear antigen ( PCNA ) , caused G ( 2 ) cell cycle arrest in p 53 deficient DLD 1 colon cancer cell line after the DNA damage by treatment with cis diamminedichloroplatinum ( 2 ) . ^^^ Involvement of the interaction between p 21 and proliferating cell nuclear antigen for the maintenance of G2 / M arrest after DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In these cases , the expression of proliferating cell nuclear antigen ( PCNA ) and the presence of argyrophilic nucleolar organizer regions ( AgNOR ) , as well as DNA ploidy , were examined . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Consistent with a role for cyclin A 2 in regulating the G1 / S transition , 3 ' dA also inhibits DNA replication in treated one cell embryos . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using DNA flow cytometry and immunohistochemical staining techniques we determined the DNA content and the level of co expression of seven tumor associated proteins : proliferating cellular nuclear antigen ( PCNA ) , epidermal growth factor receptor ( EGFr ) , p 53 , c erbB 2 , H ras , c myc , and nm 23 . ^^^ In conclusion , this study demonstrates that the DNA content and genetic markers c myc , c erbB 2 , EGFr , H ras , p 53 , PCNA , and nm 23 do not predict survival after potentially curative resection of hepatic metastases from CRC . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The recent discovery of DNA polymerase Y family ( DinB / UmuC / RAD30 / REV1 superfamily ) raises a question of whether the DNA polymerase activities are modified by accessory proteins such as proliferating cell nuclear antigen ( PCNA ) . ^^^ Here , we report the activity of Sso DNA pol Y 1 encoded by the dbh gene of the archaeon Sulfolobus solfataricus is greatly enhanced by the presence of PCNA and replication factor C ( RFC ) . ^^^ Synthetic activity of Sso DNA polymerase Y 1 , an archaeal DinB like DNA polymerase , is stimulated by processivity factors proliferating cell nuclear antigen and replication factor C . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we report that in the course of searching for a putative cognate partner for cdc 2 that may have replaced cyclins A and B , we noted that the DNA polymerase processivity factor encoded by the U ( L ) 42 gene contains a degenerate cyclin box and has been reported to be structurally related to proliferating cell nuclear antigen , which also binds cdk 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Phosphorylation of the CCAAT displacement protein ( CDP ) / Cux transcription factor by cyclin A Cdk 1 modulates its DNA binding activity in G ( 2 ) . ^^^ Accordingly , cyclin A Cdk 1 was found to bind to CDP / Cux and modulate its DNA binding activity in vitro and in vivo . ^^^ In cotransfection studies , cyclin A Cdk 1 inhibited CDP / Cux stable DNA binding and prevented repression of the p 21 ( WAF 1 ) reporter . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Chk 1 and Cds1 / Chk2 are effector kinases in the G ( 2 ) phase checkpoint activated by damaged or unreplicated DNA , and they prevent entry into M phase through inhibition of cyclin B Cdc 2 kinase activation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A tumor necrosis factor alpha and interleukin 6 inducible protein that interacts with the small subunit of DNA polymerase delta and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , we found that DNA binding activity of NF Y transcription factor , which is essential for transcription of the cdk 1 and cyclin B genes and inactivated in senescent fibroblast , is significantly decreased by expression of either of p 53 , p 63 , or p 73 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Inactivation of the retinoblastoma ( Rb ) protein caused by gene mutation , association with oncoproteins from small DNA viruses , mutational inactivation of p 16 ( Ink4a ) , or overexpression of cyclin D is a common feature of many human cancer cells and is causally associated with the aberrant proliferation control of cancer cells ; whereas normal cells maintain an integrated cell cycle machinery and are subject to cell cycle checkpoint control by cyclin dependent kinase ( CDK ) inhibitors ( CKIs ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Mediation of proliferating cell nuclear antigen ( PCNA ) dependent DNA replication through a conserved p 21 ( Cip 1 ) like PCNA binding motif present in the third subunit of human DNA polymerase delta . ^^^ The subunit that mediates binding of proliferating cell nuclear antigen ( PCNA ) to human DNA polymerase delta has not been clearly defined . ^^^ We show that the third subunit of human DNA polymerase delta , p 66 , interacts with PCNA through a canonical PCNA binding sequence located in its C terminus . ^^^ Conversely , p 66 interacts with the domain interconnecting loop of PCNA , a region previously shown to be important for DNA polymerase delta activity and for binding of the cell cycle inhibitor p 21 ( Cip 1 ) . ^^^ In accordance with this , a peptide containing the PCNA binding domain of p 21 ( Cip 1 ) inhibited p 66 binding to PCNA and the activity of native three subunit DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the present study , we used a modified DNA binding site selection and PCR amplification procedure to identify DNA binding proteins that are potential substrates of cyclin A CDK . ^^^ Cells overexpressing cyclin A have elevated levels of Sp 1 DNA binding activity , suggesting that cyclin A CDK mediated phosphorylation augments Sp 1 DNA binding properties . ^^^ Mutation of the phosphorylation site abrogated cyclin A CDK dependent phosphorylation , augmentation of Sp 1 transactivation function and DNA binding activity . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression by recombinant adenovirus of E2F1 , E2F2 , E2F3 , cyclin E / cdk2 , and Mdm 2 individually resulted in DNA synthesis in 10 30 % of cells . ^^^ However , combination of Mdm 2 with E2F or cyclin E / cdk2 resulted in 50 to 75 % of cells synthesizing DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The p 21 regulatory protein can bind proliferating cell nuclear antigen ( PCNA ) and prohibit DNA replication . ^^^ We show here that p 21 also inhibits PCNA stimulation of long patch base excision repair ( BER ) in vitro . p 21 disrupts PCNA directed stimulation of flap endonuclease 1 ( FEN 1 ) , DNA ligase 1 , and DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
If PCNA protein is present in abundance in the cell in the absence of p 53 , DNA replication occurs . ^^^ On the other hand , if PCNA protein levels are high in the cell in the presence of p 53 , DNA repair takes place . ^^^ The evolution from prokaryotes to eukaryotes involved a change of function of PCNA from a ' simple ' sliding clamp protein of the DNA polymerase complex to an executive molecule controlling critical cellular decision pathways . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Previous studies have shown that UV induced binding of p 21 ( WAF 1 ) to PCNA through the PCNA interacting protein ( PIP ) domain in p 21 ( WAF 1 ) promotes a switch from DNA replication to DNA repair by altering the PCNA protein complex . ^^^ UV rapidly induces p 33 ( ING1b ) to bind PCNA competitively through this domain , a motif also found in DNA ligase , the DNA repair associated FEN 1 and XPG exo / endonucleases , and DNA methyltransferase . ^^^ These data indicate that ING 1 competitively binds PCNA through a site used by growth regulatory and DNA damage proteins , and may contribute to regulating the switch from DNA replication to DNA repair by altering the composition of the PCNA protein complex . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The oligomeric `` sliding clamp ' ' processivity factors , such as PCNA , are thought to rely on a loose , topological association with DNA to slide freely along dsDNA . ^^^ Unlike PCNA , the processivity subunit of the herpes simplex virus DNA polymerase , UL 42 , is a monomer and has an intrinsic affinity for dsDNA that is remarkably high for a sequence independent DNA binding protein . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These data confirm the hypothesis of a p 53 independent p 21 ( waf ) induction and suggest a functional role in the inhibition of PCNA mediated DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Taken together , these findings suggest that FEN 1 plays an essential role in the DNA repair processes in mammalian cells and that this activity of FEN 1 is PCNA dependent . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The Ddc1 / Rad17 / Mec3 complex and Rad 24 are DNA damage checkpoint components with limited homology to replication factors PCNA and RF C , respectively , suggesting that these factors promote checkpoint activation by `` sensing ' ' DNA damage directly . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Sequencing genomic DNA and cDNA corresponding to P 1 P6 region showed that differences in COOH terminal residues were not due to either DNA mutations or errors in transcription , suggesting a high error rate in translation of cyclin B 1 protein in tumors . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
MAIN OUTCOME MEASURE ( S ) : The expression of proliferating cell nuclear antigen ( PCNA ) of spermatogonia and the frequency of apoptosis of spermatogonia demonstrated by the in situ DNA 3 ' end labeling method were investigated to determine the degree of cell degeneration . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA content and PCNA immunoreactivity in oral precancerous and cancerous lesions . ^^^ Thirty three dysplastic lesions showing varying degrees of atypia located in the oral cavity and 83 squamous cell carcinomas located in the oral cavity and tongue ( n = 56 ) or in the lips ( n = 27 ) were analysed by means of proliferating cell nuclear antigen ( PCNA ) immunoreactivity and image cytometric DNA measurements . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These chosen dCSTs include among others cyclins D and E , two cyclin dependent kinases , two other kinases , transcription factors E2F4 , E2F5 , and p 130 , a DNA repair gene , a gene for the signalosome subunit , and potential guanine nucleotide binding factors . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Since prior work has shown that gamma irradiation induces cyclin D 1 expression we investigated the induction of MCT 1 to DNA damaging agents . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Pre NAC biopsy and operative specimens were subjected to counting of apoptotic ( AI / V ) and mitotic ( MI / V ) indices , detection of human papillomavirus ( HPV ) DNA , and immunohistochemical analysis of cell cycle and proliferation markers ( p 21 , p 53 , pRb , proliferating cell nuclear antigen [ PCNA ] , Ki 67 ) and multidrug resistance gene ( MDR 1 ) , as related to NAC response ( RAC ) , recurrence free ( RFS ) , and overall ( OS ) survival . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A nucleotide excision repair protein , proliferating cell nuclear antigen , was recruited to the sites of DNA damage within 30 min after ultraviolet exposure . ^^^ The level of proliferating cell nuclear antigen varied with DNA repair activity and diminished within 24 h . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Recombinant DNA polymerase delta efficiently replicated singly primed M 13 DNA in the presence of replication protein A , proliferating cell nuclear antigen , and replication factor C and was active in the SV 40 DNA replication system . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The aim of this study was to analyse whether DNA ploidy correlates with proliferative activity as measured by PCNA expression , presence of oncogenic human papillomaviruses ( HPVs ) , histological grade , expression of antiapoptotic protein Bcl 2 and clinical outcome in a cohort of 57 preneoplastic and neoplastic lesions of the uterine cervix . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Viral cyclin / cdk6 complexes interact with and phosphorylate human Orc 1 , a component of the origin recognition complex ( ORC ) that functions in DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Clb 2 mitotic cyclin inhibits cell cycle progression by preventing mitotic exit and DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Induction of cyclin E and inhibition of DNA synthesis by the novel acronycine derivative S 23906 1 precede the irreversible arrest of tumor cells in S phase leading to apoptosis . ^^^ Similar inhibition of BrdU incorporation and elevation of cyclin E protein were observed after treatment with cytosine arabinoside , which reversibly inhibited progression into S phase , but not after DNA damage induced by cisplatin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The CK gated SPF and the PCNA labeling index of an individual tumor had a good correlation ( P < 0 . 0001 ) , and this agreed with the result showing that DNA diploid and aneuploid tumors had equal proliferative activity ( P = 0 . 64 and P = 0 . 63 , respectively ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Y boxes are located on the promoter of numerous genes , such as DNA topoisomerase IIalpha ( Topo IIalpha ) , proliferating cell nuclear antigen ( PCNA ) and multidrug resistance 1 ( MDR 1 ) . ^^^ Expression of Y box binding protein 1 correlates with DNA topoisomerase IIalpha and proliferating cell nuclear antigen expression in lung cancer . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Combined analysis of the expression of cell cycle related proteins , proliferation marker Ki 67 and proliferating cell nuclear antigen ( PCNA ) versus DNA content were used to determine the amount of proliferating cells in each phase , engaged in cell cycle transit . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) reduced the template dissociation rate of pol delta , thus increasing the processivity of both synthesis and strand displacement , whereas replication protein A ( RP A ) limited the size of the displaced fragment down to 20 30 nucleotides , by generating a `` locked ' ' flap DNA structure , which was a substrate for processing of the displaced fragment by Fen 1 into a ligatable product . ^^^ Our data support a model for Okazaki fragment processing where the strand displacement activity of DNA polymerase delta is modulated by the concerted action of PCNA , RP A and Fen 1 . . ^^^ Okazaki fragment processing : modulation of the strand displacement activity of DNA polymerase delta by the concerted action of replication protein A , proliferating cell nuclear antigen , and flap endonuclease 1 . ^^^ Proliferating cell nuclear antigen ( PCNA ) reduced the template dissociation rate of pol delta , thus increasing the processivity of both synthesis and strand displacement , whereas replication protein A ( RP A ) limited the size of the displaced fragment down to 20 30 nucleotides , by generating a `` locked ' ' flap DNA structure , which was a substrate for processing of the displaced fragment by Fen 1 into a ligatable product . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Targeting of human DNA polymerase iota to the replication machinery via interaction with PCNA . ^^^ Here , we provide evidence for the physical interaction of hPoliota with proliferating cell nuclear antigen ( PCNA ) , and show that PCNA , together with replication factor C ( RFC ) and replication protein A ( RPA ) , stimulates the DNA synthetic activity of hPoliota . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA damage invokes mismatch repair dependent cyclin D 1 attenuation and retinoblastoma signaling pathways to inhibit CDK 2 . ^^^ In both Rb+ / + and Rb / cells , cyclin D 1 expression was attenuated following DNA damage . ^^^ As cyclin D 1 is a critical determinant of RB phosphorylation and cell cycle progression , we probed the pathway through which cyclin D 1 degradation occurs in response to DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In order to evaluate at the ultrastructural level the three dimensional arrangement of the dispersed chromatin during the intephase , the immunogold detection of Bromodeoxyuridine ( BrdU ) , of the DNA polymerase alpha and of the proliferating cell nuclear antigen ( PCNA ) was performed on human HL 60 leukemia cells and nuclear matrices extracted from the same cellular model . ^^^ The single or multiple combined immunolocalization of different structures involved in the DNA replication , where BrdU , DNA polymerase alpha and PCNA represent , respectively , the substratum , the polymerizing enzyme and a regulator of the reaction , allowed the understanding of its reciprocal spatial relationship on the dispersed interphasic chromatin and the role of the nuclear matrix in the replicative process . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Most K 8 null hepatocytes were positive for the proliferating cell nuclear antigen ( PCNA ) with a doubled DNA content in comparison with the predominantly PCNA negative wild type hepatocytes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA replication and mitosis are dependent on the activity of cyclin dependent protein kinase ( CDK ) enzymes , which are heterodimers of a catalytic subunit with a cyclin subunit . ^^^ Cyclin accumulation is particularly important in terminating the G 1 phase , when it raises CDK activity and starts events leading to DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Novel function of the cyclin A binding site of E2F in regulating p 53 induced apoptosis in response to DNA damage . ^^^ We demonstrate here that the E2F1 induced by DNA damage can bind to and promote the apoptotic function of p 53 via the cyclin A binding site of E2F1 . ^^^ However , in response to DNA damage , cyclin A levels decrease , with a concomitant increase in E2F1 p 53 complex formation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
When the subcellular localization of human pol epsilon was examined by indirect immunofluorescence , pol epsilon appeared in discrete nuclear foci that colocalized with proliferating cell nuclear antigen ( PCNA ) foci and sites of DNA synthesis only late in S phase . ^^^ It is hypothesized from these observations that pol epsilon and PCNA have separate but associated functions early in S phase and that pol epsilon participates with PCNA in DNA replication late in S phase . . ^^^ Human DNA polymerase epsilon colocalizes with proliferating cell nuclear antigen and DNA replication late , but not early , in S phase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A was induced during the first peak of DNA synthesis 4 hr earlier among CR mice , and it continued 4 hr longer in AL mice , indicating an earlier post replicative exit by hepatocytes in CR mice . p 21 was induced during the G 1 phase at 4 hr post PH , and was maximally expressed during and after peak DNA synthesis in both dietary groups . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Twenty four mediastinal teratomas ( 18 mature and 6 immature ) were examined for apoptosis by 3 ' end labeling of DNA and stained immunohistochemically for proliferating cell nuclear antigen , Bcl 2 , Bax , p 53 protein , and alpha fetoprotein ( AFP ) expression in formalin fixed , paraffin embedded specimens . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
G ( 0 / 1 ) doublets were identified and quantitated using fluorescence height versus area and fluorescence width versus area pulse measurements , by enumerating the proportion of G ( 2 ) + M cells that lack cyclin B 1 immunoreactivity , and modeled in the DNA histograms by software algorithms . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
CCK ( B ) / gastrin receptor mediates synergistic stimulation of DNA synthesis and cyclin D 1 , D 3 , and E expression in Swiss 3T3 cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We used INK4A / ARF / mice as well as cyclin D 1 and p 16 ( INK4A ) transgenic strains to examine the physiological significance of these patterns . p 16 ( INK4A ) directly regulated the in vivo transition from E2F3 to E2F4 as the major E2F DNA binding activity , and its contribution to growth arrest was independent of cyclin D 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In fact , both UV induced DNA incision and the recruitment of proliferating cell nuclear antigen ( PCNA ) to DNA repair sites occurred to a comparable extent in p 53 wild type and mutant cell lines , although PCNA remained associated with chromatin for a longer period of time in IGROV 1 / Pt1 cells . ^^^ UV induced DNA incision and proliferating cell nuclear antigen recruitment to repair sites occur independently of p 53 replication protein A interaction in p 53 wild type and mutant ovarian carcinoma cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA , Bcl 2 protein and Fas antigen expression were examined by the avidin / biotin immunoperoxidase method , while apoptosis was assessed by in situ DNA 3 ' end labeling method . ^^^ Both PCNA expression and apoptotic DNA fragmentation were noted in cytotrophoblasts ( C cells ) , being most abundant in very early placenta , less abundant in midterm placenta and least abundant in term placenta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) and Ki 67 in epithelial ovarian tumours : correlation with DNA flow cytometric analysis . ^^^ AIMS : The aim of the present retrospective study was to evaluate the prognostic significance of Ki 67 and Proliferating cell nuclear antigen ( PCNA ) immunostaining and DNA content measured by flow cytometry ( FCM ) in epithelial ovarian tumours . ^^^ CONCLUSION : There was no significant correlation between DNA ploidy , SPFs derived from FCM analysis , and proliferative activity , determined by PCNA and Ki 67 and the known histopathologic parameters of prognostic significance in ovarian epithelial malignancies . . ^^^ Proliferating cell nuclear antigen ( PCNA ) and Ki 67 in epithelial ovarian tumours : correlation with DNA flow cytometric analysis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the accumulated regions , PCNA labeled cells undergoing DNA synthesis were also detected . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Resistance to UV induced cell killing in nucleophosmin / B23 over expressed NIH 3T3 fibroblasts : enhancement of DNA repair and up regulation of PCNA in association with nucleophosmin / B23 over expression . ^^^ Furthermore , PCNA , an essential component for DNA repair machinery , was correlated with nucleophosmin / B23 expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 was used as a model TCF target gene for analysis of beta catenin TCF 4 DNA binding and trans activation . ^^^ Cyclin D 1 promoter analysis revealed that indomethacin disrupted formation of a beta catenin TCF 4 DNA complex . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
BTP pre treatment also decreased downstream effects of Akt activation including phosphorylation of glycerol synthase kinase 3 , increased cyclin D 1 protein levels and increased DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
AKT / PKB phosphorylation of p21Cip / WAF1 enhances protein stability of p21Cip / WAF1 and promotes cell survival . p 21 ( Cip1 / WAF1 ) ( p 21 ) , a p 53 inducible protein , is a critical regulator of cell cycle and cell survival . p 21 binds to and inhibits both the DNA synthesis regulator proliferating cell nuclear antigen and cyclin A / E CDK 2 complexes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Identification and characterization of a proliferating cell nuclear antigen consensus interaction domain on Pol2p indicates that the motif is dispensable for DNA replication but is important for methyl methanesulfonate damage induced DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In a screen for silencing impaired cac 1 alleles , we isolated a mutation that reduced binding to the Cac3p subunit and another that impaired binding to the DNA replication protein PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
For detection of the chromosomal aberrations , we used FISH on interphase nuclei with commercially available centromere specific probes for chromosomes 1 , 7 , 9 , 11 , 15 , and 17 and further DNA probes for 5p13 , 5q31 , Rb gene ( 13q14 ) , cyclin D 1 gene ( 11q13 ) , and p 53 gene ( 17p13 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the present study , we expanded our investigations to examine the effect of cisplatin induced ERK activation on the expression of p 53 targeted genes that have been shown to be important in the cellular response to DNA damage including Bax , Bcl 2 , Bcl x 1 , Cyclin G , Gadd 45 , p21WAF1 , and Mdm 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our results indicate that nucleophosmin / B23 correlates with PCNA and DNA repair capacity in cellular sensitivity to UV . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Proliferating cell nuclear antigen ( PCNA ) immunohistochemistry in 60 cases and cellular nuclear DNA contents cytometry in 40 cases were used to compare the epithelial cell kinetics of the odontogenic keratocyst , radicular cyst , dentigerous cyst , and ameloblastoma . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Apoptotic index was significantly higher and proliferating cell nuclear antigen labeling index was relatively lower in an ovarian cancer xenograft without p 53 gene receiving combination treatment , compared with a single treatment of either CDDP or AxCAp 53 , suggesting that the transduction of p 53 gene induces apoptosis , but does not enhance the DNA repair system . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Preliminary data indicate that the expression level of the DNA repair cofactor , proliferating cell nuclear antigen ( PCNA ) , is up to 13 fold greater in the HD resistant cell line G 361 compared to the HD sensitive SVK 14 cell line . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
MATERIALS AND METHODS : CDKN1A , PCNA , DNA PK , hMre 11 and Rad 50 were investigated for their subnuclear localization after irradiation with heavy ions using immunocytochemical staining and confocal laser scanning microscopy . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cell cycle analysis by cyclin E + A / DNA multiparameter flow cytometry in exponential growth MOLT 4 cells . ^^^ RESULTS : We developed a cyclin E + A / DNA flow cytometry analysis method , which may distinguish G 0 , early G 1 , late G 1 , S , G 2 and M phase cells , rather than three phases in the DNA content histogram . ^^^ CONCLUSION : Cyclin E + A / DNA multiparameter flow cytometry can simultaneously differentiate in the same sample six cell groups : G 0 , early G 1 , late G 1 , S , G 2 and M phase cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The primary purpose of the present study was to investigate whether DNA replication at meiotic prophase also requires replication factors , especially proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Stimulation of DNA synthesis activity of human DNA polymerase kappa by PCNA . ^^^ Here , we provide evidence for the physical interaction of human Polkappa ( hPolkappa ) with proliferating cell nuclear antigen ( PCNA ) and show that PCNA , replication factor C ( RFC ) , and replication protein A ( RPA ) act cooperatively to stimulate the DNA synthesis activity of hPolkappa . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Characterization of myocardial hypertrophy by DNA content , PCNA expression and apoptotic index . ^^^ The present study aims to analyze proliferating cell nuclear antigen ( PCNA ) expression , DNA content and apoptosis , in several types of myocardial hypertrophy in order to define the biological characteristics of this process . ^^^ RESULTS : The analyzed biomarkers were similar in hypertension and in remodeling , with a very high apoptotic index ( mean values : 8 . 1 and 8 . 5 % , respectively ) , a low PCNA positivity ( mean values : 1 . 8 and 1 . 6 % ) and a prevalent diploid DNA content ( DNA index : 1 . 2 ) . ^^^ Conversely , HCM showed a high mean PCNA index ( 21 . 2 % ) associated with a prevalence of hyperdiploid myocytes ( DNA index : 1 . 8 ) and a low number of apoptotic cells ( mean value : 1 . 7 % ) . ^^^ Therefore , the combined evaluation of DNA content , PCNA and apoptotic indices could provide a powerful diagnostic tool in doubtful cases of myocardial primary or secondary hypertrophy and open new avenues in the clinical treatment of these entities . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is an essential component in the eukaryotic DNA replication machinery , in which it works for tethering DNA polymerases on the DNA template to accomplish processive DNA synthesis . ^^^ The PCNA also interacts with many other proteins in important cellular processes , including cell cycle control , DNA repair , and an apoptotic pathway in the domain EUCARYA : We identified three genes encoding PCNA like sequences in the genome of Aeropyrum pernix , a crenarchaeal archaeon . ^^^ All three PCNA homologs stimulated the primer extension activities of the two DNA polymerases , polymerase 1 ( Pol 1 ) and Pol 2 , identified in A . pernix to various extents , among which A . pernix PCNA 3 ( ApePCNA 3 ) provided a most remarkable effect on both Pol 1 and Pol 2 . ^^^ In Eucarya , three checkpoint proteins , Hus 1 , Rad 1 , and Rad 9 , have been proposed to form a PCNA like ring structure and may work as a sliding clamp for the translesion DNA polymerases . ^^^ Three proliferating cell nuclear antigen like proteins found in the hyperthermophilic archaeon Aeropyrum pernix : interactions with the two DNA polymerases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Finally , software compensation was used to compare the relative levels of PCNA and p 53 expression in two clinical ovarian cancer ascites specimens , stained for PCNA or p 53 ( FITC ) , keratin 8 / 18 ( RPE ) , and DNA ( PI ) , with a known p 53 status ( positive and negative , respectively ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Subsequent activation of cyclin E / CDK2 , hyperphosphorylation of pRb , and DNA synthesis are only induced by mitogenic concentrations of IGF 1 ( > or =20 ng / ml ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , cyclin E does not need to be degraded or dissociated from the chromosomes during mitosis ; instead , it may be required on chromosomes during mitosis to immediately initiate the next round of DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The PCNA binding domain was determined , and a hybrid DNA polymerase was constructed by grafting this domain onto the classical PCR enzyme from Thermus aquaticus , Taq DNA polymerase . ^^^ Addition of PCNA to PCR reactions catalyzed by the fusion protein greatly stimulated product generation , most likely by tethering the enzyme to DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cdc 6 synergizes with physiological levels of cyclin E / Cdk2 to induce semiconservative DNA replication in quiescent cells whereas cyclin A / Cdk2 is unable to collaborate with Cdc 6 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Loss of the p 21 ( Cip1 / Waf1 ) cyclin kinase inhibitor results in propagation of horizontally transferred DNA . ^^^ Here we show that mouse embryonic fibroblast cells lacking the p 21 ( Cip1 / Waf1 ) cyclin kinase inhibitor are able to propagate DNA engulfed by phagocytosis of apoptotic bodies . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHOD : 87 cases of superficial transitional cell bladder cancer were analysed for the expression of apoptosis and PCNA by using the 3 end labeling method of DNA and immunohistochemical staining in tissue sections . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These were : a dramatic arrest at the G2 / M phase indicated by a marked increase in both the number of G2 / M cells and the expression of cyclin B 1 , cdc 2 , and mitotic phosphoprotein monoclonal 2 ( MPM 2 ) reactive proteins ; a severe apoptosis shown by a marked increase in the number of cells with hypo diploid DNA and DNA fragmentation ; and as a result , a severe inhibition of cell growth and proliferation measured by the MTT test and [ ( 3 ) H ] thymidine uptake assay . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In order to understand the possible mechanisms by which MY and MG enhance tumor development , in this study we have tested the effects of MY and MG on DNA synthesis and PCNA expression in preneoplastic hepatic lesions during N nitrosodiethylamine ( DEN ) induced hepatocarcinogenesis in male Wistar ( WR ) rats . ^^^ The effects of MY and MG were monitored on the basis of cell proliferation markers DNA synthesis and PCNA expression both by immunohistochemical and immunoblotting . ^^^ Following DEN administration , MY , MG and PB showed stimulation of DNA synthesis and increased PCNA expression when compared with either the corresponding controls or only DEN treated animals . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The expression of cyclin D 1 and DNA synthesis were inhibited along with G 1 cell cycle block , causing decreased cell density and growth . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cells were cultured with TNF alpha and harvested at 24 , 48 and 72 hr to examine cyclin expression and DNA content . ^^^ Because cyclin B is mitotic , results suggest that Jurkat cells undergo apoptosis at G 2 , while J1 . 1 cells enter mitosis and then die by apoptosis , as no changes in cyclin B or DNA content at G2M were observed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we show that positively charged lysine residues in the B domain of pRB are necessary for the release of pRB from E2F on DNA following phosphorylation by cyclin E cdk 2 kinase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Transcription of the CLN 3 G ( 1 ) cyclin in Saccharomyces cerevisiae is positively regulated by glucose in a process that involves a set of DNA elements with the sequence AAGAAAAA ( A ( 2 ) GA ( 5 ) ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this first ever study , we investigated the role of nine prognostic markers ' expression ( estrogen receptor [ ER ] , progesterone receptor [ PR ] , p 53 , C erbB 2 , epidermal growth factor receptor [ EGFR ] , cathepsin D [ CD ] , proliferating cell nuclear antigen [ PCNA ] , DNA ploidy , and S phase fraction [ SPF ] ) and disease outcome in IBC cases compared with the control group . ^^^ The expression of nine prognostic markers , that is , ER , PR , p 53 , C erbB 2 , EGFR , CD , PCNA , SPF , and DNA ploidy , was studied by immunohistochemistry and flow cytometry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The lesions were examined histologically and immunohistochemically with anti single stranded DNA after acid hydrolysis ( DNA instability test ) , p 53 , VEGF , DFF 45 , PCNA and AgNORs parameters analyses . ^^^ The percentage of PCNA positive vascular endothelial cells was significantly higher in VEGF positive lesions with a positive DNA instability test and became higher toward the late stage of progression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Tissues were subjected to immunohistochemical staining for proliferating cell nuclear antigen ( PCNA ) , p 53 , DNA fragmentation factor 45 ( DFF 45 ) , analysis of various AgNORs parameters , and triple immunostaining for vascular endothelial growth factor ( VEGF ) , CD 34 , and PCNA . ^^^ The proportion of lesions positive for PCNA , p 53 , DFF 45 , and values of AgNORs parameters steadily increased from hyperplasia to mild , moderate and severe dysplasia , and SCC , especially in those showing positive DNA instability test , indicative of malignancy . ^^^ The proportion of PCNA positive vascular endothelial cells in the vicinity of VEGF positive epithelial lesion was significantly higher than that of negative DNA instability lesions , as revealed by immunohistochemical triple staining for VEGF , CD 34 , and PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The formation of distinct cyclin CDK complexes controls the progression through the first gap phase ( G ( 1 ) ) and initiation of DNA synthesis ( S phase ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factor C ( RFC ) is the accessory protein required to load the proliferating cell nuclear antigen ( PCNA ) onto DNA in replication process . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Wounds were examined by transmission electron microscopy , the detection of free 3 ' OH DNA ends and immunohistochemistry of proliferating cell nuclear antigen ( PCNA ) , inducible nitric oxide synthase ( iNOS ) , keratinocyte growth factor ( KGF ) and keratinocyte growth factor receptor ( KGFR ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The progesterone mediated decrease in DNA synthesis was associated with the upregulation of the cyclin dependent kinase inhibitor p 27 ( Kip 1 ) , whereas p 21 ( cip ) and proliferating cell nuclear antigen protein levels were unchanged . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Control of DNA replication and chromosome ploidy by geminin and cyclin A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RESULTS : A high expression of cyclin E enabled to promote the cell growth and DNA synthesis and accelerated the proceeding of G ( 1 ) phase to S phase , It also promoted the phosphorylatin of pRB and up regulate the expression of p 27 while a low expression of cyclin E showed an opposite effect . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The number of proliferating cell nuclear antigen ( PCNA ) positive cells was less in PLC / Cx26 in vitro than in control ( P = 0 . 0039 ) , and single stranded DNA ( ssDNA ) positive cells were more abundant in the colony of PLC / Cx26 ( P = 0 . 029 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , the lack of IGF IR in brown adipocytes resulted in a higher mitogenic response ( DNA synthesis , cell number , and proliferating cell nuclear antigen expression ) to insulin than wild type cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
CONCLUSION : The application of rhGH in burn patients could improve the serum concentration of GH and IFG 1 , promote DNA synthesis and PCNA and EFGR expression of epithelium , so that re epithelialization of the burn wound could be accelerated . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The changes in intestinal mucosal DNA content and intestinal mucosal proliferating cell nuclear antigen labeling index ( PCNALI ) were determined on the 1st , 3rd , 6th and 9th postburn days ( PBDs ) respectively in rats . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Vascular cell single strand DNA ( ssDNA ) and proliferating cell nuclear antigen ( PCNA ) were assessed , and changes in gene and protein expression of smooth muscle alpha actin ( sm alpha actin ) , beta actin , and heme oxygenase 1 ( HO 1 ) were evaluated by Western analysis , RT PCR , and immunohistochemistry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Stimulation of rat aortic VSMCs with platelet derived growth factor ( PDGF ) BB ( 20 ng / mL ) , angiotensin 2 ( Ang 2 , 1 micromol / L ) , or 10 % fetal calf serum ( FCS ) for 48 hours increased DNA synthesis , as assessed by proliferating cell nuclear antigen ( PCNA ) immunoblotting . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In contrast , cyclin D degradation in response to DNA damage , a critical early mediator of growth arrest , was impaired in r VSMCs , an effect that required p 53 . ^^^ We also identify a restenosis VSMC specific defect in cyclin D degradation induced by DNA damage . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We suggest that newly synthesized DNA possessing discontinuities is restored to full size by a `` copy choice ' ' type of DNA synthesis which requires Rad 5 , a DNA dependent ATPase , and also PCNA and Poldelta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study the prognostic significance of DNA toposiomerase 2 alpha ( topoII ) and cyclin A immunohistochemistry was examined in a series of 263 meningiomas . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Fluorescence in situ hybridisation ( FISH ) was performed on paraffin sections with locus specific DNA probes for D7S486 , c myc , cyclin D 1 , Her 2 / neu , 20q13 . 2 and associated chromosomes 7 , 8 , 11 , 17 and 20 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Emerging evidence now indicates that replication fork components , such as PCNA , a novel DNA polymerase , Trf4p / Pol sigma ( formerly Trf4p / Pol kappa ) , and a modified clamp loader complex , actively participate in the process of the cohesion establishment . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our results demonstrate that Rho plays a fundamental role in promoting Ras dependent S phase entry in mammary epithelial cells , whether in response to normal or oncogenic signaling , and indicate that in cells expressing oncogenic Ras , the activation of Rho diminishes p 21 ( CIP 1 ) expression , increases cyclin D 1 promoter activity , and uncouples DNA synthesis from mitosis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The liver regeneration estimated by the rates of [ ( 3 ) H ] thymidine incorporation into DNA and staining of proliferating cell nuclear antigen was significantly lower in the cirrhotic rats than in the controls . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclins A and E and their partner cyclin dependent kinases ( Cdks ) are key regulators of DNA synthesis and of mitosis . ^^^ Immunofluorescence studies have shown that both cyclins are nuclear and that a proportion of cyclin A is localized to sites of DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The effect of roscovitine , a purine analogue and cyclin dependent kinase inhibitor , on DNA synthesis rate in tissue mini units obtained from human cervical cancers was investigated . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Additional factors with a possible function in eukaryotic MMR are PCNA , EXO 1 , and the DNA polymerases delta and epsilon . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Hybridizations with locus specific DNA probes demonstrated a high incidence of deletion for the tumour suppressor genes p 53 and retinoblastoma ( Rb ) , and for the oncogene cyclin D 1 , comparable in all carcinoma types . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Using cell culture and immunocytochemical techniques , we examined the cell growth , DNA synthesis , expression of PCNA , cyclin A , B ( 1 ) , D ( 1 ) , p 16 ( ink4a ) and p 21 ( cip / waf1 ) of SGC 7901 cells which were treated with various c 9 , t 11 CLA concentrations ( 25 , 50 , 100 and 200 micromol . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a sliding clamp that serves as a loading platform for many proteins involved in DNA replication and DNA repair . ^^^ Our results strengthen the role of PCNA as a factor coordinating DNA replication and epigenetic inheritance . . ^^^ Proliferating cell nuclear antigen associates with histone deacetylase activity , integrating DNA replication and chromatin modification . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a sliding clamp that serves as a loading platform for many proteins involved in DNA replication and DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) acts as a processivity factor for DNA polymerase delta , which is involved directly in DNA synthesis , and the PCNA level is correlated with the proliferative state of cells . p 21 ( WAF1 / CIP1 ) interacts with PCNA to inhibit DNA synthesis and plays a central role in regulating the cell cycle . ^^^ Proliferating cell nuclear antigen ( PCNA ) acts as a processivity factor for DNA polymerase delta , which is involved directly in DNA synthesis , and the PCNA level is correlated with the proliferative state of cells . p 21 ( WAF1 / CIP1 ) interacts with PCNA to inhibit DNA synthesis and plays a central role in regulating the cell cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
OBJECTIVE : To probe into the relationship between DNA content , PCNA and prognosis . ^^^ METHODS : Surgical margins in 34 patients with locally advanced laryngeal cancers were observed by means of antibody to PCNA and DNA content measurements . ^^^ RESULTS : The results demonstrated that at neoplasm margins of 1 . 0 , 0 . 5 , and 0 cm , PCNA indices were 8 . 62 % , 17 . 76 % and 50 . 32 % and DNA indices were 0 . 98 , 1 . 082 and 1 . 436 respectively . ^^^ DNA content , expression of proliferating cell nuclear antigen and surgical margins in locally advanced laryngeal cancer ] . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Moreover , the percentages of Skp 2 and S phase positive cells , as measured by DNA content or BrdU labeling , strictly matched and closely parallel that of Ki 67 and cyclin A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis was observed by using PCNA stain immunohistochemistry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
However , when purified yeast RPA and recombinant PCNA together were added to the polymerase fraction obtained from S phase synchronized cells , in vitro plasmid DNA replication was restored . ^^^ In vitro plasmid DNA replication with polymerase fractions from unsynchronized and G ( 1 ) phase cells could not be reconstituted upon addition of purified RPA and PCNA . ^^^ Results presented here demonstrate that both RPA and PCNA are cell cycle independent in their ability to stimulate in vitro plasmid DNA replication , whereas replication factors in the polymerase fractions are strictly S phase dependent . . ^^^ Cell cycle specific plasmid DNA replication in the nuclear extract of Saccharomyces cerevisiae : modulation by replication protein A and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : The second passage BLECs were cultured with different concentrations of bFGF ( 0 . 01 100 . 00 microgram / L ) for 24 96 hours , the DNA synthesis of BLEC was measured by ( 3 ) H TdR incorporation , and the expression of PCNA and the cell cycle were counted by the flow cytometer . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It has been evaluated by immunohistochemistry using proliferative markers ( PCNA , Ki 67 , etc . ) and by flow cytometry considering DNA content , growth fraction ( S + G2M ) and S phase fraction . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To assess the proliferative activity of renal cell carcinoma ( RCC A ) in patients with acquired cystic disease of the kidney ( ACDK ) after long term hemodialysis , we analyzed cell cycle , DNA ploidy , and S phase fraction by flow cytometry ( FCM ) and proliferating cell nuclear antigen ( PCNA ) labeling index by immunohistochemistry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To investigate the influence of cyclin D 1 genotypes on the genetic susceptibility in humans from Southern China to sporadic nasopharyngeal carcinoma , cyclin D 1 genotyping was performed by denaturing high performance liquid chromatography ( DHPLC ) and DNA sequencing analysis of the PCR products from 84 NPC cases and 91 normal controls . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Sections of tumors were made then stained separately for free 3 . hydroxyl ends of genomic deoxyribonucleic acid ( DNA ) using fluorescein deoxyunidine triphosphate ( dUTP ) , and immunohistochemically for proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , we studied the expression of proliferation markers , including proliferating cell nuclear antigen ( PCNA ) and the synthesis of DNA , by immunohistochemical and autoradiographic methods . ^^^ Normal or axotomized ganglion cells did not express PCNA and did not synthesize DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The eluted complex retains in vitro DNA synthetic activity , and by Western blot analysis , contains DNA polymerase delta , proliferating cell nuclear antigen , and replication protein A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating nuclear antigen ( PCNA ) plays an important role both in the process of replication and repair of DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
CONCLUSION : In the early carcinogenesis of esophageal epithelium , DNA content and heteroploidy rates increase with tumor suppressor gene p 16 deletion and p 53 protein accumulation while oncogene cyclin D 1 is overexpressed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin E is a critical cell cycle protein in the regulated progression of normal cells to replicate their DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In Ang 2 infused rats , vascular DNA synthesis ( by 3H thymidine incorporation ) ; expression of cell cycle proteins cyclin D 1 and cdk 4 , angiotensin 2 type 1 receptors , vascular cell adhesion molecule 1 , and platelet and endothelial cell adhesion molecule ; and nuclear factor kappaB activity were increased . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA may have contributed to the repair of DNA damage and to cell proliferation caused by exposure to these pollutants . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Finally , we present evidence indicating that p 33 ( ING1b ) affects the degree of physical association between proliferating cell nuclear antigen ( PCNA ) and p 300 , an association that has been proposed to link DNA repair to chromatin remodeling . ^^^ Together with the finding that human ING 1 proteins bind PCNA in a DNA damage dependent manner , these data suggest that ING 1 proteins provide a direct linkage between DNA repair , apoptosis , and chromatin remodeling via multiple HAT . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Upregulation of Cyclin E expression , accomplished through binding of Cubitus interruptus ( Ci ) to the Cyclin E promoter , mediates the ability of Hh to induce DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The roles in DNA replication of two distinct protein kinases , Cdc7p / Dbf4p and Cdk1p / Clb ( B type cyclin ) , were studied . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen and terminal deoxyuridine triphosphate nick end labeling ( TUNEL ) immunohistochemistry for detection of DNA synthesis and apoptosis , respectively , was performed 4 , 7 , or 10 days after SO or BDL . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Relative liver weight , DNA synthesis rate , and proliferating cell nuclear antigen labeling index were determined at the time of hepatectomy ( day 0 ) and on days 1 , 3 , and 7 after hepatectomy . ^^^ Both the DNA synthesis rate and proliferating cell nuclear antigen labeling index in the ED group ( 77 + / 36 disintegrations per minute / microg DNA and 8 . 3 % + / 1 . 9 % , respectively ) were lower than those in the ID group ( 262 + / 50 disintegrations per minute / microg DNA and 21 . 6 % + / 5 . 6 % , respectively ) on day 1 after hepatectomy ( P < . 05 , respectively ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Unlike its proliferative response in fibroblasts , FBLN 5 overexpression in mink lung Mv1Lu epithelial cells resulted in an antiproliferative response , reducing their DNA synthesis and cyclin A expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factor C ( RFC ) is a pentameric complex of five distinct subunits that functions as a clamp loader , facilitating the loading of proliferating cell nuclear antigen ( PCNA ) onto DNA during replication and repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The molecular mechanism of action of S 23906 1 could involve DNA alkylation , modulation of cyclin E protein levels and inhibition of DNA synthesis leading to apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These include alterations in DNA ploidy , cellular proliferation markers ( PCNA , Ki 67 , Mcm 2 , MIB 1 , MIA , and CSE1L / CAS protein ) , nuclear morphology , the p 53 gene and its related molecule MD M 2 , other cell cycle regulators ( cyclin A , cyclin D , cyclin E , cdc 2 , p 27 , p 73 ) , oncogenes and their receptors ( such as ras , c myc , c fms , HGF , c met , and erb B receptor family members ) , apoptosis related factors ( Fas and FasL ) , as well as telomerase activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Accordingly , the unwinding mediated by NS 1 and RPA promoted processive leading strand synthesis catalyzed by recombinant human DNA polymerase delta , PCNA , and RFC , using the minimal left end origin cloned in a plasmid as a template . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
With the aim to identify unconventional DNA polymerases from human cells , we have set up a special assay to fractionate HeLa extracts based on the ability ( 1 ) to bypass DNA lesions , ( 2 ) to be resistant to aphidicolin and an inhibitory antibody against pol alpha and ( 3 ) to be non responsive to proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Its control has been uncovered by the discovery of the CDKs ( cyclin dependent kinases ) as master regulators of the cell cycle and the initiator proteins of DNA replication , such as the Origin Recognition Complex ( ORC ) , Cdc6 / 18 , Cdt 1 and the MCM complex . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we show that E2F is involved in transcription of plant genes for proliferating cell nuclear antigen ( PCNA ) , which is required for DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The expression of the proliferation markers Ki 67 , proliferating cell nuclear antigen ( PCNA ) and cyclin D 1 was determined with immunohistochemistry , while S phase and DNA ploidy were analysed by flowcytometric analysis cell scan ( FACS ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) plays an essential role in nucleic acid metabolism as a component of the DNA replication and DNA repair machinery . ^^^ Three regions in human and rat DNA polymerases beta ( beta pol ) that resemble the consensus PIM were identified , and we show here that beta polymerase and PCNA can form a complex both in vitro and in vivo . ^^^ Direct interaction between mammalian DNA polymerase beta and proliferating cell nuclear antigen . ^^^ Proliferating cell nuclear antigen ( PCNA ) plays an essential role in nucleic acid metabolism as a component of the DNA replication and DNA repair machinery . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cellular proteins flap endonuclease 1 ( FEN 1 ) , proliferating cell nuclear antigen , replication factor C , DNA ligase 1 and DNA polymerase delta are required for the repair of this type of DNA lesion . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Serum stimulated DNA synthesis and cyclin D 1 expression was inhibited by low doses of PD 184352 , which abolished ERK 1 activity but had no effect on ERK 5 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In parallel , we used DNA microarrays to examine the genome wide transcriptional consequences of deleting PHO 85 or members of the Pho 85 cyclin family . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Initiation of DNA replication is regulated by cyclin dependent protein kinase 2 ( Cdk 2 ) in association with two different regulatory subunits , cyclin A and cyclin E ( reviewed in ref . 1 ) . ^^^ Cyclin A has two separable functions : it activates DNA synthesis by replication complexes that are already assembled , and it inhibits the assembly of new complexes . ^^^ The dual functions of cyclin A ensure that the assembly phase ( G 1 ) ends before DNA synthesis ( S ) begins , thereby preventing re initiation until the next cell cycle . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study , 53 sporadic CRCs were examined by immunohistochemistry for cyclin D 1 and beta catenin protein expression , and with PCR and direct DNA sequencing for k ras gene status . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Arteries exposed to Ad HO 1 demonstrated significantly increased TUNEL labeling of apoptotic nuclei and significantly decreased PCNA labeling of DNA synthesis in the medial wall 48 hours after injury . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Pol5p was identified and purified from yeast cell extracts and is an aphidicolin sensitive DNA polymerase that is stimulated by yeast proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression of growth arrest and DNA damage inducible protein , GADD 34 and proliferating cell nuclear antigen ( PCNA ) have been investigated in the core and peri infarct zone at 2 and 24 h after middle cerebral artery occlusion ( MCAO ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Moreover , a striking inverse correlation was noted between hepatocyte nuclear accumulation of phospho STAT 3 and DNA synthesis ( as assessed by bromodeoxyuridine labeling ) , as well as cyclin D 1 mRNA induction and protein expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
For further confirmation , DNA contents and expression levels of cyclins , cyclin dependent kinases ( CDKs ) , and CDK inhibitors ( CDKIs ) were examined by FACS analysis and Western blotting , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we show that , similar to cyclin A , cyclin F is degraded when the spindle assembly checkpoint is activated and accumulates when the DNA damage checkpoint is activated . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
ICI treatment led to decreases in the absolute levels of cyclin D 1 and cyclin A expression , retinoblastoma protein phosphorylation , and DNA synthesis in IGF 1 treated cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Mutants of S . pombe pol delta , containing truncated Cdc 27 derivatives deficient in binding to PCNA , supported DNA replication less processively than the wild type complex . ^^^ Fusion of a minimal PCNA binding motif ( aa 352 372 ) to C terminally truncated Cdc 27 derivatives restored processive DNA synthesis in vitro . ^^^ These data support the model in which Cdc 27 plays an essential role in DNA replication by recruiting PCNA to the pol delta holoenzyme . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Double staining of cellular cyclin A protein / DNA was used to detect the expression levels of cyclin A protein in cytoplasm . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferative cell nuclear antigen ( PCNA ) is an auxiliary protein of DNA polymerase delta and appears to be required for both DNA synthesis and repair . ^^^ After this treatment , expression of apoptosis was histologically examined using caspase 3 , an apoptosis inducer , in addition PCNA ( DNA synthesis / repair ) , and examination of glomerular morphometric changes , including cell number and tuft area . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
After MRS examinations , [ ( 3 ) H ] thymidine incorporation into hepatic DNA , proliferating cell nuclear antigen ( PCNA ) protein expression , and serum bilirubin determinations were performed on each rat . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we report that induction of this checkpoint with ICRF 193 , a topoisomerase 2 catalytic inhibitor that does not cause DNA damage , was associated with an ATR dependent inhibition of polo like kinase 1 ( Plk 1 ) kinase activity and a decrease in cyclin B 1 phosphorylation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Paraffin embedded tissues from 103 patients with HNSCC were analyzed using genomic DNA probes for cyclin D 1 and p 16 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA microarray analysis of livers from ET 743 treated animals showed a dramatic increase in the expression of ATP binding cassette transport genes Abcb1a and Abcb1b , which impart resistance to anticancer drugs , and of Cdc2a and Ccnd 1 , the rodent homologues of human cell cycle genes CDC 2 and cyclin D 1 , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Also , overexpression of cyclin E did not affect the repair of DNA double strand breaks and failed to potentiate the cytotoxic effects of etoposide . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
While PCNA is used as a marker of cell proliferation it is also strongly expressed in non dividing cells undergoing DNA synthesis and repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
BACKGROUND : Cyclin G 1 is a transcriptional target of p 53 and is induced by DNA damage in a p 53 dependent manner . ^^^ Analysis of cyclin G 1 disrupted mice demonstrated that cyclin G 1 is involved in many of the functions regulated by p 53 such as apoptosis , growth control and check point regulation in response to DNA damage . ^^^ RESULTS : Western blot analysis revealed that the accumulation of p 53 protein during the initial 24 h period following DNA damage is reduced in cyclin G 1 / cells compared to wild type cells . ^^^ Cyclin G 1 interacted directly with MDM 2 and promoted the formation of the ARF / MDM2 complex within the initial 24 h period following DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cytokinetic analysis of cell cycle and sub phases in MOLT 4 cells by cyclin E + A / DNA multiparameter flow cytometry . ^^^ Therefore , in the current study we established a cyclin E + A / DNA multiparameter flow cytometric technique by using a mixture of cyclin E and cyclin A antibodies , which can identify six stages in the whole cell cycle : G ( 0 ) , early G ( 1 ) , late G ( 1 ) , S , G ( 2 ) , and M phase . ^^^ Furthermore , we found that cyclin E + A / DNA multiparameter flow cytometry could also be used for stathmokinetic analysis of lymphocyte leukemia MOLT 4 cells after addition of the stathmokinetic agent vinblastine to cultures of exponentially growing MOLT 4 cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The presence of human herpesvirus 8 DNA sequences , as well as an overexpression of human interleukin 6 and human cyclin D 1 in myofibroblastic cells of inflammatory myofibroblastic tumor ( inflammatory pseudotumor ) , has recently been reported . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , a eukaryotic DNA replication factor , functions not only as a processivity factor for DNA polymerase delta but also as a binding partner for multiple other factors . ^^^ Proliferating cell nuclear antigen ( PCNA ) , a eukaryotic DNA replication factor , functions not only as a processivity factor for DNA polymerase delta but also as a binding partner for multiple other factors . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Prognostic significance of different biomarkers ( DNA content , PCNA , karyotype ) in colorectal adenomas . ^^^ Immunohistochemical detection of proliferating cell nuclear antigen ( PCNA ) , densitometric analysis of nuclear DNA content and fluorescence in situ hybridization with centromere specific DNA probes to chromosomes 11 and 17 were carried out on histological sections from 55 colorectal adenomas , in order to identify those adenomas that are more likely to progress to cancer . ^^^ A considerable variability of PCNA positivity ( range : 23 28 . 2 % ; mean value : 12 . 8 % ) , a DNA indexfrom 1 to 2 . 3 and numerical alterations of chromosome 11 were observed . ^^^ In particular , 14 out of 55 adenomas ( 25 % ) , independent of histological type , degree of dysplasia , location and size , showed a DNA aneuploid content , trisomies and tetrasomies of chromosome 11 and high PCNA index . ^^^ It was concluded that the combination of some biomarkers ( additional chromosomes 11 , high PCNA and DNA indices ) may allow identification of more aggressive colorectal adenomas with increased ability to undergo malignant transformation . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Southern blot analysis of the DNA restriction fragment showed no alterations and / or amplification in the coding region of the cyclin D 1 gene . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cell cycle progression was then assessed by measuring [ methyl 3H ] thymidine incorporation into DNA and monitoring cyclin E and A protein levels . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Moreover , Delta N cyclin A 2 Cdk2 has an expanded substrate specificity and can phosphorylate histone H2B at Ser 32 , which may facilitate DNA cleavage . ^^^ Consistent with a role for cyclin A 2 in apoptosis , the addition of Delta N cyclin A 2 Cdk2 , but not full length cyclin A 2 Cdk2 , to Xenopus egg extracts triggers apoptotic DNA fragmentation even when caspases are not activated . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , 1 , 25 ( OH ) ( 2 ) D ( 3 ) impaired autocrine and EGF induced nuclear translocation of activated EGFR and , consequently , its binding to AT rich DNA sequences and transcriptional activation of the cyclin D 1 promoter . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin dependent kinase 2 activated by cyclin E is involved in the initiation of DNA replication and other S phase functions . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Overexpression of DNA repair enzymes was associated with elevated levels of proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
However , activation of p42 / 44 ( MAPK ) in the above cells led to the inhibition of DNA synthesis , caused growth arrest , decrease in cyclin A and upregulation of p 21 ( Cip ) expression in a time dependent manner . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cell cycle analysis revealed elevated S phase DNA content accompanied by increased expression of cyclin E 1 and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have examined the involvement of the interdomain connector loop ( IDCL ) and of the carboxy terminal domain of PCNA in Apn 2 binding and found that Apn 2 binds PCNA via distinct domains dependent upon whether the binding is in the absence or presence of DNA . ^^^ In the absence of DNA , Apn 2 binds PCNA through its IDCL domain , whereas in the presence of DNA , when PCNA has been loaded onto the template primer junction by replication factor C , the C terminal domain of PCNA mediates the binding . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The effect of exposure to 50 Hz , 1 mT magnetic fields ( MF ) on the cell cycle in general , on the DNA synthesis in S phase , and on the G 1 phase regulating proteins Cdk 4 , cyclin D 1 , p16INK4a , and p21CIP1 was investigated in human amniotic fluid cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA topoisomerase 2 alpha and cyclin A immunoexpression in meningiomas and its prognostic significance : an analysis of 263 cases . ^^^ OBJECTIVE : To investigate the prognostic utility of 3 proliferative markers , namely , Ki 67 , DNA topoisomerase 2 alpha ( topoII ) , and cyclin A in a representative series of intracranial meningiomas . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin E and cyclin A are likely targets of Src for PDGF induced DNA synthesis in fibroblasts . ^^^ We conclude that both cyclin E and cyclin A are likely targets of Src mediating PDGF induced DNA synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cytokeratin and several proliferation associated cellular antigens ( proliferating cell nuclear antigen ( PCNA ) , p 53 , c erbB / 2 and c myc ) were labeled with PE and FITC , which was followed by DNA staining using PI . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A number of studies have suggested a role for proliferating cell nuclear antigen ( PCNA ) in DNA mismatch repair ( MMR ) . ^^^ The pol 30 201 mutation altered an amino acid ( C22Y ) located on the surface of the PCNA trimer that slides over the DNA but did not cause a defect in MSH 2 MSH6 binding in vitro . ^^^ Isolation and characterization of new proliferating cell nuclear antigen ( POL 30 ) mutator mutants that are defective in DNA mismatch repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Interestingly , deletion of the p 53 binding site confers enhanced responsiveness to p 53 mediated repression , suggesting that transcriptional repression of PCNA by p 53 is achieved by a mechanism other than direct DNA binding . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RAD 6 dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO . ^^^ Here we show that UBC 9 , a small ubiquitin related modifier ( SUMO ) conjugating enzyme , is also affiliated with this pathway and that proliferating cell nuclear antigen ( PCNA ) a DNA polymerase sliding clamp involved in DNA synthesis and repair is a substrate . ^^^ We demonstrate that these modifications differentially affect resistance to DNA damage , and that damage induced PCNA ubiquitination is elementary for DNA repair and occurs at the same conserved residue in yeast and humans . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These were analyzed for apoptosis ( in situ end labeling of fragmented DNA , light and electron microscopy ) , Bax / Bcl 2 protein ( Western blotting ) , mRNA ( Northern blotting ) and distribution ( immunohistochemistry ) , as well as caspase 3 activity ( substrate cleavage assay ) , inflammation ( ED 1 staining ) , proliferation ( proliferating cell nuclear antigen staining ) and fibrosis ( Masson ' s Trichrome staining ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study , we analyzed interactions that take place during loading onto DNA of either the PCNA clamp or the Rad 9 Rad1 Hus 1 checkpoint complex , using computationally derived molecular models . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition to known cell cycle regulators encoding inhibitory protein kinases ( wee 1 , pka 1 ) and DNA checkpoint proteins ( Pcna , rad 24 ) , we have identified genes that are involved in a number of cellular processes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In view of this dichotomy in its functions and its critical role in cell cycle control , this study examined the following four aspects of E2F 1 in a panel of 87 non small cell lung carcinomas ( NSCLCs ) , previously analysed for defects in the pRb p 53 MDM2 network : firstly , the status of E2F 1 at the protein , mRNA and DNA levels ; secondly , its relationship with the kinetic parameters and genomic instability of the tumours ; thirdly , its association with the status of its transcriptional co activator CBP , downstream target PCNA and main cell cycle regulatory and E2F 1 interacting molecules pRb , p 53 and MDM 2 ; and fourthly , its impact on clinical outcome . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 , a product of the bcl 1 gene , phosphorylates the retinoblastoma protein , releasing E2F 1 , which in turn activates genes involved in DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunohistochemistry using antibodies against glutathione S transferase placental form ( GST P ) , proliferating cell nuclear antigen ( PCNA ) , and in situ DNA nick labeling ( TUNEL ) were used . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Liver regeneration was evaluated in terms of the restoration of liver weight in proportion to body weight , liver DNA content and immunostaining for proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis , but not cytokinesis , continues in K cyclin expressing cells , leading to multinucleation and polyploidy . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
BACKGROUND : Proliferating cell nuclear antigen ( PCNA ) , which is recognized as a DNA polymerase processivity factor , has direct interactions with various proteins involved in the important genetic information processes in Eukarya . ^^^ RESULTS : The replication factor C ( RFC ) is known as the loading factor of PCNA on to the DNA strand . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Adhesion mediated release of MIF subsequently promotes integrin dependent activation of MAP kinase , cyclin D 1 expression , and DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Of note , DNA repair enzymes such as redox factor / apurinic / apyridimine endonuclease Ref 1 protein , proliferative cell nuclear antigen ( PCNA ) , the poly ( ADP ribose ) polymerase ( PARP ) , and DNA protein kinase ( DNA PK ) determine the cell fate after the DNA damage . ^^^ The PCNA ( 7 . 1 + / 2 . 8 % vs . 0 . 9 + / 0 . 6 % , p = 0 . 05 ) and DNA PK expressions ( 39 . 5 + / 5 . 4 % vs . 8 . 6 + / 5 . 5 % , p < 0 . 01 ) were higher in patients with LVEF < or =35 % vs . ^^^ The PCNA , Ref 1 , and DNA PK expression correlated with the LV end systolic wall stress ( r = 0 . 61 , p < 0 . 01 ; r = 0 . 52 , p < 0 . 01 ; and r = 0 . 73 , p < 0 . 001 , respectively ) . ^^^ In addition , the PCNA and DNA PK expression correlated with inducible NO synthase ( r = 0 . 41 , p = 0 . 05 , and r = 0 . 53 , p < 0 . 01 , respectively ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PURPOSE : A DNA RNA chimeric ribozyme was developed that targets the mRNA of a cell cycle regulatory protein , proliferating cell nuclear antigen ( PCNA ) . ^^^ The hypothesis was that inhibition of PCNA , essential in DNA replication , would decrease the proliferation of cells that are involved in formation of granuloma after surgical procedures in the eye . ^^^ METHODS : Rabbit genomic DNA encoding PCNA was cloned and sequenced . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Four different methods were used to visualize replication sites : in vivo pulse labeling with 5 bromo 2 ' deoxyuridine ( BrdU ) , followed by either acid depurination , or incubation in nuclease cocktail to expose single stranded BrdU substituted DNA regions for immunolabeling ; biotin dUTP labeling of nascent DNA by run on replication within intact nuclei and staining with fluorescent streptavidin ; and , finally , immunolabeling of the replication fork proteins PCNA and RPA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The genetic components of the RB : CDK : cyclin : p 16 tumor suppressor pathway undergo mutational and epigenetic alterations in a wide range of human cancers and serve as critical targets for inactivation by the transforming oncoproteins of several DNA tumor viruses . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In S phase , phosphorylation of components of the DNA replication machinery such as CDC 6 by cyclin A CDK is believed to be important for initiation of DNA replication and to restrict the initiation to only once per cell cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Stimulation of the breast cancer derived MCF 7S cell line with insulin like growth factor 1 ( IGF 1 ; 20 ng / ml ) leads to enhanced expression of cyclin D 1 , hyperphosphorylation of pRb , DNA synthesis , and cell division . 17beta Estradiol ( E ( 2 ) ; 10 ( 9 ) m ) is not able to stimulate proliferation of MCF 7S cells , although addition of E ( 2 ) to serum starved cells does result in induction of cyclin D 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The evidences that p 16 and cyclin D alterations occur in the earlier stages of many human cancers and that its immunolocalization can be used to study the cell cycle regulation , coupled with the possibility that chronic use of carbamide peroxide would induce DNA damage and cell cycle alteration , prompted us to analyse the effect of carbamide peroxide on the immunolocalization of these proteins in rat oral mucosa . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) has been shown to interact with a variety of DNA polymerases ( pol ) such as pol delta , pol epsilon , pol iota , pol kappa , pol eta , and pol beta . ^^^ However , when tested on a template containing a bulky DNA lesion , such as the major cisplatin Pt d ( GpG ) adduct , PCNA could not allow translesion synthesis by pol lambda . ^^^ Human DNA polymerase lambda functionally and physically interacts with proliferating cell nuclear antigen in normal and translesion DNA synthesis . ^^^ Proliferating cell nuclear antigen ( PCNA ) has been shown to interact with a variety of DNA polymerases ( pol ) such as pol delta , pol epsilon , pol iota , pol kappa , pol eta , and pol beta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factor C ( RFC ) catalyzes assembly of circular proliferating cell nuclear antigen clamps around primed DNA , enabling processive synthesis by DNA polymerase during DNA replication and repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Coupling of DNA synthesis and histone synthesis in S phase independent of cyclin / cdk2 activity . ^^^ DNA and histone synthesis are both triggered at the beginning of S phase by cyclin / cdk2 activity . ^^^ Although cyclin / cdk2 activity drives activation of both DNA and histone synthesis at the G1 / S transition of cycling cells , concerted repression of DNA or histone synthesis in response to inhibition of either one of these is not accompanied by prolonged inhibition of cyclin A / cdk2 or E / cdk2 activity . ^^^ Therefore , during S phase coupling of DNA and histone synthesis occurs , at least in part , through a mechanism that is independent of cyclin / cdk2 activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Higher expression of cyclin B 1 correlated with higher levels of cyclin B1 / cdc2 complex and kinase activity that interestingly , showed no inhibition at G2 / M after DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In MCF 7 cells , leptin and high glucose stimulated cell proliferation as demonstrated by the increases in DNA synthesis and expression of cdk 2 and cyclin D 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Free E 1 is readily ubiquitinated and degraded by the proteasome , while it becomes resistant to this degradation pathway when bound to cyclin E / Cdk2 complexes before the start of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Distinct nongenomic signal transduction pathways controlled by 17beta estradiol regulate DNA synthesis and cyclin D ( 1 ) gene transcription in HepG 2 cells . ^^^ The existence of rapid / nongenomic estradiol regulated protein kinase C ( PKC alpha ) and extracellular signal regulated kinase ( ERK ) signal transduction pathways , their cross talk , and role played in DNA synthesis and cyclin D ( 1 ) gene transcription have been studied herein in human hepatoma HepG 2 cells . 17Beta estradiol was found to rapidly activate PKC alpha translocation and ERK 2 / mitogen activated protein kinase phosphorylation in this cell line . ^^^ These actions were independent of each other , preceding the increase of thymidine incorporation into DNA and cyclin D ( 1 ) expression , and did not involve DNA binding by estrogen receptor . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Yeast PCNA is a homo trimeric , ring shaped DNA polymerase accessory protein that can encircle duplex DNA . ^^^ They were able to function as weak DNA polymerase delta processivity factors in vitro , and when the monomeric PCNA 41 ( A112T , S135F double mutant ) allele was introduced as the sole source of PCNA in vivo , the cells were viable and healthy . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The expressions of proliferating cell nuclear antigen ( PCNA ) and DNA polyploid content in porcine gastric epithelial cells were quantitatively assayed by means of immunohistochemistry and Feulgen stain respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Quantification of cyclin B 1 and p 34 ( cdc 2 ) in bovine cumulus oocyte complexes and expression mapping of genes involved in the cell cycle by complementary DNA macroarrays . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the breast cancer cell line MCF 7 , overexpression of Oct 1 or its POU domain strongly increases transcriptional activation of cyclin D 1 and GAL 4 reporter genes that is specifically dependent upon CREB but independent of Oct 1 DNA binding . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
By co immunoprecipitation analyses , Ku was found to interact with DNA polymerases alpha , delta and epsilon , PCNA , topoisomerase 2 , RF C , RP A , DNA PKcs , ORC 2 , and Oct 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA sequencing of the subtracted cDNA pool , cloned into the pBluescript vector , revealed three widely expressed , well known negative growth regulators , namely , thrombospondin 1 , cyclin G and tyrosine phosphatase CL 100 , as primary targets of glucocorticoid hormones . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Mutational changes in beta catenin in exons 3 , 5 and 6 were detected by each PCR single strand conformational polymorphism analysis followed by direct DNA sequencing . mRNA expression and copy numbers of c myc and cyclin D 1 were determined by semiquantitative reverse transcriptase PCR and competitive genomic PCR . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We show that exposure of cultured cortical neurons to beta amyloid induces the expression of DNA polymerase beta , proliferating cell nuclear antigen , and the p 49 and p 58 subunits of DNA primase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our data suggested , that upon replication block a Rad17 / RF C complex is recruited to sites of DNA lesions in late S phase , binds the Rad9 / Hus1 / Rad1 complex and enables it to interact with PCNA . ^^^ An interaction of Rad17 / RF C with PCNA appears to be mediated by the small RF C p 37 subunit , suggesting that PCNA might provide communication between replication checkpoint control and DNA replication and repair . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Bromodeoxyuridine , origin recognition complex , and the elongation factors minichromosome maintenance proteins ( MCM ) 2 7 and proliferating cell nuclear antigen were precisely localized , and the DNA copy number along the third chromosome chorion amplicon was quantified during multiple developmental stages . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Now , ubiquitin and SUMO modification of proliferating cell nuclear antigen ( PCNA ) is shown to be induced by DNA damage and linked to components of the RAD 6 pathway . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The malaria parasite Plasmodium falciparum genome sequencing has revealed the existence of a second gene for proliferating cell nuclear antigen ( PCNA ) , a key factor in a variety of DNA metabolic events . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
E2F activity was substantially increased in both the AhR overexpressing cells and the AhR agonist treated cells , suggesting that AhR activated E2F / DP2 may induce the expression of PCNA and RFC 38 and subsequent DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Polymerase chain reaction ( PCR ) technique was used to synthesize a digoxigenin labeled single stranded DNA probe specific for HHV 8 open reading frame 72 cyclin D homolog gene encoded mRNA as the probe accompanying with a tyramide signal amplification system ( TSA ) for ISH assay . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The Pab proliferating cell nuclear antigen ( PCNA ) activated the PabRFC complex in a DNA dependent manner , but the PabRFC small ATPase activity was neither DNA dependent nor PCNA dependent . ^^^ Finally , ( 1 ) the PabRFC large fraction cross reacted with anti human RFC PCNA binding domain antibody , corroborating the conservation of the protein sequence , ( 2 ) the human PCNA stimulated the PabRFC complex ATPase activity in a DNA dependent way and ( 3 ) the PabRFC complex could load human PCNA onto primed single stranded circular DNA , suggesting that the PCNA binding domain of RFC has been functionally conserved during evolution . ^^^ In addition , ATP hydrolysis was not required either for DNA polymerase stimulation or PCNA loading in vitro . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Nuclear localization of cyclin B 1 regulates DNA damage induced apoptosis . ^^^ To understand the biochemical pathways controlling this differential response , we have studied the intracellular localization of cyclin B 1 in cell types sensitive or resistant to apoptosis induced by DNA damage . ^^^ Our observations are consistent with the idea that localization of cyclin B 1 is among the factors determining the cellular decision to undergo apoptosis in response to DNA damage . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the presence of proliferating cell nuclear antigen , yeast DNA polymerase delta ( Pol delta ) replicated DNA at a rate of 40 60 nt / s . ^^^ The maturation kinetics were optimal with a slight molar excess over DNA of Pol delta , FEN 1 , and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We propose that this pathway may represent an initial event to facilitate the assembly of other replication factors , e . g . , PCNA and / or DNA polymerase delta , a model that could also apply to other eukaryotic replicons , such as nanoviruses , circoviruses , and parvoviruses with a similar DNA replication strategy . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proteolytic targets that are now known include most of the cyclins , cyclin dependent kinase inhibitors , DNA replication factors , the securin class of proteins that inhibit loss of sister chromatid cohesion following DNA replication and , of course , the cohesion factor itself . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is thought to play a role in DNA mismatch repair at the DNA synthesis step as well as in an earlier step . ^^^ MSH6 binds to PCNA loaded on newly replicated DNA and is transferred from PCNA to mispaired bases in DNA . . ^^^ MSH6 complex from proliferating cell nuclear antigen to mispaired bases in DNA . ^^^ Proliferating cell nuclear antigen ( PCNA ) is thought to play a role in DNA mismatch repair at the DNA synthesis step as well as in an earlier step . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , by screening for synthetic dosage lethality , we have shown that overexpression of MGS 1 causes lethality in combination with mutations in genes that encode replication proteins such as DNA polymerase delta , RFC , PCNA and RPA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Pathological characteristics , PCNA labeling index and DNA index in prognostic evaluation of patients with moderately differentiated hepatocellular carcinoma . ^^^ AIM : To study the relationship between prognosis and pathological characteristics , proliferating cell nuclear antigen labeling index ( PCNA LI ) and DNA index ( DI ) in patients with moderately differentiated hepatocellular carcinoma ( HCC ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we show that exposure of the transformed endothelial cell line ECV 304 to NAMI A significantly inhibited DNA synthesis , as well as the expression of the proliferating cell nuclear antigene ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
ING 1 promotes DNA repair and interacts with proliferating cell nuclear antigen , thus linking DNA repair , apoptosis and chromatin remodelling . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The gene encoding the proliferating cell nuclear antigen ( PCNA ) , a sliding clamp of DNA polymerases , was cloned from an euryarchaeote , Thermococcus kodakaraensis KOD 1 . ^^^ The stimulatory effect of Tk PCNA was observed when a circular DNA template was used and was equally effective on both circular and linear DNA . ^^^ The Tk PCNA improved the sensitivity of PCR without adverse effects on fidelity with the KOD DNA polymerase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Assimilation of HPV oncogenes E 6 and E 7 into the host DNA promotes upregulation of cyclin dependent kinase inhibitor ( CDKI ) p 16 ( INK4A ) , detectable by monoclonal antibody in the developing cervical cancer cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin G 2 may exceptionally be a negative regulator since its expression could be induced by DNA damage and the VHL tumor suppressor protein . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Western blot analyses showed that the levels of other replication proteins ( Orc 2 , PCNA , DNA polymerase epsilon and delta , Primase and Topoisomerase IIalpha ) were comparable in both the xrs 5 mutant and CHO K 1 wild type cell lines . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To explore this question , we sought to determine whether DNA targeting of murine and human cyclin T 1 can reconstitute a Tat / TAR independent activity to the HIV 1 LTR . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Under these conditions T cells expressed CD 25 and CD 69 and progressed through the first 12 hr of G0 / G1 phase but did not express CD 71 , cyclin D 3 , cdk 4 , begin DNA synthesis , or differentiate into cytotoxic effector cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Bivariate distribution of cyclin B 1 or p 21 expression versus cellular DNA content was assessed by flow cytometry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Binding kinetics of the toroid shaped PCNA to DNA strands on a 27 MHz quartz crystal microbalance . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In only 1 case was cyclin D 1 immunoreactivity detected , and the t ( 11 ; l 4 ) ( q 13 ; q 32 ) breakpoint was amplified from both lymph node and skin DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Mutation of the NLS eliminated nuclear accumulation of both cyclin E and Cdk 2 , and such versions of cyclin E were unable to trigger DNA replication . ^^^ Addition of a heterologous NLS from SV 40 large T antigen restored both nuclear targeting of Cdk2 / cyclin E and DNA replication . ^^^ In contrast to its inability to promote DNA replication , cyclin E lacking its NLS was able to cooperate with cyclin B in promoting mitotic entry . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Reduced DNA replication in regenerating Foxm1b ( / ) hepatocytes was associated with sustained increase in nuclear staining of the cyclin dependent kinase ( Cdk ) inhibitor p 21 ( Cip 1 ) ( p 21 ) protein between 24 and 40 h after partial hepatectomy . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , the induction did not depend on DNA repair , since PCNA was UV inducible in UVL 10 and xrs 6 cells , in which nucleotide excision repair and double stranded repair , respectively , are largely compromised . ^^^ The roles of p 53 , DNA repair , and oxidative stress in ultraviolet C induction of proliferating cell nuclear antigen expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Thus the inhibition of entry of irradiated cells into S phase does not appear to be related to DNA bound PCNA complexed to CDKN1A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
As in ischemic preconditioning , TNF alpha pretreatment activated NF kappaB DNA binding , STAT 3 , cyclin D 1 , cyclin dependent kinase 4 ( cdk 4 ) expression , and cell cycle entry , determined by proliferating cell nuclear antigen ( PCNA ) staining of hepatocyte nuclei . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The expression of Ki 67 and PCNA was measured by immunocytochemical methods and biosynthesis of DNA was evaluated by [ 14C ] thymidine incorporation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The preadipocytes traverse the G ( 1 ) S checkpoint synchronously as evidenced by the expressionactivation of cdk 2 cyclin EA , turnover of p27kip1 , hyperphosphorylation of Rb , translocation of cyclin D ( 1 ) from nuclei to cytoplasm and GSK 3beta from cytoplasm to nuclei , and incorporation of [ ( 3 ) H ] thymidine into DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Reactivation of lytic replication from B cells latently infected with Epstein Barr virus occurs with high S phase cyclin dependent kinase activity while inhibiting cellular DNA replication . ^^^ Furthermore , although cellular DNA replication was blocked , elevation of cyclin E / A expression and accumulation of hyperphosphorylated forms of Rb protein were observed , a post G ( 1 ) / S phase characteristic of cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The spatial and temporal organization of DNA replication was investigated in living cells with a green fluorescent protein fusion to the DNA polymerase clamp PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RFC is a clamp loader , facilitating the addition and removal of proliferating cell nuclear antigen from DNA during replication and repair but can also interact directly with the retinoblastoma tumor suppressor protein and the transcription factor C / EBPalpha . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cells which belonged to G ( 1 ) phase were sorted by FCM according DNA diploidy , and then the expression of cyclin B 1 was examined by confocal microscope to confirm the results . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In an attempt to identify molecular prognostic markers , a series of laryngeal and hypopharyngeal carcinomas was examined for PCNA , Ki 67 , p 27 ( Kip 1 ) , p 53 , E cadherin and CD 44 by immunohistochemistry and for DNA content by flow cytometry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Identification of a novel protein , PDIP 38 , that interacts with the p 50 subunit of DNA polymerase delta and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Similar to 3T3 L 1 preadipocytes , the MEFs reenter the cell cycle ( as indicated by the synchronous expression of cyclin A ) and undergo MCE as evidenced by the incorporation of BrdUrd into DNA and the formation of mitotic foci of cells that undergo adipogenesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Phosphorylation and inactivation of the pRB protein , which is required for progression into the DNA synthetic phase of the cell cycle is conducted by a holoenzyme , for which cyclin D 1 gene encodes the rate limiting regulatory subunit . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin K was found to associate with the activation domain of STAT 3 to inhibit its DNA binding and transcriptional activities . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : In a standard immunohistochemical procedure , monoclonal antibodies to Ki 67 antigen and single stranded DNA were applied to detect cycling and apoptotic cells respectively ; polyclonal antibodies to cyclin D 1 and Fhit protein were used . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The PCNA heterotrimer , but not individual subunits , stimulates the activities of the DNA polymerase , DNA ligase 1 , and the flap endonuclease ( FEN 1 ) of S . solfataricus . ^^^ Distinct PCNA subunits contact DNA polymerase , DNA ligase , or FEN 1 , imposing a defined architecture at the lagging strand fork and suggesting the existence of a preformed scanning complex at the fork . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The effects of 17 beta estradiol , dihydrodydrogesterone , tamoxifen and cyclophosphamide upon parameters of cell maturation ( Mucine 1 expression ) , cell proliferation ( Cyclin D 1 expression ) and apoptosis ( loss of nuclear DNA ) were studied in estrogen receptor positive ( ER+ ) and negative ( ER ) human breast cancer cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Eukaryocyte expression vector ( pAS A ) containing anti sense and the full length human cyclin A complementary DNA ( cDNA ) ( 1 . 77 kb ) was constructed and was transferred into squamous carcinoma of the tongue cell line ( Tca 8113 ) by Lipofect AMINETM introduction . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In 38 patients with acute lymphocytic leukemia ( ALL ) , the genomic DNA of mononuclear cells isolated from peripheral blood and bone marrow was amplified by using hemi nested polymerase chain reaction ( PCR ) technique and the expression of cyclin D 1 protein of mononuclear cells was detected by using immunohistochemical method . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
TGF beta 1 gene at different doses was transduced into the rat bone marrow derived MSCs to examine the effects of TGF beta 1 gene transfection on MSCs DNA synthesis , cell cycle kinetics and the expression of proliferating cell nuclear antigen ( PCNA ) . ^^^ The results showed that 3 microliters lipofectamine mediated 1 microgram TGF beta 1 gene transfection could effectively promote the proliferation of MSCs best ; Under this condition ( DNA / Lipofectamine = 1 microgram / 3 microliters ) , flow cytometry and immunohistochemical analyses revealed a significant increase in the 3H incorporation , DNA content in S phase and the expression of PCNA . ^^^ Transfection of gene encoding TGF beta 1 could induce the cells at G0 / G1 phase to S 1 phase , modulate the replication of DNA through the enhancement of the PCNA expression , increase the content of DNA at S 1 phase and promote the proliferation of MSCs . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We found that CREB activity , including its DNA binding ability and phosphorylation on residue Ser 133 , was strongly inhibited by Cpd 5 , followed by suppression of CRE mediated transcription of cyclin D 1 and Bcl 2 genes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression of EGFR and PCNA , and DNA content in squamous cell carcinoma of larynx ] . ^^^ OBJECTIVE : To investigate the expression of epidermal growth factor ( EGF ) , proliferating cell nuclear antigen ( PCNA ) and DNA index ( DI ) in laryngeal carcinoma , to analyse the correlation between these index and the biological characteristics of laryngeal carcinoma and their values of clinical prognosis . ^^^ METHOD : Immunohistochemical staining was used to detect the expression of EGFR and PCNA in laryngeal cancer and normal tissue , and with MIPS 1 image analysis system DNA contents of cancer cell were measured and made out DNA index . ^^^ The expression of EGFR did not correlate with histological grading and 5 years survival rate ( P > 0 . 05 ) , The positive expression of PCNA and DNA contents in the laryngeal carcinoma were increased with the decrease of tumorous differentiation ( P < 0 . 05 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RESULTS : The PCNA index was increased significantly in the colon after ethanol administration compared with controls ( ethanol , 10 . 3 + / 2 . 3 vs . control , 6 . 51 + / 1 . 6 % PCNA positive cells , p < 0 . 05 ) , although neither the protein , RNA , and DNA concentrations nor k ( s ) , k ( RNA ) , k ( DNA ) , and 5 ( s ) were affected . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To determine whether hysteresis underlies entry into and exit from mitosis in cell free egg extracts , we tested three predictions of the Novak Tyson model . ( 1 ) The minimal concentration of cyclin B necessary to drive an interphase extract into mitosis is distinctly higher than the minimal concentration necessary to hold a mitotic extract in mitosis , evidence for hysteresis . ( 2 ) Unreplicated DNA elevates the cyclin threshold for Cdc 2 activation , indication that checkpoints operate by enlarging the hysteresis loop . ( 3 ) A dramatic `` slowing down ' ' in the rate of Cdc 2 activation is detected at concentrations of cyclin B marginally above the activation threshold . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Inhibitory effects of genistein on the synthesis of DNA and the protein expression of cyclin D 1 in human gastric carcinoma cell line ] . ^^^ The above mentioned results indicate that genistein inhibits the growth of gastric carcinoma cells and the possible mechanism of this inhibition might be resulted from inhibiting the synthesis of DNA and the protein expression of cyclin D1 . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Conversely , misexpression of a dominant negative cyclin dependent kinase ( CDK ) or CDK inhibitor proteins ( ICK / KRPs ) in Arabidopsis and tobacco leaves has revealed that cell growth can be uncoupled from cell cycle progression and DNA content . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using in vivo genomic footprinting , we have identified protein DNA interactions within the cyclin D 1 core promoter that are disrupted upon inactivation of TAF 1 in ts 13 cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Tissues were examined for cyclin D 1 genotype ( by DNA single strand conformation polymorphism analysis ) , for cyclin D 1 protein expression ( by immunohistochemistry ) , and for cyclin D 1 gene copy number ( by fluorescence in situ hybridization ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression of Y family polymerases is often induced by DNA damage , and their recruitment to the replication fork is mediated by beta clamp , clamp loader , single strand DNA binding protein and RecA in Escherichia coli , and by ubiquitin modified proliferating cell nuclear antigen in yeast . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Ectopic expression of the 24 amino acid N terminal end of p55gamma inhibited cell cycle progression , as evidenced by induction of cell growth arrest at the G0 / G1 phase , inhibition of DNA synthesis , inhibition of cyclin D and cyclin E promoter activity , and changes in the expression of cell cycle related proteins . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Because IKKalpha but not IKKbeta induced cyclin D 1 expression through Tcf activity , these studies indicate that the relative levels of IKKalpha and IKKbeta may alter their substrate and signaling specificities to regulate mitogen induced DNA synthesis through distinct mechanisms . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
HBcAg expression and its relationship with histologic activity index , ALT levels , PCNA score and HBV DNA levels were investigated . ^^^ In multivariate analysis , both high HBV DNA level and low HAI ( P < 0 . 0005 and P < 0 . 05 , respectively ) but not PCNA score , were independently associated with nuclear staining of HBcAg . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In all tumor cell lines , DNMT 1 mRNA as well as protein was decreased relative to the DNA replication factor PCNA , and DNA hypomethylation was present . ^^^ Diminished DNMT 1 : PCNA mRNA ratios were also found in 28 / 45 TCC tissues but did not correlate with the extent of DNA hypomethylation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To investigate microglial proliferation and apoptosis during development , we combined proliferating cell nuclear antigen ( PCNA ) immunohistochemistry , in situ detection of nuclear DNA fragmentation ( TUNEL ) , and caspase 3 immunohistochemistry with tomato lectin histochemistry , a selective microglial marker . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We found that mevastatin induced G 1 arrest and decreased DNA synthesis in rat PASMCs and did so in association with an increase in both total and cyclin E bound p27Kip1 . ^^^ However , in PASMCs lacking functional p27Kip1 , mevastatin still decreased cyclin E kinase activity , caused G 1 arrest , and decreased DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
At 24 hr after PH , the vitamin treatments increased the peak of [ ( 3 ) H ] thymidine incorporation into DNA and the proliferative index ( PI ) , measured as PCNA expression ; an inverse relationship between PI and LPO levels could be demonstrated . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the absence of oriP containing plasmids , EBNA 1 was highly colocalized with cellular DNA replication foci that were identified by immunostaining S phase cells for proliferating cell nuclear antigen and replication protein A ( RP A ) in combination with DNA short pulse labeling . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Minichromosome maintenance ( Mcm ) proteins , cyclin B 1 and D 1 , phosphohistone H 3 and in situ DNA replication for functional analysis of vulval intraepithelial neoplasia . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Key target genes in this process include master regulators of the cell cycle , such as cyclin E , which regulates G ( 1 ) progression , and cyclin A , which is required for the initiation of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Following DNA damage , the p 53 dependent induction of p21CIP1 regulates cyclin E / Cdk2 and cyclin A / Cdk2 complexes both of which phosphorylate pRB , leading to E2F mediated activation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : For each patient , flow cytometry DNA analyses on frozen samples and on immunohistochemical staining were performed , including Ki 67 , cyclin A , p 53 , and p 21 ( waf 1 ) ( p 21 ) , with assessment of the percentages of positive nuclei were assessed . ^^^ CONCLUSIONS : Immunohistochemical study of proteins involved in the cell cycle and assessment of proliferative activity using flow cytometric DNA analysis aided the authors in singling out correlations of cyclin A and S phase , along with p 21 , with metastasis free survival and overall survival in patients with invasive breast carcinoma . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We also found that in SH SY5Y neuronal cells H ( 2 ) O ( 2 ) induced the activation of DNA repair system with the nuclear translocation of MSH 2 , and PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the early embryonic cell cycle , Cdc 2 cyclin B functions like an autonomous oscillator , whose robust biochemical rhythm continues even when DNA replication or mitosis is blocked . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Image analysis also demonstrated that PCNA expression was more intense in HPV DNA 16 / 18 OSCCs . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the present study , the early presence , origin , and proliferation activity of Schwann cells ( SCs ) along this particular type of biological graft conduit have been investigated , using antibodies directed against glial fibrillar acid protein ( GFAP ) , a protein that is specifically expressed in glial cells , and proliferating cell nuclear antigen ( PCNA ) , a protein that is expressed by cells during DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
AIM : To investigate the change of HBV DNA , PCNA and GST pi in chronic liver disease and hepatocellular carcinoma ( HCC ) . ^^^ METHODS : Hepatitis B surface antigen ( HBsAg ) , proliferating cell nuclear antigen ( PCNA ) and glutathione S transferases ( GST pi ) were detected by immunohistochemical staining and HBV DNA was detected by in situ hybridization ( ISH ) in formalin fixed and paraffin embedded sections with a total of 111 specimens of chronic hepatitis , liver cirrhosis , paratumorous tissue , HCC and normal liver tissue . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We demonstrate co localisation of WRN and PCNA at replication factories , show that PCNA binds to two distinct functional sites on WRN , and suggest a mechanism by which association between WRN and PCNA may be regulated in cells on DNA damage and during DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
On sacrifice at the end of week 24 , glutathione S transferase placental form positive foci , putative preneoplastic lesions in the liver , cell proliferation as indicated by proliferating cell nuclear antigen immunohistochemical staining and levels of 8 hydroxydeoxyguanosine , a marker of oxidative DNA damage , were significantly increased in the liver of group 3 along with non significant alteration of 8 oxoguanine DNA glycosylase mRNA expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA microarray analysis and immunoblotting identified p 21 , Myc , 14 3 3 zeta , cyclin A , cyclin B 1 , and GADD 153 as genes constitutively overexpressed ( 2 to 10 fold ) in both MCF+FIR and MCF+SOD cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Compared to normal human mucosa , epithelia migrating to cover 2 or 3 day old wounds made either in vivo or in an organotypic cell culture all showed loss of the proliferation marker Ki 67 and cyclins D ( 1 ) and A , and reduced expression of cyclins D ( 3 ) and E , the cyclin D dependent kinase 4 ( CDK 4 ) , the MCM 7 component of DNA replication origin complexes and the retinoblastoma protein pRb . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin G expression resulted in a dramatic decrease of p 53 protein levels in response to DNA damage and abrogated irradiation mediated G 1 arrest along with an increase of S phase in MCF 7 cells containing wild type p 53 . ^^^ Moreover , inhibition of cyclin G by small interfering RNA ( siRNA ) caused the accumulation of p 53 and p 73 protein levels in response to DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
TUNEL staining for DNA fragmentation and Western blots for p 38 MAPK , Fas L and cyclin D ( 1 ) detection were performed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The reduction of cyclin D 1 to low levels during S phase is required for DNA synthesis , and forces the cell to induce high cyclin D 1 levels once again when it enters G 2 phase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In cyclin D 1 null mice , E 2 also induces retinoblastoma protein phosphorylation and DNA synthesis in a normal manner . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
ER , PR , p 53 , C erbB 2 , EGFR , Cathepsin D , PCNA , DNA ploidy and S phase fraction , were studied by immunohistochemistry and flow cytometry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A is expressed during the S phase and cyclin A / CDK2 is important for a normal rate of DNA elongation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It interacts directly or indirectly with a variety of important proteins , including oncogene proteins ( c myc , E2F ) , tumor suppressor proteins ( p 53 , RB , BRCA 2 ) , DNA damage repair proteins ( RAD 50 , RAD 51 ) , cell cycle regulators ( cyclin , CDK ) , transcriptional regulators ( RNA polymerase 2 ) and others related to the important biological events . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Because the PCNA gene has a cAMP responsive element in its promoter , it can be suggested that CREB may activate the PCNA gene and lead to the induction of hepatocyte DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In order to study the effect of and mechanism of lysophosphatidylcholine ( LysoPC ) on proliferation of the calf thoracic aorta smooth muscle cells ( ASMCs ) , the ASMCs were used to observe the effects of LysoPC induced endothelial cell conditioned medium on the DNA content and proliferating cell nuclear antigen ( PCNA ) expression in the calf thoracic ASMCs by flow cytometry and Western Blot technique . ^^^ It was found that LysoPC induced endothelial cell conditioned medium could significantly promote PCNA expression of the calf ASMCs , induce the converting of ASMCs from G0 / G1 phase to S phase of DNA synthesis , and increase the tyrosine phosphorylation protein expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A significant stimulation of the nuclease activity with PCNA was observed with double stranded and flap structure DNA . ^^^ A potential PCNA binding motif was found in the sequences of several mt nucleases and mt proteins involved in the maintenance of the mt DNA with respect to the consensus described by Warbrick . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The findings that CTF7 / ECO1 , POL 30 ( PCNA ) , and CHL12 / CTF18 ( a replication factor C [ RFC ] homolog ) genetically interact provided the first evidence that the processes of cohesion establishment and DNA replication are intimately coupled a link now confirmed by other studies . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
However , here we show that expression of reporter plasmids containing promoter sequences from the human DNA polymerase alpha ( pol alpha ) , CAD , and cyclin A genes is stimulated in cotransfections with N terminally truncated CDP / Cux proteins but not with full length CDP / Cux . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Earlier we showed that U ( L ) 13 and ICP 22 mediate the stabilization of cdc 2 and the replacement of its cellular partner , cyclin B , with the viral DNA polymerase processivity factor U ( L ) 42 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin G 1 is a transcriptional target of the tumor suppressor p 53 , and its expression is increased after DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Prognostic impact of DNA ploidy pattern , S phase fraction ( SPF ) , and proliferating cell nuclear antigen ( PCNA ) in patients with primary gastric lymphoma . ^^^ BACKGROUND : DNA ploidy , S phase fraction ( SPF ) , and proliferating cell nuclear antigen ( PCNA ) are considered to be significant prognostic factors in non Hodgkin lymphomas . ^^^ Proliferative activity was studied by staining against PCNA ; in addition , the prognostic significance of DNA ploidy and SPF , as determined by flow cytometry , were investigated and compared to the results of the PCNA stainings . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Low density DNA array analysis revealed that telomerase activity increases the expression of G 1 regulating genes including cyclin D 3 , cyclin E 1 , E2F 4 , and DP 2 , associated with hyperphosphorylation of retinoblastoma ( pRb ) , leading to the extended proliferative capacity of BMSSC Ts . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In situ terminal deoxynucleotidyl transferase end labeling ( TUNEL ) and avidin biotin peroxidase complex ( ABC ) immunohistochemical assay were used to detect single strand DNA breaks and proliferating cell nuclear antigens ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The PCNA XPF complex acts as a structure specific nuclease on a similar range of DNA flap , bubble and junction substrates as the human protein , suggesting a fundamental conservation through billions of years of evolution . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin dependent kinases phosphorylate p 73 at threonine 86 in a cell cycle dependent manner and negatively regulate p 73 . p 73 transcription factors are members of the p 53 family and participate in developmental processes and DNA damage response . p 73 expression was shown to be regulated during the cell cycle , suggesting that p 73 might play a role in cell growth and might be a target for cyclin dependent kinases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The apoptotic function of E2F 1 is dependent on its ability to bind DNA ; cyclin A kinase activity has been shown to negatively regulate the DNA binding capacity of E2F 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The growth factor stimulated to induce cyclin D 1 protein and increase DNA contents . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We analyzed cyclin B synthetic requirements in oocytes and early embryos by inhibiting cyclin B synthesis with DNA and morpholino antisense oligonucleotides . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The DNA histogram showed that the cell fraction of the G2 / M phase was increased , and this G2 / M phase arrest was related to a decrease of cdk 1 and cyclin A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Following treatment with fludarabine , there was a significant increase in the number of cells undergoing apoptosis in Cyclin D 3 expression down regulated WSU CLL cells as determined by Annexin 5 assay , cell cycle analysis for DNA content , and cytomorphology . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Moreover , calcitriol mediated arrest of beta TC ( 3 ) cells in the G ( 1 ) phase of the cell cycle was associated with the abnormal expression of p 21 and G ( 2 ) / M specific cyclin B 2 genes and involved the DNA damage inducible factor GADD 45 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The following seven genes were selected as potential molecular markers for chemical uncouplers : seryl tRNA synthetase ( Ser tRS ) , glutamine hydrolyzing asparagine synthetase ( Glut HAS ) , mitochondrial bifunctional methylenetetrahydrofolate dehydrogenase ( Mit BMD ) , mitochondrial heat shock 10 kDa protein ( Mit HSP 10 ) , proliferating cyclic nuclear antigen ( PCNA ) , cytoplasmic beta actin ( Act B ) , and growth arrest and DNA damage inducible protein 153 ( GADD 153 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Constitutive N myc overexpression stimulates increases in cyclin E dependent kinase activity and decreases in p 27 resulting in increased DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The human DNA polymerase epsilon catalytic subunit consists of a 140 kDa N terminal domain that contains the catalytic activity and a 120 kDa C terminal domain that binds to the other subunits and to exogenous peptides , including PCNA and MDM 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Rats were injected with 4 . 5 microg LGF / rat , and LGF activity was measured both by liver DNA synthesis stimulation and `` proliferating cell nuclear antigen ( PCNA ) positive ' ' hepatocytes in rats injected with LGF or +anti TNF alpha . ^^^ DNA synthesis and PCNA positive hepatocytes induced by LGF were inhibited by anti TNF alpha , PCNA positive hepatocytes being especially abundant around the central vein when LGF was injected alone , but TNF alpha exhibited increased signal intensity in endothelial cells of the portal vein . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Changes in the activity of cyclin kinase complexes governing cell transition from G 1 phase to DNA replication phase in E1A + c Ha ras transformants transfected with the bcl 2 gene ] . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyp2b20 , growth arrest and damage inducible gene beta ( Gadd45beta ) , tumor necrosis factor alpha induced protein 2 and insulin like growth factor binding protein 1 ( Igfbp 5 ) genes and proteins were upregulated by oxazepam , and Cyp2b20 , Cyclin D 1 , proliferating cell nuclear antigen , Igfbp 5 , Gadd45beta and cell death inducing DNA fragmentation factor alpha subunit like effector A exhibited higher expression after Wy 14 , 643 treatment . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Persistently elevated cdk 4 and cyclin D 1 in progastrin overexpressing mice accounts for the capacity of colon cells to continue with the cell cycle after DNA damage . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
One potential mechanism involves cAMP responsive element binding protein , which is activated by radiation via the epidermal growth factor receptor / MAPK pathway and which regulates synthesis of proliferating cell nuclear antigen ( PCNA ) , a protein involved in repair of ionizing radiation induced DNA damage . ^^^ Pulsed field gel electrophoresis measurements showed that CR 133 inhibited the repair of radiation induced DNA double strand breaks , and this effect was reversed by over expression of PCNA ; dominant negative CREB also significantly inhibited split dose recovery . ^^^ These data demonstrate that genetic disruption of CREB results in radiosensitization , and that this effect can be explained by a mechanism involving decreased PCNA expression and inhibition of DNA repair . . ^^^ Dominant negative cAMP responsive element binding protein inhibits proliferating cell nuclear antigen and DNA repair , leading to increased cellular radiosensitivity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Transfection with cyclin D 1 in vivo triggered hepatocyte DNA synthesis and the expression of S phase proteins in the absence of dietary protein . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The functional classification of the 33 genes identified was related to several kinds of biological pathways , regulating the cell cycle ( PCNA , CDC7L1 , CCND 3 , YWHA 1 , PKMYT 1 ) , DNA replication and repair ( RFC 4 , RECQ 2 , PCNA , NAP1L1 ) , cell growth ( IGF 2 , IGFBP 2 , PRSS 11 ) , hormonal signals ( AR , SRD5A1 , NR1I3 ) , and cellular metabolism ( E 2 EPF , WWP 1 , CYP2C9 , CYP2E1 , CYP2A6 , CYP2A7 , CYP2A13 , CYP4F2 , CYP3A4 , DDT ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
For example , in frog egg extracts , Cdk 1 cyclin B catalyzes entry into mitosis but can not trigger DNA replication . ^^^ Two hypotheses can explain this observation : Either Cdk 1 cyclin B fails to recognize the key substrates of its S phase promoting counterparts , or its activity is somehow regulated to prevent it from activating DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The expression of cyclin A at S phase in leukemia cell line HL 60 , blast cells of acute leukemia patients , bone marrow cells of outpatients without malignant hematological disease and peripheral blood cells of healthy donors was investigated by simultaneous indirect immunofluorescence staining of intracellular antigen and DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The decline in DNA synthesis , as suggested by the lower PCNA SI and LI in varicocele specimens , could be a reason for the disordered spermatogenesis in these patients . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A is required for DNA synthesis during the S phase and progression through the G2 / M transition . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Simultaneous measurements of DNA content and cyclin expression allowed us to perform cell cycle specific analysis . ^^^ New G 1 cells started DNA synthesis most likely as endoreduplication to form the third peak and the mechanism of cyclin B 1 accumulation converted into down regulation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In previous studies , we observed that expression of the homeodomain protein Zerknllt ( Zen ) represses PCNA gene transcription , by reducing the DNA binding activity of DREF . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The latter was associated with an activation of c Jun N terminal kinase ( JNK ) , an increase of the DNA binding activity of the transcription factor AP 1 and down regulation of cyclin D 1 expression . ^^^ The JNK inhibitor SP 600125 antagonized R and S flurbiprofen induced AP 1 DNA binding , suppression of cyclin D 1 expression , and the G 1 cell cycle block . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Therefore , we examined the involvement of p 38 MAPK signaling in AngII stimulated DNA synthesis , phosphorylation of the retinoblastoma protein ( Rb ) , and expression of the G 1 phase cyclin D 1 in human coronary artery smooth muscle cells ( CASMC ) . ^^^ AngII induced phosphorylation of Rb ( Ser 795 and Ser 807 / 811 ) , cyclin D 1 expression , and DNA synthesis was also markedly enhanced by pharmacological inhibition of the p 38 MAPK pathway . ^^^ The present study demonstrates that p 38 MAPK negatively regulates AngII induced ERK1 / 2 activity , Rb phosphorylation , cyclin D 1 expression , and DNA synthesis in human CASMC . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This alternative RFC containing complex interacts with proliferating cell nuclear antigen but not with the Rad9 / Rad1 / Hus1 complex , a proliferating cell nuclear antigen like clamp involved in the DNA damage response . hCTF 18 preferentially binds chromatin during S phase , suggesting a role during replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In eukaryotic DNA replication , replication factor C ( RFC ) acts as a `` clamp loader ' ' that loads PCNA onto a primed DNA template in an ATP dependent manner . ^^^ Truncation of the C terminal alpha helix ( alpha 16 ) causes a failure in RFCS oligomerization and a loss of the stimulating activity for the PCNA dependent DNA synthesis by DNA polymerases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Despite this oncogenic lesion , Y 1 cells retain tight regulatory mechanisms of cell cycle control typified by the sequential events comprising the mitogenic response triggered by FGF 2 in G0 / G1 arrested Y 1 cells : 1 ) activation of ERK1 / 2 and PI3K , by 5 minutes ; 2 ) induction of c Fos and c Myc proteins by 2 hours ; 3 ) induction of cyclin D 1 protein by 5 hours ; 4 ) phosphorylation of Rb protein between 6 and 8 hours ; 5 ) onset of DNA synthesis by 8 9 hours . ^^^ Ectopic expression of both c Myc and cyclin D 1 is not sufficient to drive G0 / G1 arrested Y 1 cells into S phase , but when the sustained expression of these two proteins is complemented by ACTH treatment it promotes G 1 phase progression and DNA synthesis initiation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Bisulphite DNA sequencing revealed that loss of cyclin D 2 expression was closely associated with the density of methylation in the promoter region . ^^^ Treatment with DNA methyltransferase inhibitor , 5 aza 2 ' deoxycytidine , restored the cyclin D 2 expression level in methylated gastric cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
FEN 1 binds proliferating cell nuclear antigen ( PCNA ) , a DNA clamp protein , when processing Okazaki fragments during lagging strand DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
From these results , we propose a model in testicular germ cell tumors , in particular embryonal carcinomas , whereby the overexpression of cyclin D 2 , a gene localized on chromosome 12p a region of DNA amplification in germ cell tumors leads to the functional sequestration of p 27 in the presence of cyclin E and cyclin D 2 , thus favoring cellular proliferation . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The eukaryotic polymerase processivity factor , proliferating cell nuclear antigen ( PCNA ) , interacts with many cell cycle regulator proteins and with proteins involved in the mechanisms of DNA replication and repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
An antisense mediated decrease in c Myc expression results in decreased cyclin D 1 expression and inhibition of DNA synthesis , mimicking the effects of antiestrogen treatment and emphasizing the importance of c Myc as an estrogen / antiestrogen target . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Hepatocytes adherent to collagen film spread extensively , express cyclin D 1 , and increase DNA synthesis in response to epidermal growth factor , whereas hepatocytes adherent to collagen gel have increased differentiated function , but lower DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here , the presence of rapid / nongenomic , estradiol regulated , PI3K / AKT signal transduction pathway , its modulation by the levels of the tumor suppressor PTEN , its cross talk with the ERK pathway , and its involvement in DNA synthesis and cyclin D 1 gene promoter activity have all been studied in HepG 2 cells . 17beta Estradiol induced the rapid and biphasic phosphorylation of AKT . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
TGF beta 1 inhibited DNA synthesis and cyclin dependent kinase ( CDK ) activity after release from growth arrest in association with induction of the p 21 CDK inhibitor , whereas cyclins , CDKs , and p 27 protein levels remained relatively unchanged . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The present investigation measured the abundance and localization of cyclin A protein , which is uniquely present in proliferating cells and required for the entry of vertebrate cells into the DNA synthesis phase during the time course of chicken ALD loading . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The tumor suppressor p33ING1 has growth inhibitory and pro apoptotic effects recruiting p 53 and it plays a role in DNA repair through interaction with PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Liver weight , protein and DNA contents , DNA synthesis ( 5 ' bromodeoxyuridine ( BrdU ) incorporation ) and cellular levels of Cyclin E , CDK 2 , CDK 4 and proliferating cell nuclear antigen ( PCNA ) were assessed before and 24 , 48 , 72 and 168 h after PBL . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To a lesser extent , PCNA homozygous and heterozygous mutants also show MSI in the germline , which reveals the importance of DNA replication factors to maintain genomic stability in vivo . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) was originally characterised as a DNA sliding clamp for replicative DNA polymerases and as an essential component of the eukaryotic chromosomal DNA replisome . ^^^ Proliferating cell nuclear antigen ( PCNA ) was originally characterised as a DNA sliding clamp for replicative DNA polymerases and as an essential component of the eukaryotic chromosomal DNA replisome . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) is an essential component for eukaryotic chromosomal DNA replication and repair . ^^^ PCNA forms a homotrimer ring , which may function as a DNA sliding clamp for DNA polymerases and , possibly , a docking station for other replication and repair related proteins . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Incubation with beta endorphin for 48 h increased the number of AHPs found in mitosis , the total DNA content , and the expression of proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
During the process of carcinogenesis , changes in hepatic gene expression of DNA repair proteins / enzymes ( XPA and XPC , xeroderma pigmentosum complementation groups A and C , respectively ; APE , apurinic / apyrimidinic endonuclease ) and of cell proliferation associated proteins ( c myc ; PCNA , proliferating cell nuclear antigen ; cyclin D 1 , cyclin B , and p34cdc2 ) were examined by RT PCR . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
By using hemi nested polymerase chain reaction ( PCR ) the genomic DNA from fresh peripheral blood and bone marrow was amplified and the expression of cyclin D 1 in the smears was detected by using immunohistochemical method . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cell cycle dependent phosphorylation of human DNA ligase 1 at the cyclin dependent kinase sites . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Featured prognostic molecular markers can be divided into the following categories : cell proliferation indices ( Ki 67 , Mib 1 , proliferating cell nuclear antigen ) ; oncogenes / tumor suppressor genes [ p 53 , K ras , Deleted in Colorectal Cancer ( DCC ) , Bcl 2 , c erbB 2 ] ; DNA repair ( microsatellite instability ) ; markers of angiogenesis ( vascular count , vascular endothelial growth factor ) ; markers of invasion / metastasis ( plasminogen related molecules , matrix metalloproteinases ) ; and biochemical markers ( thymidylate synthase ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Betacellulin and amphiregulin induce upregulation of cyclin D 1 and DNA synthesis activity through differential signaling pathways in vascular smooth muscle cells . ^^^ BTC increased cyclin D 1 mRNA , cyclin D 1 protein , and DNA synthesis activity . ^^^ Pretreatment with the phosphatidylinositol 3 ' kinase ( PI 3 ' kinase ) inhibitor wortmannin suppressed BTC induced cyclin D 1 mRNA and protein and DNA synthesis activity . ^^^ In contrast , AR , a specific ErbB 1 ligand , induced sustained ERK1 / 2 and Elk 1 phosphorylation , increased cyclin D 1 mRNA and protein , and increased DNA synthesis activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , with DNA array technique , we showed that the expression of p 202 was accompanied by downregulation of G2 / M phase cell cycle regulators , cyclin B , and p55cdc . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
TNP 470 also decreased PCNA expression in the neointima and inhibited DNA synthesis of cultured SMCs . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
CAF 1 and PCNA interact as major regulators of chromatin assembly during DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
On the other hand , in cultures of rMFs , cell number increases along with DNA synthesis , and these cells do not become multinuclear . `` Activated ' ' HSCs produce higher levels of cyclin D ( 1 ) and E ( 1 ) transcripts than rMFs , which correlates with their increased levels of phosphorylated retinoblastoma ( Rb ) protein . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
BACKGROUND : The neurotropic herpes simplex virus mutant HSV 1716 lacks the gene encoding the virulence factor ICP34 . 5 and can not replicate in non dividing cells where proliferating cell nuclear antigen ( PCNA ) is not actively engaged in cellular DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Quantitative detection of binding of PCNA protein to DNA strands on a 27 MHz quartz crystal microbalance . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The inserted sequence had no sequence identity with other eukaryotic counterparts of DNA ligase 4 or with another aspartic acid and glutamic acid rich sequence inserted in C . cinereus proliferating cell nuclear antigen ( CcPCNA ) , although the length and the percentages of aspartic and glutamic acids were similar . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Previously the authors showed that ICP34 . 5 binds to proliferating cell nuclear antigen ( PCNA ) , a protein necessary for cellular DNA replication and repair . ^^^ Here the authors demonstrate that ( 1 ) the interaction between ICP34 . 5 and PCNA involves two regions of the virus protein ; ( 2 ) ICP34 . 5 forms a complex with HSV replication proteins that is DNA binding ; ( 3 ) at early times in infection , ICP34 . 5 colocalizes with PCNA and HSV replication proteins in cell nuclei , before accumulating in the cytoplasm ; and ( 4 ) ICP34 . 5 is a virion protein . ^^^ The herpes simplex virus ( HSV ) protein ICP34 . 5 is a virion component that forms a DNA binding complex with proliferating cell nuclear antigen and HSV replication proteins . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA damage by a radiomimetic drug or replication block by hydroxyurea stimulated a buildup of cyclin B 1 but was accompanied by an increase of inhibitory phosphorylation of CDC 2 . ^^^ After DNA damage and replication block , all cyclin CDK pairs that control S phase and mitosis were to different degrees inhibited by phosphorylation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Methylated Ub , a chemically modified Ub that can not form chains , and S5a , a Ub chain binding subunit of the 26S proteasome , were added to extract at concentrations known to inhibit cyclin B proteolysis and their effects on cell cycle progression and DNA replication were examined . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin D 1 HLH region was also required for repression of the PPAR gamma ligand binding domain linked to a heterologous DNA binding domain . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
By using yeast two hybrid technology and the TYLCSV REn protein as bait , we have isolated three clones of the proliferating cell nuclear antigen ( PCNA ) of Arabidopsis thaliana , a ring shaped protein that encircles DNA and plays an essential role in eukaryotic chromosomal DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is a DNA polymerase delta accessory protein , and is an indicator of the proliferative state of the cell . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a DNA polymerase delta accessory protein , and is an indicator of the proliferative state of the cell . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We addressed the analysis of the physical and functional association of proliferating cell nuclear antigen ( PCNA ) , a protein involved in many DNA transactions , with poly ( ADP ribose ) polymerase ( PARP 1 ) , an enzyme that plays a crucial role in DNA repair and interacts with many DNA replication / repair factors . ^^^ We demonstrated that PARP 1 and PCNA co immunoprecipitated both from the soluble and the DNA bound fraction isolated from S phase synchronized HeLa cells . ^^^ Conversely , the effect of PARP 1 on PCNA dependent DNA synthesis was assessed by a DNA polymerase delta assay . ^^^ These observations suggest that PARP 1 and p 21 could cooperate in regulating the functions of PCNA during DNA replication / repair . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Both the five and seven subunit Ctf 18 RFC complexes bind to single stranded and primed DNAs and possess weak ATPase activity that is stimulated by the addition of primed DNA and proliferating cell nuclear antigen ( PCNA ) . ^^^ These complexes catalyzed the ATP dependent loading of PCNA onto primed and gapped DNA but not onto double stranded nicked or single stranded circular DNAs . ^^^ Consistent with these observations , both Ctf 18 RFC complexes substituted for the replicative RFC in the PCNA dependent DNA polymerase delta catalyzed DNA replication reaction . ^^^ The alternative Ctf 18 Dcc1 Ctf 8 replication factor C complex required for sister chromatid cohesion loads proliferating cell nuclear antigen onto DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using fluorescent tags , we analysed subnuclear localisations of the DNA damage checkpoint protein Rad 9 , of the homologous recombination protein Rad 22 and of PCNA , which are implicated in many aspects of DNA metabolism . ^^^ Likewise , Rad 22 and PCNA form foci despite inactive homologous recombination repair and impaired DNA damage checkpoint . ^^^ Thus , in fission yeast , DSBs are detected by the DNA damage checkpoint and are repaired by homologous recombination at a few spatially confined subnuclear compartments where Rad 22 , Rad 9 and PCNA concentrate independently . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factor C ( RF C ) complex binds to DNA primers and loads PCNA onto DNA , thereby increasing the processivity of DNA polymerases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin dependent kinase inhibitor p 27 ( Kip 1 ) regulates both DNA synthesis and apoptosis in mammary epithelium but is not required for its functional development during pregnancy . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Because PCNA also participates in DNA repair , these results raise the possibility that p 21 also affects repair of oxidized DNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Chromatin structure plays an important role in DNA replication , repair , and transcription . p 300 is a transcriptional coactivator with protein acetyltransferase activity , and proliferating cell nuclear antigen ( PCNA ) plays important roles in DNA replication and repair . ^^^ The reciprocal modulation of p 300 and PCNA activities by each other provides an example of integrative regulatory cross talk among chromatin based processes such as DNA transcription , repair , and synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A and B 1 were immunologically stained with Alexa Fluor 488 , and nuclear DNA was stained with propidium iodide . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Molecular analyses revealed that cells lacking cyclin E fail to normally incorporate MCM proteins into DNA replication origins during G ( 0 ) > S progression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Synthesis with eukaryotic DNA polymerases alpha , delta , and epsilon involves various replication factors , including the replication protein A , replication factor C , proliferating cell nuclear antigen , etc . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Additional investigations also showed that at concentrations of 5 10 microM PEITC , DNA synthesis was inhibited and G2 / M phase cell cycle arrest occurred , correlating with an alteration in cyclin B 1 and p 34 ( cdc 2 ) protein levels . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The roles of RPA and PCNA in the formation of incisions at ICLs and in the subsequent DNA synthesis step were assessed . ^^^ PCNA is required for the DNA synthesis stage and although it is not critical for the incision stage of the reaction it does enhance this step presumably by a stimulation of lesion recognition by MutSbeta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These molecular events are likely to play a role in mediating activation of PCNA gene expression by p 53 during the cellular response to DNA damage . ^^^ This differential regulation of PCNA and p21 / wild type p 53 activated factor may establish the proper ratio of the two proteins to coordinate DNA repair with cell cycle arrest . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We characterized immunohistochemically the expression of cell cycle regulators p 63 , CD 29 , PCNA , p 53 , pro and antiapoptotic proteins bcl 2 , bax , caspase 3 and DNA breaks , as well as keratin 10 , 16 and 17 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
S phase DNA synthesis and PCNA immunohistochemical staining after injury showed early and robust tissue repair in WT DB mice , but not in the PPAR alpha / DB mice . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Pretreatment of rHuEPO resulted in the following : 1 ) decreased serum creatinine level ; 2 ) decreased tubular cell apoptosis and necrosis , measured by DNA fragmentation analysis and TUNEL staining and histomorphological criteria ; 3 ) decreased tubular cell proliferation as determined by proliferating cell nuclear antigen expression ; 4 ) increased bcl 2 protein and decreased caspase 3 activity ; and 5 ) decreased JNK expression . rHuEPO treatment increased HSP 70 expression in a dose dependent manner in normal rat kidneys , and inhibition of HSP 70 expression by quercetin eliminated the renoprotective effect of rHuEPO in ischemic kidneys . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Activation of endogenous ( PRL ) or transfected estrogen responsive genes occurs at the same , higher concentrations of E 2 required to promote cell survival , whereas stimulation of cyclin D 3 expression and DNA synthesis occur at lower E 2 concentrations . ^^^ Similarly , the pure antiestrogen ICI 182 , 780 inhibits estrogen response element dependent trans activation and cell death more effectively than cyclin cdk activity , G 1 S transition , or DNA synthesis rate . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Subsequently , the relationship of Cyclin D 1 with apoptosis was elucidated in a colocalization experiment in BM biopsy sections using immunohistochemistry for Cyclin D 1 and in situ end labeling of DNA ( ISEL ) for apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Ubiquitin and SUMO compete for modification of proliferating cell nuclear antigen ( PCNA ) , an essential processivity factor for DNA replication and repair . ^^^ Here we show that RAD 6 mediated mono ubiquitination of PCNA activates translesion DNA synthesis by the damage tolerant polymerases eta and zeta in yeast . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results suggest that p 21 suppressed synthesis of DNA via PCNA , and TGF beta 1 is a regulation factor for the expression of p 21 , and that the combination of p 53 and p 21 expression is concluded to be a useful prognostic marker of gastric carcinoma . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA replication alternates with gap phases and cell cycle specific cyclin E expression is maintained . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
XRad 9 , XRad 1 , and XHus 1 ( components of the 9 1 1 complex ) all show homology to the DNA polymerase processivity factor PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Calvarial cells but not embryonic fibroblasts from Runx 2 ( / ) or Runx 2 ( DeltaC / DeltaC ) mutant mice exhibit increased cell growth rates as reflected by elevations of DNA synthesis and G ( 1 ) S phase markers ( e . g . , cyclin E ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The ability of the cyclin dependent kinase ( CDK ) inhibitor p21CDKN1A to interact with PCNA recruited to DNA replication sites was investigated to elucidate the relevance of this interaction in cell cycle arrest . ^^^ CDKN1A does not interfere with loading of PCNA at DNA replication sites , but inhibits subsequent binding of DNA polymerase delta at the G1 / S phase transition . ^^^ Association of p 21 to chromatin bound PCNA resulted in the loss of interaction with the p 125 catalytic subunit of DNA polymerase delta ( pol delta ) . ^^^ These results suggest that in vivo p 21 does not interfere with loading of PCNA at DNA replication sites , but prevents , or displaces subsequent binding of pol delta to PCNA at the G1 / S phase transition . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This can engage proteasome dependent cyclin degradation , causing G ( 1 ) arrest and this permits repair of genomic DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin dependent kinase ( CDK ) 2 interacting cyclins perform essential functions for DNA replication and cellular proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
There was no cyclin D 1 expression in the control group . ( 2 ) beta actin DNA was detected in 101 of the 107 tumor cases ( 94 . 4 % ) . t ( 11 ; 14 ) was detected in 22 of the 36 MCL . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We describe ( 1 ) the role of ATP in remodelling the NER initiating complex of XPC / TFIIH / damaged DNA as a prerequisite for the recruitment of the next NER factors ; ( 2 ) the coordination between damage removal and DNA resynthesis and the release of XPC HR23B , TFIIH and XPA upon arrival of XPG and XPF ERCC 1 , respectively ; ( 3 ) how RPA remains associated with the excised DNA initiating the assembly of resynthesis factors such as PCNA ; ( 4 ) the recycling of XPC HR23B , TFIIH and XPA in the NER ; and the shuttling of TFIIH between NER and transcription . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA damage during the spindle assembly checkpoint degrades CDC25A , inhibits cyclin CDC 2 complexes , and reverses cells to interphase . ^^^ Cells did not progress into G 1 but seemed to retract to a G 2 like state containing 4N DNA content , with stabilized cyclin A and cyclin B 1 binding to Thr14 / Tyr15 phosphorylated CDC 2 . ^^^ Extensive DNA damage during mitotic block inactivated cyclin B 1 CDC2 and prevented G 1 entry when the block was removed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cdc 6 is known to be phosphorylated by cyclin A cyclin dependent kinase 2 ( Cdk 2 ) , an event that promotes its exit from the nucleus and probably blocks it from initiating inappropriate DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The S phase specificity of detectable cyclin A was also assessed in combination with in situ DNA replication using fluorescence confocal microscopy . ^^^ No cells expressed cyclin A in the absence of active DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RESULTS : Marked elevations in DNA synthesis , as assessed by BrdU incorporation and proliferating cell nuclear antigen ( PCNA ) immunoreactivity , were confirmed in psoriatic epithelial cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Promyelocytic leukemia zinc finger ( PLZF ) protein is a sequence specific DNA binding protein that represses the transcriptional activity of target genes such as those for cyclin A and the interleukin 3 receptor alpha chain . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Multiple strong contact points to PCNA may reflect the extra demands of loading the PCNA trimeric ring onto DNA compared with the dimeric beta ring . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In CM and CF , 4 OH tamoxifen and ICI 182 , 780 treatment reduced proliferating cell nuclear antigen protein expression and concomitantly increased p27Kip1 . 4 OH Tamoxifen and ICI 182 , 780 treatment increased ERK1 / 2 phosphorylation in CM and CF , and ERK1 / 2 kinase ( MEK ) dependent inhibition of ERK1 / 2 activation attenuated ICI 182 , 780 mediated suppression of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Liver was harvested 3 , 5 , and 7 days after sham operation or BDL , and immunohistochemistry for proliferating cell nuclear antigen and terminal dUTP nick end labeling was performed for detection of DNA synthesis and apoptosis , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Follicle stimulating hormone induced DNA synthesis in the granulosa cells of hamster preantral follicles involves activation of cyclin dependent kinase 4 rather than cyclin d 2 synthesis . ^^^ Although cyclin D 2 mRNA synthesis precedes gonadotropin induced DNA synthesis in quiescent granulosa cells in culture , it is unclear whether a similar mechanism exists for the granulosa cells of growing preantral follicles in cyclic animals . ^^^ The objective was to evaluate whether the synthesis of cyclin D 2 protein was a prerequisite for FSH induced DNA synthesis in the granulosa cells of intact preantral follicles of cyclic hamsters . ^^^ FSH stimulated cyclin dependent kinase ( CDK ) 4 activity by 2 h and DNA synthesis by 4 h without altering the levels of cyclin D 2 in the granulosa cells . ^^^ In contrast to granulosa cells in intact follicles , FSH or cAMP significantly increased cyclin D 2 protein levels in cultured granulosa cells but failed to induce DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The quality of NMPs was monitored by Western blot analysis including DNA topoisomerase IIalpha , proliferation cell nuclear antigen ( PCNA ) and histone . ^^^ RESULTS : Western blot analysis revealed that DNA topoisomerase IIalpha and PCNA were detected , and the majority of histones were deleted in NMPs of SHEE and SHEEC . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis and cyclin D 1 expression were suppressed in hepatocytes grown on the glycopolymer as compared with those grown on fibronectin and collagen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin kinase inhibitor p 21 associates with and inhibits cyclin CDKs to retard the progress of the cell cycle in response to DNA damage . ^^^ After transfection with an expression vector containing cDNA of various p 21 mutants , cells were irradiated with 10 Gy of gamma rays to introduce DNA damage , followed by quantification of the p 21 cyclin A association . ^^^ This suggests that DNA damage triggers a signal to the p 21 region between 21 and 96 aa to allow cyclin A association . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The downstream effect of the inhibitor is a failure to recruit proliferating cell nuclear antigen , but not DNA polymerase alpha , to the nascent replication fork . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These features are believed to be provided by interaction with processivity factors , beta clamp or proliferating cell nuclear antigen ( PCNA ) , which are also essential for the function of replicative DNA polymerases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The Pol 32 subunit of DNA polymerase delta contains separable domains for processive replication and proliferating cell nuclear antigen ( PCNA ) binding . ^^^ However , the presence of its carboxyl terminal PCNA binding domain enhances the efficiency of mutagenesis , particularly at high loads of DNA damage . ^^^ In vitro , in the absence of effector DNA , the PCNA binding domain of Pol 32 is essential for PCNA Pol delta interactions . ^^^ However , this domain has minimal importance for processive DNA synthesis by the ternary DNA PCNA Pol delta complex . ^^^ Using diagnostic PCNA mutants , we show that during DNA synthesis the carboxyl terminal domain of Pol 32 interacts with the carboxyl terminal region of PCNA , whereas interactions of the other subunit ( s ) of Pol delta localize largely to a hydrophobic pocket at the interdomain connector loop region of PCNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin dependent kinase inhibitor p 21 , a major transcriptional target of the tumor suppressor p 53 , plays a critical role in cell cycle arrest in G 1 and G 2 after DNA damage . ^^^ Importantly , DNA elongation assays in isolated nuclei show that the C terminus of p 21 containing the PCNA binding domain effectively blocks this process . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA methylation of RASSF1A , HIN 1 , RAR beta , Cyclin D 2 and Twist in in situ and invasive lobular breast carcinoma . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Unlike replication factor C ( RFC ) , which uses the 3 ' primer / template junction to recruit proliferating cell nuclear antigen ( PCNA ) , the Rad 17 Rfc2 5 complex can use both the 5 ' and the 3 ' primer / template junctions to recruit the Rad 9 Rad1 Hus 1 complex , and it shows a preference for gapped DNA structures . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Content of DNA and telomerase as well as multi gene expressions such as p 53 , p 21 and cyclin D 1 in esophageal precancer cells were quantitatively analysed by flow cytometry ( FCM ) with indirect immunofluorescence technique and DNA propidium iodide fluorescence staining . ^^^ CONCLUSION : Increased DNA content and heteroploid rate , accumulation of p 53 protein , and over expression of p 21 , telomerase and cyclin D 1 proteins were early molecular events during the development of esophageal cancer . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin E / Cdk2 , a central regulator of the G1 / S transition , coordinates multiple cell cycle events , including DNA replication , centrosome duplication , and activation of the E2F transcriptional program . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results suggest that DNA hypomethylation is a mechanism underlying the increased expression of cyclin D 2 in cancer cells and that demethylation of cyclin D 2 may be involved in development and progression of gastric carcinoma . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In nontransformed cell lines , lack of cyclin B 1 accumulation was observed when DNA synthesis was inhibited . ^^^ In the tumour cell lines , a good correlation between the ability to arrest cell cycle when DNA synthesis was inhibited in the presence of caffeine and the lack of cyclin B 1 accumulation was observed . ^^^ Lack of cyclin B 1 accumulation after DNA synthesis inhibition in NRK cells was not due to increased degradation of the protein , but correlated with a decrease in mRNA accumulation . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Instead , proliferating cell nuclear antigen ( PCNA ) dissociated from chromosomes following IR in Ku 80 deficient cells but not in wild type or DNA PKcs deficient cells . ^^^ Together , these results suggest that binding of the Ku complex at chromosomal breaks may be necessary to maintain the sliding clamps ( PCNA ) on chromatin , which would allow cells to resume DNA replication without a major delay following IR . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The tissue specific expression pattern of the transcripts of Rpt 6 and PCNA suggested that the rice proteasome played important roles in DNA replication involving PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The heteropentamer replication factor C ( RFC ) loads during DNA replication the homotrimer proliferating cell nuclear antigen ( PCNA ) polymerase clamp onto DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis by DNA polymerase delta / epsilon is dependent on proliferating cell nuclear antigen , which also stimulates the DNA ligase 1 and flap endonuclease . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Fidelity of DNA polymerase delta holoenzyme from Saccharomyces cerevisiae : the sliding clamp proliferating cell nuclear antigen decreases its fidelity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Chem . 278 , 9754 9760 ] , we hypothesize that the interaction between AKAP 95 and D type cyclins might serve to facilitate the emerging regulatory role of cyclin D CDK 4 in the formation of the prereplication complex at the DNA replication origins . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In human hepatocellular carcinoma in cirrhosis proliferating cell nuclear antigen ( PCNA ) is involved in cell proliferation and cooperates with P 21 in DNA repair . ^^^ BACKGROUND : Proliferating cell nuclear antigen ( PCNA ) is a nuclear protein involved in DNA synthesis and repair . ^^^ During DNA synthesis and repair the only active PCNA fraction is tightly bound to DNA . ^^^ Similarly , during DNA repair , a fraction of p 21 colocalizes with PCNA in a detergent insoluble form . ^^^ AIM : The aim of the study was to analyze to what extent the presence of DNA bound PCNA and p 21 correlates with cell proliferation and DNA repair in hepatocellular carcinoma ( HCC ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here , the role of p 38 MAP kinase was further investigated in relation to its participation in 6 nitro 7 hydroxycoumarin induced apoptosis . 6 Nitro 7 hydroxycoumarin was shown to alter cell cycle progression , leading to the appearance of a sub G ( 1 ) peak , containing hypodiploid DNA , accompanied by increases in both poly ( ADP ribose ) polymerase cleavage and decreased expression of cyclin D 1 . ^^^ Drug treatment also lead to a rise in the expression in the cyclin dependent kinase inhibitor , p 21 ( WAF1 / CIP1 ) , and the appearance of inter nucleosomal DNA cleavage and morphological changes , consistent with apoptotic cell death . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , the rescue of E2F activity , cyclin A expression , and DNA synthesis by expression of E can be blocked by the expression of either CDK 2 ( D145N ) or RbDeltaCDK , a constitutively active mutant of pRb . ^^^ These data indicate that CDK 2 cyclin E , without prior CDK 4 cyclin D activity , can phosphorylate and inactivate pRb , activate E2F , and induce DNA synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
When CDK 2 activity was bypassed by activation of the ER E2F1 fusion protein , cAMP no longer inhibited expression of Cdc25A or cyclin A but still inhibited DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication factor C ( RFC ) catalyzes the assembly of circular proliferating cell nuclear antigen ( PCNA ) clamps around primed DNA , enabling processive synthesis by DNA polymerase . ^^^ The DNA elongation rate of the family B DNA polymerase from T . kodakaraensis KOD 1 ( KOD DNA polymerase ) , which has the highest elongation rate in all thermostable DNA polymerases , was increased about 1 . 7 times , when T . kodakaraensis KOD 1 PCNA ( Tk PCNA ) and the Tk RFC at the equal molar ratio of KOD DNA polymerase were reacted with primed DNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
When we examined immunohistochemically the expression of various antigens such as proliferating cell nuclear antigen ( PCNA ) , p 53 and LeY or the presence of DNA fragmentation by nick end labelling in the biopsy materials taken at the first visit to our clinic from 20 patients treated with the current therapy , the CR group showed a significantly increased LeY expres sion level ( p < 0 . 05 ) and DNA fragmentation rate ( p < 0 . 05 ) as compared with the partial response ( PR , n= 3 ) + no change ( NC , n= 1 ) group . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Others , such as histological type , grading according to Hu classification , depth of tubal wall invasion , the presence of neoplastic cells in peritoneal leakage , invasion of the lymphatic and blood vessels , mitotic activity , DNA ploidy , Ki 67 expression , AgNOR level and p 53 and c erbB 2 immunoreactivity , are not widely accepted . 70 cases of primary Fallopian tube carcinomas were analysed with regard to clinicopathological data , survival and the expression of proliferating cell nuclear antigen ( PCNA ) and laminin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
After concanavalin A stimulation , whole blood cultures were analyzed by flow cytometry detecting lymphocyte proliferation and activation by bivariate expression of proliferating cell nuclear antigen ( PCNA ) / DNA content and T cell surface activation antigens ( e . g . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
However , UL 42 is structurally similar to sliding clamp processivity factors , such as PCNA , which encircle DNA as a multimeric ring . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Whereas the up regulated genes include cyclin D 1 , p21WAF1 , p141NK4B / p15INK5B , Clusterin , inhibitor of DNA binding 1 ( ID 1 ) and others . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We show that hEXO 1 colocalizes with proliferating cell nuclear antigen ( PCNA ) at DNA replication sites and that the C terminal region of hEXO 1 is sufficient for this localization . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In pristane treated DA rats the MHC class 2 beta chain , gelatinase B ( Mmp 9 ) and the protein tyrosine phosphatase CL 100 ( Ptpn 16 ) were expressed at a higher level , whereas immunoglobulins , the CD 28 molecule ( Cd 28 ) , the mast cell specific protease 1 ( Mcpt 1 ) , the carboxylesterase precursor ( Ces 2 ) , K cadherin ( Cdh 6 ) , cyclin G 1 ( Ccng 1 ) , DNA polymerase 4 ( Primase ) and the tumour associated glycoprotein E 4 ( Tage ) were expressed at a lower level . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A C / EBP inhibited events associated with hormone induced entry of S phase of the cell cycle , including the turnover of p27 / Kip1 , a key cyclin dependent kinase inhibitor , expression of cyclin A and cyclin dependent kinase 2 , DNA replication , MCE , and , subsequently , adipogenesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we report that in Saccharomyces cerevisiae , a build up or burst of G 1 cyclin dependent kinase ( CDK ) activity through activation of the cyclin genes CLN 1 , 2 and PCL 1 , 2 is essential for cell morphogenesis , but not for other events associated with the G 1 S phase transition , including DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proteins known to be involved in DNA synthesis , such as PCNA and DNA polymerase delta , are concentrated in perinucleolar foci throughout S phase under these conditions . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Consistent with the properties of this family of proteins in other cell systems , 3T3L1 cells stably overexpressing FBI 1 showed reduced DNA synthesis and reduced expression of cyclin A , cyclin dependent kinase 2 , and p 107 , proteins known to be involved in the regulation of mitotic clonal expansion . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
HHV 8 infection was ascertained immunohistochemically with use of an antibody directed against latency associated nuclear antigen 1 ( LANA 1 ) , and a polymerase chain reaction ( PCR ) assay was performed on lung DNA to detect the viral cyclin gene of HHV 8 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This inhibitory activity is not due to sequestration of replication factors by the damaged DNA , rather , it acts through generation of a diffusible inhibitor of PCNA loading . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Induction of cyclin dependent kinase inhibitor p21WAF1 by p 53 after DNA damage plays an important role in cell cycle arrest after gamma irradiation . ^^^ It is known that p21WAF1 binds PCNA and inhibits PCNA function in DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To evaluate the role of cyclin D 1 in the biological regulation of ACC , we constitutively expressed an antisense cyclin D 1 complementary DNA ( cDNA ) in an established ACC cell line that exhibits high endogenous expression of cyclin D 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Structural basis for FEN 1 substrate specificity and PCNA mediated activation in DNA replication and repair . ^^^ Flap EndoNuclease 1 ( FEN 1 ) and the processivity factor proliferating cell nuclear antigen ( PCNA ) are central to DNA replication and repair . ^^^ To clarify the molecular basis of FEN 1 specificity and PCNA activation , we report here structures of FEN 1 : DNA and PCNA : FEN 1 peptide complexes , along with fluorescence resonance energy transfer ( FRET ) and mutational results . ^^^ Ordering of unstructured C terminal regions in FEN 1 and PCNA creates an intermolecular beta sheet interface that directly links adjacent PCNA and DNA binding regions of FEN 1 and suggests how PCNA stimulates FEN 1 activity . ^^^ The DNA and protein conformational changes , composite complex structures , FRET , and mutational results support enzyme PCNA alignments and a kinked DNA pivot point that appear suitable to coordinate rotary handoffs of kinked DNA intermediates among enzymes localized by the three PCNA binding sites . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 expression and cell cycle response in DNA mismatch repair deficient cells upon methylation and UV C damage . ^^^ At later time points , however , only DNA damage arrested cells showed decreased cyclin D 1 levels irrespective of MMR status , indicating that reduced cyclin D 1 could be a result of a smaller fraction of cells being in G 1 phase rather than a result of an intact MMR system . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have used DNase 1 to release DNA bound PCNA together with replication proteins including the p 125 catalytic subunit of DNA polymerase delta ( p 125 pol delta ) , DNA ligase 1 , cyclin A , and cyclin dependent kinase 2 ( CDK 2 ) . ^^^ Proliferating cell nuclear antigen ( PCNA ) plays an essential role in DNA replication , repair , and cell cycle control . ^^^ PCNA is a homotrimeric ring that , when encircling DNA , is not easily extractable . ^^^ Consequently , the dynamics of protein protein interactions established by PCNA at DNA replication sites is not well understood . ^^^ Interaction with these proteins was investigated by immunoprecipitation with antibodies binding near the interdomain connector loop or to the C terminal domain of PCNA , respectively , or with antibodies to p 125 pol delta or DNA ligase 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
One large group is expressed at the G 1 S transition and includes cyclin genes , whose products control the p 34 ( CDC 28 ) protein kinase , as well as many genes essential for DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The end points evaluated included cell apoptosis ( morphology and in situ end labelling [ ISEL ] , viability [ lactate dehydrogenase ( LDH release ) ] , cell proliferation [ proliferating cell nuclear antigen ( PCNA ) ] and DNA synthesis ( thymidine incorporation ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cell death induced in this ischemic model was evaluated by a series of markers : lactate dehydrogenase ( LDH ) release , caspase 3 activation , presence of cyclin D 1 , cytochrome c leakage from the mitochondria , BAX cellular redistribution , cleavage of poly ( ADP ribose ) polymerase ( PARP ) to an 85 kDa apoptotic fragment , and DNA fragmentation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
However , absence of p 53 did not appear to accelerate K cyclin induced lymphomagenesis by averting apoptosis : E micro K cyclin / p53 ( / ) end stage lymphomas contained abundant apoptotic cells , and transgenic E micro K cyclin / p53 ( / ) lymphocytes in vitro were not measurably protected from DNA damage induced apoptosis compared with E micro K cyclin / p53 ( wt ) cells . ^^^ Notably , whereas aneuploidy was frequently evident in pre lymphomatous tissues , end stage E micro K cyclin / p53 ( / ) tumors showed a near diploid DNA content with no aberrant centrosome numbers . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cell cycle dependent phosphorylation of the DNA polymerase epsilon subunit , Dpb 2 , by the Cdc 28 cyclin dependent protein kinase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Ectopically expressed Cdc 6 is translocated from the nucleus during S phase in a cyclin A Cdk 2 dependent process , suggesting that reinitiation of DNA replication is prevented by removal of phosphorylated Cdc 6 from chromatin after origin firing . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RESULTS AND CONCLUSIONS : After 12 h of treatment , in parallel with the 1 , 25 ( OH ) 2D3 induced G 1 arrest , a particular set of DNA replication genes including a cell division cycle 6 homolog , a DNA polymerase alpha subunit , proliferating cell nuclear antigen , two DNA polymerase delta subunits , and flap structure specific endonuclease 1 , was downregulated at least 2 fold . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Multiple biomarkers ( DNA contents , AgNOR , PCNA , p 53 , c erbB 2 ) in 10 normal colorectal mucosae , 37 colorectal adenomas and 55 colorectal cancers were analyzed quantitatively in the computed processing imaging system . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This impaired S checkpoint induced by CPT or IR in Hus 1 deficient cells reflected mainly the chain elongation step of DNA replication and was correlated with the reduction of dissociation of PCNA from DNA replication foci . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The absence of Fbw 7 results in elevated levels of cyclin E , concurrent with inappropriate DNA replication in placental giant trophoblast cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin E is essential for progression through the G 1 phase of the cell cycle and initiation of DNA replication by interacting with and activating its catalytic partner , the cyclin dependent kinase 2 ( Cdk 2 ) . ^^^ Rb , as well as Cdc 6 , NPAT , and nucleophosmin , critical components of cell proliferation and DNA replication , respectively , are targets of Cyclin E / Cdk2 phosphorylation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Activation of the G ( 1 ) checkpoint following DNA damage leads to inhibition of cyclin E Cdk 2 and subsequent G ( 1 ) arrest in higher eucaryotes . ^^^ We demonstrate that DNA damage induced by ionizing radiation results in the suppression of phosphorylation of NPAT , an in vivo substrate of cyclin E Cdk 2 kinase and an essential regulator of histone gene transcription , and its dissociation from histone gene clusters in a p53 / p21 dependent manner . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Because hypertrophy is a result of increased protein content per cell without DNA replication , those proteins that control the cell cycle , such as the cyclin kinase inhibitor p 21 , represent fertile ground for studying the mechanism of this structural alteration . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
However , treatment with ADR or cisplatin is accompanied by a significant increase and redistribution of RAD 6 to DNA , and RAD 6 , RAD 18 , PCNA , phosphohistone H 3 , as well as p 53 proteins are all found in the DNA fractions . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Ovarian expression of PCNA , a marker of DNA replication , repair , or both , did not differ between ob / ob and control mice . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We also found that deacetylation reduced the ability of PCNA to bind to DNA polymerases beta and delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It also interacts with several host proteins , including the cell cycle regulator , retinoblastoma , and essential components of the cell DNA replication machinery , like proliferating nuclear cell antigen ( PCNA ) and RFC 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PDGF ( platelet derived growth factor ) stimulated MAPK activity , up regulated protein levels of cyclin D 1 , CDK 2 ( cyclin dependent kinase 2 ) and PCNA ( proliferating cell nuclear antigen ) , decreased the protein level of p 27 and increased DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A high percentage of cells expressing nondestructible cyclin B 1 had doubled DNA content as a result of undergoing endomitosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Moreover , accumulation of repair proteins ( XPB and proliferating cell nuclear antigen ) at localized DNA damage sites , detected using micropore UV irradiation combined with fluorescent antibody labeling , reflected their DNA repair activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Candidate genes included DNA repair genes , methylenetetrahydrofolate reductase ( MTHFR ) and cyclin D 1 genes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Analyses of the cell cycle and cyclin expression suggested that C 18 SQMG arrested the cell cycle at intra S phase , and the inhibition manner of DNA replication by C 18 SQMG was similar to that by hydroxyurea . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA methylation status of portions of the ER alpha and cyclin D 1 gene promoters in liver tissue was measured using methylation specific polymerase chain reaction . ^^^ Exposed mice exhibited reduced ( by approximately 90 % ) methylation of the ER alpha gene promoter in liver DNA as compared with control mice ; the cyclin D 1 gene promoter was not methylated in either exposed or control mice . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
EXPERIMENTAL DESIGN : HIN 1 , Twist , Cyclin D 2 , RAR beta , and RASSF1A were analyzed in DNA from 67 AA and 44 Cau invasive ductal breast cancers , stratified by age and estrogen receptor / progesterone receptor ( ER / PR ) status , by methylation specific PCR . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Activation of cyclin E / cdk2 ( cyclin dependent kinase 2 ) at the end of G ( 1 ) is then required to trigger DNA synthesis ( S phase entry ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here , we show that the down regulation of Cdk1 / cyclin B is secondary to the activation of the DNA structure checkpoint kinase Chk 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
At amino acid residues Glu 276 Pro345 , a specific inserted sequence composed of 70 amino acids rich in polar forms was found to exist , without sequence identity to other eukaryotic FEN 1 or the polar amino acid rich sequences found in C . cinereus PCNA and C . cinereus DNA ligase 4 , although the lengths and percentages of polar amino acids were similar . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen accumulated in the epithelium of bile ducts on day 90 after repeated O . viverrini infection , supporting the hypothesis that cell proliferation was promoted by inflammation mediated DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The Rrm 3 DNA helicase of Saccharomyces cerevisiae interacts with proliferating cell nuclear antigen and is required for replication fork progression through ribosomal DNA repeats and subtelomeric and telomeric DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Amplification of the cyclin D 1 gene is associated with tumour subsite , DNA non diploidy and high S phase fraction in squamous cell carcinoma of the head and neck . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We constructed a recombinant adenovirus encoding YA aa and found that YA aa expression leads to repression of cell cycle regulatory genes , such as cyclin A , RNR R 2 , DNA polymerase alpha , cdc 2 , cyclin B , and cdc25C . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here , we summarize the role of cyclin dependent kinases in limiting DNA replication origin usage to once per cell cycle in the budding yeast Saccharomyces cerevisiae . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The purified Chl 12 RFC complex is structurally indistinguishable from RFC , as shown by electron microscopy , and it exhibits DNA stimulated ATPase activity that is further enhanced by PCNA , and by DNA binding activity on specific primer / template DNA structures . ^^^ Furthermore , the complex loads PCNA onto a circular DNA substrate , and stimulates DNA polymerase delta DNA synthesis on a primed M 13 single stranded template in the presence of purified replication proteins . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Unlike the well described sliding clamp processivity factors , eukaryotic proliferating cell nuclear antigen and Escherichia coli beta subunit , PF 8 and other herpesvirus processivity factors do not require a clamp loader or ATP to bind to template DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunohistochemical staining was used to study expression of proliferating cell nuclear antigen as an index of proliferative activity and single stranded DNA as an index of apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
FR 901228 also efficiently reduced the DNA binding of NF kappaB and AP 1 in HTLV 1 infected T cell lines and primary ATL cells and down regulated the expression of Bcl 10 ( L ) and cyclin D 2 , regulated by NF kappaB . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In both species , the increase in H 19 gene expression was preceded by the induction of proliferating cell nuclear antigen and DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin dependent kinases are critical regulators of eukaryotic DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We analyzed a series of parathyroid neoplasms with DNA fluorescent probes to evaluate the diagnostic and prognostic utility of numerical abnormalities of chromosomes 1 , 6 , 9 , 11 , 13 , 15 , 17 , and 22 and cyclin D 1 and p 53 gene loci . ^^^ Directly labeled fluorescent DNA probes for the centromere region of chromosomes 1 , 6 , 9 , 11 , 15 , and 17 , and locus specific probes for chromosome 22 and chromosome 13 and for cyclin D 1 and p 53 gene loci were used for dual probe hybridization . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We report here that XRCC 1 co localizes with proliferating cell nuclear antigen ( PCNA ) at DNA replication foci , observed exclusively in the S phase of undamaged HeLa cells . ^^^ The current evidence suggests a model where XRCC 1 is sequestered via its interaction with PCNA to sites of DNA replication factories to facilitate efficient SSBR in S phase . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study we examined whether the accumulation of Pol eta in replication foci after DNA damage is dependent on phosphorylation of the PCNA binding motif . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
OBJECTIVES : The telomere ( T ) length , p 21 ( WAF1 / CIP1 ) and p 27 ( Kip 1 ) cyclin dependent kinase inhibitor ( CDKI ) genes are considered the markers of cell senescence and DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Overexpression of cyclin E prior to the midblastula transition ( MBT ) , with or without cdk 2 , results in a loss of nuclear DNA and subsequent apoptosis at early gastrula stages . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Opposing effects of ubiquitin conjugation and SUMO modification of PCNA on replicational bypass of DNA lesions in Saccharomyces cerevisiae . ^^^ It has been shown recently that following treatment of yeast cells with DNA damaging agents , the lysine 164 residue of PCNA becomes monoubiquitinated in a Rad 6 Rad18 dependent manner and that subsequently this PCNA residue is polyubiquitinated via a lysine 63 linked ubiquitin chain in an Mms 2 Ubc13 , Rad 5 dependent manner . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The capacity of the large tumorantigen to bind the pocket proteins , pRB , p 130 and p 107 , is important for the transactivation of DNA synthesis enzymes and the cyclins E and A , while the interference of small tumorantigen with protein phosphatase PP2A causes a destabilization of the cdk 2 inhibitor p 27 , and thus leads to strong cyclin E and cyclin A dependent cdk 2 activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
When tumor cells retrieved from paraffin embedded tissue were examined by flow cytometry , higher proportions of cells expressing only cdk 4 or cyclin D 1 in type A cases and of cells expressing any cyclin or cdk in type B cases showed a subdiploid DNA content . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin dependent kinase ( CDK ) inhibitor p21CDKN1A is known to induce cell cycle arrest by inhibiting CDK activity and by interfering with DNA replication through binding to proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Also p 15 and p 16 have been identified to be involved in the pathogenesis of esophageal cancer by influencing the cyclin kinase inhibitor cascade and DNA mismatch repair processes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Aside from this specific function as a regulator of S phase entry , cyclin E plays a direct role in the initiation of DNA replication , the control of genomic stability , and the centrosome cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Interaction of human DNA polymerase eta with monoubiquitinated PCNA : a possible mechanism for the polymerase switch in response to DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We investigated expression patterns of DNA repair genes such as the CPD photolyase , UV DDB 1 , CSB , PCNA , RPA 32 and FEN 1 genes by northern hybridization analysis and in situ hybridization using a higher plant , rice ( Oryza sativa L . cv . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Regulation of the cyclin E Cdk 2 substrate NPAT , which is essential for both histone gene expression and S phase entry , provides a mechanism coordinating histone and DNA synthesis in mammalian cells . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
AS primer pairs were designed for nine candidate genetic variants in DNA repair and cell cycle / apoptotic regulatory genes , including Cyclin D 1 [ codon 870 splice site variant ( A > G ) ] ; BRCA 1 , P871L ; ERCC 2 , K751Q ; FAS 1377 ( G > A ) ; hMLH 1 93 ( G > A ) and V219I ; p 21 , S31R ; and the XRCC 1 R194W and R399Q variants . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These proteins link the cyclin A 1 CDK2 complex to diverse cellular processes such as DNA repair , signaling , and splicing . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A comparison between the PCNA nuclear level and the DNA content was performed . ^^^ The quality and the quantity of food eaten under ad libitum conditions were highly correlated with both the PCNA and DNA levels in the caeca cells . ^^^ Locusts fed a diet with a close to optimal P : C content ( P 21 % , C 21 % ) showed the highest PCNA and DNA content . ^^^ These results , combined with the low number of mitotic figures found in the regenerative nests of the caeca and the marked variation in PCNA levels among groups , suggest that some type of DNA endoreduplication process may be taking place . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This paper describes an example where this approach is useful in understanding multiple rounds of DNA synthesis ( endoreplication ) in fission yeast cells that lack the main ( B type ) mitotic cyclin , Cdc 13 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A timely coordination of cellular DNA synthesis and division cycles is governed by the temporal and spatial activation of cyclin dependent kinases ( Cdks ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using a random priming method for labeling genomic DNA or cDNA probes , we show specific detection of genomic viral DNA from cells infected with the human herpesviruses , and effectively demonstrate the inhibitory effects of a cellular cyclin dependent kinase inhibitor on viral gene expression in HIV 1 and KSHV latently infected cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Although cell cycle distribution , DNA synthesis , and the activity of key G1 / S regulating cyclin dependent kinases remained unaltered in p 27 deficient ES cells during retinoic acid induced differentiation , the amounts of cyclin D 2 and D 3 in such cells were much lower compared with normal mES cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Liver regeneration , assessed by the relative liver weight , thymidine incorporation into DNA , and proliferating cell nuclear antigen ( PCNA ) labeling index was delayed significantly in the PVNL compared to that in the HEP . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Liver tissue repair was measured by [ 3H CH 3 ] thymidine ( 3H T ) incorporation into hepatic nuclear DNA and proliferating cell nuclear antigen ( PCNA ) immunohistochemistry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
According to the current model , signals elicited by DNA damage prevent mitosis by inhibiting both activation and nuclear import of cyclin B 1 Cdk1 , a master mitotic regulator . ^^^ In these cells , exposure to nonrepairable DNA damage leads to nuclear accumulation of inactive cyclin B 1 Cdk1 complexes . ^^^ In p 21 deficient normal human fibroblasts and immortal cell lines , cyclin B 1 fails to accumulate in the nucleus and could be readily detected at the centrosome in response to DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
OBJECTIVE : To study the expression levels of three DNA damage excision repair enzymes : excision repair cross complementing rodent repair deficiency gene 2 ( ERCC 2 ) , uracil DNA glycosylase ( UDG ) , and proliferating cell nuclear antigen ( PCNA ) , in different lung tissues and their relationship with lung cancer prognosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Techniques of cell culture , OD value of MTT test , measure of ( 3 ) H TdR incorporation , average fluorescent values of proliferating cell nuclear antigen ( PCNA ) and flow cytometric DNA analysis were used in the experiment . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Analysis of DNA replication in cells constitutively expressing cyclin E at levels similar to those observed in a subset of tumor derived cell lines indicates that initiation of replication and possibly fork movement are severely impaired . ^^^ Cyclin E mediated impairment of DNA replication provides a potential mechanism for chromosome instability observed as a consequence of cyclin E deregulation . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Placement of a model for primed DNA within the central hole of PCNA reveals a striking correspondence between the RFC spiral and the grooves of the DNA double helix . ^^^ This model , in which the clamp loader complex locks onto primed DNA in a screw cap like arrangement , provides a simple explanation for the process by which the engagement of primer template junctions by the RFC : PCNA complex results in ATP hydrolysis and release of the sliding clamp on DNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
CONCLUSION : The deregulation of cyclin / CDK expression and the up regulation of p 21 and p 27 with the administration of ASA , post treatment of the carcinogen administration , would block the pass through out to the G0 / G1 check point to permit the cells to repair their DNA and HO 1 protected the liver from reactive oxygen species produced from DAB . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Herein , reciprocal regulation of cyclin D 1 and p 16 ( INK4a ) was observed in tissues of mice mutant for the Ink4a / Arf locus . p 16 ( INK4a ) and p 19 ( ARF ) inhibited DNA synthesis in MCF 7 cells . p 16 ( INK4a ) repressed cyclin D 1 expression and transcription . ^^^ Transcriptional repression of the cyclin D 1 gene through distinct DNA sequences may contribute to the tumor suppressor function of the Ink4a / Arf locus . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Levels of PCNA and gadd 45 proteins involved in DNA repair in response to genomic damage were increased , suggesting that the cells were responding to CSC induced genomic damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The PCNA RFC families of DNA clamps and clamp loaders . ^^^ The proliferating cell nuclear antigen PCNA functions at multiple levels in directing DNA metabolic pathways . ^^^ Unbound to DNA , PCNA promotes localization of replication factors with a consensus PCNA binding domain to replication factories . ^^^ When bound to DNA , PCNA organizes various proteins involved in DNA replication , DNA repair , DNA modification , and chromatin modeling . ^^^ The ring like PCNA homotrimer encircles double stranded DNA and slides spontaneously across it . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Estimation of PCNA expression suggests the efficiency of T cells connected with DNA synthesis related to the stage of allergy disease and demands further investigations . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
E1A + c Ha ras transformants overexpressing bcl 2 oncogene are able to be arrested at the G1 / S boundary of the cell cycle after DNA damage and upon serum starvation , this cell cycle blockage being accompanied by a decrease in the activity of cyclin E Cdk 2 complexes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here , we describe methodologies for evaluation of three facets of RB action in the DNA damage checkpoint response : ( 1 ) transcriptional repression of E2F regulated genes ( cyclin A reporter assay ) ; ( 2 ) induction of cell cycle arrest ( Brd U incorporation assay ) ; and ( 3 ) inhibition of DNA double strand break accumulation ( phosphorylated histone H2A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Functional analysis of CDK inhibitor p21WAF1 . p21WAF1 was originally identified as a protein that binds and inhibits cyclin dependent kinases ( CDKs ) . p21WAF1 is recognized to have at least two separate roles first as a CDK inhibitor , and second as an inhibitor of PCNA , an accessory protein of DNA polymerase delta . p21WAF1 plays a critical role in the cellular response to DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , p 21 interacts directly with proliferating cell nuclear antigen ( PCNA ) , thereby inhibiting DNA replication . ^^^ Since the DNA repair process occurs at discrete nuclear foci in a chromatin bound compartment , a suitable extraction procedure is necessary to investigate the association of p 21 with PCNA in these structures . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The expression of cyclin D , cyclin E , cyclin A , or cyclin B 1 vs DNA content is presented as an example . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In eukaryotes , proliferating cell nuclear antigen ( PCNA ) , the ring shaped sliding clamp , encircles double stranded DNA within its central hole and tethers the DNA polymerases onto DNA . ^^^ Here we report the three dimensional structure of an archaeal clamp loading complex ( RFC PCNA DNA ) determined by single particle EM . ^^^ The atomic structure of PCNA fits well into the closed ring , suggesting that this ternary complex represents a state just after the PCNA ring has closed to encircle the DNA duplex . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using flow cytometry , we quantified proliferating cell nuclear antigen and DNA , and compared apoptotic cells and cells in cell cycle compartments under differing conditions . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We describe here that cyclin A repression is associated with two positioned nucleosomes and that histones progressively lose DNA contact synchronously with gene activation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 activation in B cell malignancy : association with changes in histone acetylation , DNA methylation , and RNA polymerase 2 binding to both promoter and distal sequences . ^^^ The patterns of DNA methylation and histone acetylation were determined at the cyclin D 1 locus on chromosome 11q13 in B cell malignancies . ^^^ Domains of hyperacetylated histones and hypomethylated DNA extended over 120 kb upstream of the cyclin D 1 gene . ^^^ Interestingly , hypomethylated DNA and hyperacetylated histones were also located at the cyclin D 1 promoter but not the upstream major translocation cluster region in cyclin D 1 nonexpressing , nontumorigenic B and T cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This protein , whose expression is upregulated under hypoxia , inhibits the activation of the cyclin dependent kinases ( CDKs ) , thus preventing DNA synthesis and delaying the normal progression through the cell cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our results strongly suggest that these photoreceptors undergo DNA repair : p 53 , PCNA , and DNA ligase 4 are expressed before photoreceptor death , consistent with a model where photoreceptors expressing the rd 1 mutation activate a process of DNA repair but which is overwhelmed by the disease mutation leading to apoptotic death . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin D 1 down regulation by MPP ( + ) was also observed in p 53 positive PC 12 , HeLa S 3 , and HeLa rho ( 0 ) cells , which are a subclone of HeLa S 3 lacking mitochondrial DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Although activation of interleukin 6 STAT 3 signaling , regulation of expression of hepatic C / ebpalpha , C / ebpbeta , cyclin D , and cyclin E and progression through the first wave of hepatocellular DNA synthesis occurred appropriately following partial hepatectomy in Egr 1 null mice , subsequent signaling events and cell cycle progression after the first round of DNA synthesis were deranged . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Stimulation of subcultured CSMC with UTP , ITP , or ATP induced a concentration dependent increase in cellular DNA content , protein synthesis , cell number , and proliferating cell nuclear antigen expression , indicating a mitogenic role for P2Y ( 2 ) receptors . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have shown that , in human cells , when the replication machinery is blocked at DNA damage , PCNA , the sliding clamp required for DNA replication , is mono ubiquitinated and that this modified form of PCNA has increased affinity for poleta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A lot of markers can be used : antibodies for cyclins A , B , D and E , for proliferating cell nuclear antigen , Ki 67 / Mib 1 , antibodies for the inhibitory proteins p 16 , p 27 , p 53 , and for DNA topoisomerase IIalpha . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Previous studies of asynchronous cultures carrying temperature sensitive alleles of PCNA , DNA polymerase alpha ( Pol alpha ) , or primase showed that these mutations inhibited MAT switching ( A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This process coincides with the release from the same DNA region of a transcriptional repressor complex including Yin Yang 1 ( YY 1 ) and histone deacetylase 1 and is sufficient to induce the assembly of the basal transcription machinery on the promoter and to lead to initial cyclin D 1 accumulation in the cell . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin dependent kinase inhibitor p 2 ( Waf1 / Cip1 / Sdi1 / CAP20 ) plays the key part in cell cycle arrest at the G1 / S checkpoint in response to DNA damage , and is involved in the assembly of active cyclin kinase complexes , in particular , cyclin D Cdk4 / 6 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We found that this stimulation of SMC proliferation requires Rho A / ROCK as inhibition with Y 27632 , a ROCK inhibitor , or dominant negative ( DN ) mutant Rho A blocks 5 HT induced proliferation , cyclin D 1 expression , phosphorylation of Elk , and the DNA binding of transcription factors , Egr 1 and GATA 4 . 5 HT activated ROCK , and the activation was blocked by GR 55562 and GR 127935 , 5 HT 1B / 1D receptor antagonists , but not by serotonin transport ( SERT ) inhibitors . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In quiescent , estrogen deprived MCF 7 cells , estradiol did not induce a rapid activation of either the MAPK / ERK or phosphatidylinositol 3 kinase ( PI 3K ) / Akt pathway , whereas the entry into the cell cycle was documented by the successive inductions of cyclin D 1 expression , hyperphosphorylation of the retinoblastoma protein ( Rb ) , activity of the promoter of the cyclin A gene , and DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA ( Proliferating Cell Nuclear Antigen ) marker of S phase of cell cycle , detected in the myotube nuclei ( at stages 35 , 42 ) appears during DNA replication . . ^^^ PCNA ( Proliferating Cell Nuclear Antigen ) marker of S phase of cell cycle , detected in the myotube nuclei ( at stages 35 , 42 ) appears during DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Aberrant DNA methylation of cyclin D 2 and p 27 genes in rodent pituitary tumor cell lines correlates with specific gene expression . ^^^ Bisulfite genomic sequencing showed that the normally unmethylated cytosines of the p 27 gene in normal pituitary ( NP ) were extensively methylated in GH 3 and GHRH CL 1 cells , but not in AtT 20 , alphaT 3 1 and LbetaT 2 cells ; but cyclin D 2 was extensively inactivated in various pituitary tumor cell lines by increased DNA methylation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
BACKGROUND : We and others have shown four distinct and presumably related effects of mammalian proliferating cell nuclear antigen ( PCNA ) on DNA synthesis catalyzed by mammalian DNA polymerase delta ( pol delta ) . ^^^ In the presence of homologous PCNA , pol delta exhibits 1 ) increased absolute activity ; 2 ) increased processivity of DNA synthesis ; 3 ) stable binding of synthetic oligonucleotide template primers ( t1 / 2 of the pol deltaPCNAtemplate primer complex > / =2 . 5 h ) ; and 4 ) enhanced synthesis of DNA opposite and beyond template base lesions . ^^^ Site specific mutagenesis of Drosophila proliferating cell nuclear antigen enhances its effects on calf thymus DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here , we find that the replication factors proliferating cell nuclear antigen ( PCNA ) and RPAp 34 dynamically exchange at these repair foci with discrete kinetics , and this behavior is distinct from kinetics during DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 deficiency reduced DNA synthesis and induced differentiation of colonic epithelial cells harboring mutant APC but not wild type APC cells in vivo . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA content and the proliferating cell nuclear antigen ( PCNA ) protein expression of AEC 2 were measured by using flow cytometry and immunocytochemistry respectively after 24 h of hyperoxia exposure or amygdalin treatment . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Ki67 / MIB 1 immunostaining , tritiated thymidine or bromodeoxyuridine labeling indices , DNA S phase fraction , proliferating cell nuclear antigen expression , potential doubling time and analysis of the nucleolar organizer region associated proteins ( AgNORs ) have shown significant correlation with prognosis in 4806 cases of tumors of the oral cavity , salivary glands , pharynx and larynx . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis was observed by using PCNA stain immunohistochemistry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA expression in ischemic cardiomyopathy : DNA repair , myocyte regeneration or just another type of myocyte death . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunohistochemical studies were employed to determine the presence of PCNA and were used to detect the proliferating potential of keratinocytes needed in synthesizing DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cellular proliferation index and apoptotic index were determined by proliferating cell nuclear antigen ( PCNA ) and single strand DNA immunostaining , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We report here that an interaction between human DNA polymerase iota ( poliota ) and the proliferating cell nuclear antigen ( PCNA ) stimulates the processivity of poliota in a template dependent manner in vitro . ^^^ Thus , PCNA , acting as both a scaffold and a modulator of the different activities involved in replication , appears to recruit and coordinate replicative and translesion DNA synthesis polymerases to ensure genome integrity . . ^^^ Proliferating cell nuclear antigen dependent coordination of the biological functions of human DNA polymerase iota . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin Dependent Kinases ( CDKs ) , the master regulators of the cell cycle , coordinate the initiation of the two key cell cycle events , replication of DNA and its segregation at mitosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
After the introduction of G 1 S control midway through embryogenesis , histone expression depends on DNA replication and the function of cyclin E , and no longer requires stg ( cdc 25 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The ING family functions in DNA repair and apoptosis in response to UV damage through binding to proliferating cell nuclear antigen ( PCNA ) ; chromatin remodeling and regulation of gene expression through regulating and / or targeting histone acetyltransferase / deacetylase ( HAT / HDAC ) activities ; binding targets of rare phosphatidylinositol phosphates ( PtdInsPs ) that function in DNA damage initiated stress signaling ; and regulating brain tumor angiogenesis through transcriptional repression of NF KB responsive genes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , His p 53 and FLAG XPG , but not PCNA , stimulated the Tg DNA glycosylase / AP lyase activity of GST NTH 1 or NTH 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we show that Armadillo and Pangolin ( dTCF ) , downstream effectors of the Wingless ( Wg ) signal transduction pathway , activate transcription of the important DNA replication related genes encoding Drosophila proliferating cell nuclear antigen ( PCNA ) and DNA replication related element binding factor ( DREF ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The human DNA polymerase lambda interacts with PCNA through a domain important for DNA primer binding and the interaction is inhibited by p21 / WAF1 / CIP1 . ^^^ In this paper we show that DNA polymerase lambda ( pol lambda ) interacts with proliferating cell nuclear antigen ( PCNA ) in vivo in human cells . ^^^ Moreover , by using recombinant mutated PCNA , we could demonstrate that pol lambda interacts with both the interdomain connecting loop and the nearby hydrophobic pocket on the anterior of PCNA and that critical residues within a helix hairpin helix domain of pol lambda , important for proper DNA primer binding , are also involved in the enzyme ' s interaction with PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To analyze the functional mechanisms of BPA and NP in induction of morphological changes , we adapted a DNA array technology and identified 6 10 . laevis genes , XIRG , alpha skeletal tropomyosin , cyclin G 1 , HGF , troponin C 2 , and ribosomal protein L 9 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We conclude that E2A can be recruited to the cyclin D 3 promoter independently of E boxes or E2A DNA binding activity . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These findings provide evidence for the existence of a signal transduction pathway that links a rapamycin activated type 2A protein phosphatase to the control of DNA synthesis , DNA repair , cell cycle , and cell death via PCNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Because development of cancer is associated with deregulated cell growth and we previously observed a magnetic field induced decrease in DNA synthesis [ Lange et al . ( 2002 ) Alterations in the cell cycle and in the protein level of cyclin D1p , 21CIP1 , and p16INK4a after exposure to 50 HZ . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The past decade has seen significant advances in understanding how the initiation of DNA replication is regulated by key cell cycle regulators , including the cyclin dependent kinases ( CDKs ) and the anaphase promoting complex / cyclosome ( APC / C ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Rad 18 protein is required for mono ubiquitination of PCNA and trans lesion synthesis during DNA lesion bypass in eukaryotic cells but it remains unknown how it is activated after DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Stimulation of hepatocyte DNA synthesis was associated with increased expression of several cell cycle associated proteins ( cyclin D 1 , cyclin A , cyclin B 1 , E2F , pRb , and p 107 ) ; all were comparable in aged mice and young mice . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression of the dnDP 1 mutant interferes with binding of E2F / DP 1 heterodimers to DNA and inhibits DNA replication , as well as cyclin A mRNA and protein expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , paraffin embedded tissue sections were assessed for proliferation ( PCNA ) , DNA repair ( Ku 70 and gamma H2AX ) , and apoptosis ( TUNEL ) by immunofluorescent staining ( wild type vs . heterozygous only ) at various times after 5 Gy single dose . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cells were concurrently immunostained for gammaH2AX ( Alexa Fluor 633 ) and cyclin A ( fluorescein isothiocyanate ) ; their DNA was counterstained with 4 , 6 diamidino 2 phenylindole . ^^^ The intensities of cellular far red ( gammaH2AX ) , green ( cyclin A ) , and blue ( DNA ) fluorescences were measured by laser scanning cytometry . ^^^ Bivariate analysis of gammaH2AX versus cyclin A expression for the gated S phase cells showed a correlation between these variables , suggesting that the rate of BrdU incorporation ( DNA replication ) correlates with expression of cyclin A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin A 1 CDK2 complex regulates DNA double strand break repair . ^^^ To unravel a potential role of cyclin A 1 in DNA repair , we performed a yeast triple hybrid screen and identified the Ku 70 DNA repair protein as a binding partner and substrate of the cyclin A 1 CDK2 complex . ^^^ DNA double strand break ( DSB ) repair was deficient in cyclin A 1 / cells . ^^^ DNA DSB repair was specific for A type cyclins because cyclin E was ineffective . ^^^ These findings establish a novel function for cyclin A 1 and CDK 2 in DNA DSB repair following radiation damage . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We designed a screen for temperature sensitive mutants defective in the process of replication regardless of morphology by isolating strains unable to rereplicate their DNA in the absence of cyclin B ( Cdc 13 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The amino terminus of p 21 interacts with cyclins and cyclin dependent kinases , while the carboxyl terminus interacts with proliferating cell nuclear antigen ( PCNA ) , growth arrest and DNA damage inducible gene 45 ( GADD 45 ) , calmodulin , SET , and CCAAT / enhancer binding protein alpha ( C / EBP alpha ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here , we show that , following DNA replication arrest , WRN associates and colocalizes with the MRE 11 complex at PCNA sites . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our results demonstrate a physiologic role for TRIP Br in coupling E2F to novel functions in the regulation of cyclin E expression during cell cycle progression to ensure the proper execution of DNA replication and the maintenance of genomic stability . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To elucidate the cellular response to 4 NQO , we studied the transcriptional regulation of human proliferating cell nuclear antigen ( hPCNA ) , an essential protein in DNA replication and repair , after 4 NQO treatment . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Overexpression of the cell cycle protein cyclin D 1 overcame both ECM dependent and actomyosin dependent inhibition of DNA synthesis , suggesting that cyclin D 1 is a key event downstream of myosin dependent cell cycle regulation . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Our findings indicated that ( 1 ) proteins related to cell cycle regulation and DNA repair are induced in CDDP nephrotoxicity , ( 2 ) the SA induced attenuation of CDDP nephrotoxicity is associated with increased expression of p 27 and decreased expression of cyclin B 1 and cyclin D 1 , they all induce cell cycle arrest at G1 / S and G2 / M , and ( 3 ) enhanced expression of DNA repair related proteins is also associated with attenuation of CDDP nephrotoxicity . . ^^^ SA induced attenuation of nephrotoxicity was associated with enhanced expression of proliferating cell nuclear antigen ( PCNA ) and growth arrest and DNA damage ( GADD ) 153 in damaged tubular cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These complexes contain proteins required for both types of BER , including UNG 2 , APE 1 , POLbeta , POLdelta , XRCC 1 , PCNA and DNA ligase , the latter detected as activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The biochemical role of PCNA in rolling circle replication ( RCR ) of geminivirus DNA has not been explored in detail . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results suggest that dioxin like PCBs can induce cell proliferation of contact inhibited rat liver epithelial cells by increasing cyclin A protein levels , a process that then leads to upregulation of cyclin A / cdk2 activity and initiation of DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Sulforaphane treated cells accumulated in metaphase as determined by flow cytometry [ 4C DNA content , cyclin A ( ) , cyclin B 1 ( + ) , and phospho histone H 3 ( Ser ( 10 ) ) ( + ) ] . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A transcriptional regulatory element was identified in the region between URE ( upstream regulatory element ) and DRE ( DNA replication related element ) in the Drosophila PCNA gene promoter . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We found that palmitoylation of ERalpha enacts ERalpha association with the plasma membrane , interaction with the membrane protein caveolin 1 , and nongenomic activities , including activation of signaling pathways and cell proliferation ( i . e . , ERK and AKT activation , cyclin D 1 promoter activity , DNA synthesis ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin dependent kinases ( CDKs ) limit the activation of DNA replication origins to once per cell cycle by preventing the assembly of pre replicative complexes ( pre RCs ) during S , G 2 and M phases of the cell cycle in the budding yeast Saccharomyces cerevisiae . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The growth of H 22 transplanted tumors in mice was significantly inhibited when treated with naked plasmid DNA harboring the cyclin D 1 antisense RNA generating cassette . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The recruitment of DNA ligase 1 to replication foci and the efficient joining of Okazaki fragments is dependent on the interaction between DNA ligase 1 and proliferating cell nuclear antigen ( PCNA ) . ^^^ Although the PCNA sliding clamp tethers DNA ligase 1 to nicked duplex DNA circles , the interaction does not enhance DNA joining . ^^^ Although RFC inhibited DNA joining by DNA ligase 1 , the addition of PCNA alleviated inhibition by RFC . ^^^ Notably , the effect of PCNA on ligation was dependent on the PCNA binding site of DNA ligase 1 . ^^^ Together , these results provide a molecular explanation for the key in vivo role of the DNA ligase I / PCNA interaction and suggest that the joining of Okazaki fragments is coordinated by pairwise interactions among RFC , PCNA , and DNA ligase I . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To understand the underlying mechanism of its maintenance function , we purified recombinant forms of full length Dnmt 1 , a truncated form of Dnmt 1 ( 291 1620 ) lacking the binding sites for PCNA and DNA and examined their processivity using a series of long unmethylated and hemimethylated DNA substrates . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We identified 20 amino acids in cyclin E as a centrosomal localization signal ( CLS ) essential for both centrosomal targeting and promoting DNA synthesis . ^^^ Expressed wild type , but not mutant , CLS peptides localized on the centrosome , prevented endogenous cyclin E and cyclin A from localizing to the centrosome , and inhibited DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Quite unexpectedly , we observed that the percentage of the cells progressing through the S phase increased despite the reduced levels of cyclin E , as analyzed for the cellular DNA contents , expression of nuclear bound PCNA , immunolabelling with Ki 67 antibody and incorporation of BrdU . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Acute Rb excision from conditional knockout myotubes caused reexpression of E2F transcriptional activity , cyclin E and A kinase activities , PCNA , DNA ligase 1 , RPA , and MCM 2 , but did not induce DNA synthesis , showing that pRb is not indispensable to preserve the postmitotic state of these cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cytotoxicity was studied by MTT test , cell kinetic changes by FACStar flow cytometer , apoptosis by fluorescent microscope after staining the cells with acridine orange and ethydium bromide , DNA fragmentation by PAGE electrophoresis after RNase and proteinase K digestion , thymidine incorporation with 3H thymidine , p 53 and PCNA protein expression by Western blotting . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The positive rates of proliferation cell nuclear antigen ( PCNA ) , Ki 67 , and DNA strand break induction by photolysis ( SBIP ) were analyzed by flow cytometry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The following genes exhibited moderate changes in methylation : O 6 methylguanine DNA methyltransferase ( MGMT ) ( 20 % , 13 / 65 ) , mutL homolog 1 , colon cancer , nonpolyposis type 2 ( E . coli ) ( hMLH 1 ) ( 18 % , 12 / 65 ) , cyclin dependent kinase inhibitor 2A ( melanoma , p 16 , inhibits CDK 4 ) ( p 16 ( INK4a ) ) ( 10 % , 10 / 65 ) , methylated in tumor 1 ( MINT 1 ) ( 15 % , 10 / 65 ) , methylated in tumor 31 ( MINT 31 ) ( 11 % , 7 / 65 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Finally , we show that cdk 2 cyclin E is loaded onto the HIV 1 genome in vivo and that CYC 202 is able to inhibit the uploading of this cdk cyclin complex onto HIV 1 DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Parallel to the biochemical changes , there were progressive increases in the DNA repair enzyme APEX 1 , the cell cycle control proteins cyclin D 1 and D 3 , and the hepatocyte growth factor receptor Met . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We examined the expression of various DNA replication factors , including : cdc 45 , the factors of the GINS heterotetramer ( Sld 5 , Psf 1 , Psf 2 , Psf 3 ) , and PCNA , in Xenopus laevis during embryonic development via whole mount in situ hybridization . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA elongation by the human DNA polymerase lambda polymerase and terminal transferase activities are differentially coordinated by proliferating cell nuclear antigen and replication protein A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Renal tubular proliferation and apoptosis were detected by immunostaining proliferating cell nuclear antigen and polyclonal antisingle strand DNA antibody , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The study showed that during the course of green tea administration smoking induced DNA damage was decreased , cell growth was inhibited , and the percentage of cells in S phase was reduced , cells accumulated in G 1 phase ( cyclin D 1 positive ) , DNA content became more diploid and less aneuploid , and p 53 , Caspase 3 , and TUNEL , markers of apoptosis , were increased . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we provide evidence that the Williams syndrome transcription factor ( WSTF ) is targeted to replication foci through direct interaction with the DNA clamp PCNA , an important coordinator of DNA and chromatin replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) is a protein factor required for processive DNA synthesis that is associated with G ( 1 ) cell cycle proteins . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunohistochemically , expression of proliferating cell nuclear antigen ( PCNA ) was decreased on carcinogen exposed squamous epithelium and preneoplastic lesions , although no significant differences were detected in the expression of single strand DNA ( ssDNA ) and p 53 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Treatment with the COX 2 specific inhibitor ( NS 398 25 microM ) and cyclin D 1 inhibitor ( flavopiridol 1 microM ) increased neuronal survival and inhibited DNA fragmentation after anoxia . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
FEN 1 activity is stimulated by proliferating cell nuclear antigen ( PCNA ) , a toroidal sliding clamp that acts as a platform for DNA replication and repair complexes . ^^^ Like PCNA stimulation , 9 1 1 stimulation can not circumvent the tracking mechanism by which FEN 1 enters the substrate ; however , 9 1 1 does not substitute for PCNA in the stimulation of DNA polymerase beta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
OBJECTIVE : The purpose of this study is to compare DNA , mRNA and protein levels of the cyclin E between clear cell ( CC ) and serous ( SC ) ovarian carcinomas , and evaluate the relationship between cyclin E and p 53 status . ^^^ METHOD : We examined the DNA , mRNA and protein levels of cyclin E and the protein level of p 53 in 44 CCs and 39 SCs using microdissected tissues . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Unexpectedly , although the alkylating agent cisplatin also induced degradation of Cdc25A ( albeit delayed , after 8 12 h ) , cyclin E / CDK2 activity was elevated and DNA synthesis continued , a phenomena that correlated with increased E2F1 protein levels and consequently enhanced expression of cyclin E . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin / CDK regulates the nucleocytoplasmic localization of the human papillomavirus E 1 DNA helicase . ^^^ Cyclin dependent kinases ( CDKs ) play key roles in eukaryotic DNA replication and cell cycle progression . ^^^ E 1 phosphorylation by cyclin / CDK is critical for efficient viral DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Similarities in the toroidal shape and dimensions of DNA ligase 1 and the proliferating cell nuclear antigen sliding clamp are suggestive of an extensive protein protein interface that may coordinate the joining of Okazaki fragments . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : pXJ 41 cyclin D 1 expressing sense and antisense cyclin D 1 RNA were transinfected into malignant transformed HELF induced by quartz with DNA recombination and gene transduction . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Structural and thermodynamic analysis of human PCNA with peptides derived from DNA polymerase delta p 66 subunit and flap endonuclease 1 . ^^^ Human Proliferating Cellular Nuclear Antigen ( hPCNA ) , a member of the sliding clamp family of proteins , makes specific protein protein interactions with DNA replication and repair proteins through a small peptide motif termed the PCNA interacting protein , or PIP box . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA polymerase delta , RFC and PCNA are required for repair synthesis of large looped heteroduplexes in Saccharomyces cerevisiae . ^^^ These biochemical experiments support the idea that yeast polymerase delta , RFC and PCNA are required for large loop DNA repair synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Targeted expression of cyclin D 2 results in cardiomyocyte DNA synthesis and infarct regression in transgenic mice . ^^^ Adult transgenic mice expressing cyclin D 1 , D 2 , or D 3 under the regulation of the alpha cardiac myosin heavy chain promoter exhibited high rates of cardiomyocyte DNA synthesis under baseline conditions . ^^^ Cardiac injury in mice expressing cyclin D 1 or D 3 resulted in cytoplasmic cyclin D accumulation , with a concomitant reduction in the level of cardiomyocyte DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Deletion of this motif is shown to be sufficient for suppression of both cdc 24 M38 and dna 2 C2 , a temperature sensitive allele of dna 2 ( + ) , suggesting that disruption of the interaction between Cdc 27 and PCNA renders the activity of the Cdc 24 Dna2 complex dispensable . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Later , it has been shown that indolocarbazole compounds may inhibit various kinases , such as cyclin dependent kinases and / or topoisomerase 1 , someones behave only as DNA intercalators . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
BACKGROUND INFORMATION : Proliferating cell nuclear antigen ( PCNA ) is a key component of the DNA replication machinery involved in the process of DNA elongation , recombination , methylation and repair . ^^^ Here we make a comparison between Hoechst 33342 and GFP PCNA as in vivo event markers for DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using a cell free system that reconstitutes initiation of mammalian DNA replication , we identified a cyclin A responsive protein , p 21 ( Cip 1 ) interacting zinc finger protein 1 ( Ciz 1 ) . ^^^ Consistent with a role in DNA replication , endogenous Ciz 1 is present in nuclear foci that co localize with PCNA during S phase , and targeted depletion of Ciz 1 transcripts restrains cell proliferation by inhibiting entry to S phase . ^^^ Ciz 1 depleted cells accumulate with chromatin bound Mcm 3 and PCNA but fail to synthesize DNA efficiently . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Staining for proliferating cell nuclear antigen ( PCNA ) revealed that the granulosa cells of Cx 43 null mutant ovaries have a reduced frequency of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Characterization of an archaeal family 4 uracil DNA glycosylase and its interaction with PCNA and chromatin proteins . ^^^ We have been unable to detect any stimulation of UDG activity by PCNA , in contrast with the observed effects of PCNA on a number of DNA metabolic enzymes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 is expressed at low levels during S phase to allow efficient DNA synthesis , and induced to high levels in G 2 phase through Ras activity to commit the cells to continuing cell cycle progression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A single amino acid change ( E85K ) in human PCNA that leads , relative to wild type , to enhanced DNA synthesis by DNA polymerase delta past nucleotide base lesions ( TLS ) as well as on unmodified templates . ^^^ Human proliferating cell nuclear antigen ( hPCNA ) containing a single amino acid substitution at position 85 , that of lysine for glutamate ( E85K ) , was compared to wild type ( wt ) hPCNA for its ability to promote DNA synthesis by purified DNA polymerase delta ( pol delta ) both on unmodified templates and past chemically defined template base lesions ( translesion synthesis ; TLS ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Localisation of human Y family DNA polymerase kappa : relationship to PCNA foci . ^^^ Previous work has shown that DNA polymerases eta and iota are localised in replication factories during S phase , where they colocalise one to one with PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NF kappaB DNA binding and Cyclin D 1 proteins increased significantly in the EtOH treated rats corresponding with enhanced hepatic proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Gadd45a protein has been reported to interact with multiple important cellular proteins , including Cdc 2 protein kinase , proliferating cell nuclear antigen ( PCNA ) , p21Waf1 / Cip1 protein , core histone protein and MTK / MEKK4 , an up stream activator of the JNK / SAPK pathway , indicating that Gadd45a may play important roles in the control of cell cycle checkpoint , DNA repair process , and signaling transduction . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA was selected as an end point because it is involved in both DNA repair and the changes in cell cycle that are typical of many reported bystander effects . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We find that E2F4 levels are diminished following treatment with cyclin dependent kinase inhibitors ( flavopiridol , roscovitine and BMS 387032 ) or with DNA damaging drugs ( cisplatin and VP 16 ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The interactions at the interfaces maintain the enzyme in an inactive ' locked down ' orientation and might be utilized in rapid DNA tracking by preserving the central hole of PCNA for sliding along the DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Enhanced expression of cyclin A , a protein essential for DNA synthesis was used as an additional marker to define the initiation of the S phase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We investigated hepatitis B virus ( HBV ) DNA integration and expression of several proteins involved in the cell cycle and apoptosis , including cyclin A , retinoblastoma protein ( pRB ) , Fas associated death domain protein ( FADD ) , tumor necrosis factor receptor associated death domain protein ( TRADD ) , and nuclear factor kappaB ( NF kappaB ) in HBV associated hepatocellular carcinoma ( HCC ) and liver cirrhosis ( LC ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
BACKGROUND : Cell cycle progression and transition of cells from the first gap phase ( G 1 ) to the DNA replication phase ( S ) depend on a finely tuned balance between the levels of cyclins , cyclin dependent kinases ( CDKs ) and cyclin dependent kinase inhibitors ( CDKIs ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
AMP mediated inhibition of DNA replication and S phase progression : involvement of Rb , p21Cip1 , and PCNA . cAMP exerts an antiproliferative effect on a number of cell types including lymphocytes . ^^^ The cAMP induced inhibition of DNA synthesis was associated with the increased binding of p21Cip1 to Cdk 2 cyclin complexes , inhibition of Cdk 2 kinase activity , dephosphorylation of Rb , and dissociation of PCNA from chromatin in S phase cells . ^^^ The ability of cAMP to inhibit DNA replication and trigger release of PCNA from chromatin required Rb and p21Cip1 proteins , since both processes were only marginally affected by increased levels of cAMP in Rb / and p21Cip1 / 3T3 fibroblasts . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The DNA damage induced mitotic exit delay correlates with the inhibition of Cdh 1 activation and the attenuated degradation of cyclin B 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Replication Factor C ( RFC ) is required for the loading of Proliferating Cell Nuclear Antigen ( PCNA ) onto DNA during DNA replication , repair and recombination . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Transcriptional regulation by a DNA associated form of cyclin D 1 . ^^^ The association of cyclin D 1 with DNA prevented the recruitment of the CBP histone acetylase and RNA polymerase 2 , leading to an inhibition of the p21waf1 gene . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA ladder analysis and Western blot analysis of bcl 2 , bax , cyclin B ( 1 ) , p 21 , and p 53 were carried out . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , we demonstrate that APH activates the mono ubiquitination of both FANCD 2 and PCNA and the phosphorylation of RPA 2 , signaling processive DNA replication arrest . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
As suggested by genetic studies of budding yeast WRNIP1 / Mgs1 , the purified human WRNIP 1 complex interacted physically with human DNA polymerase delta ( pol delta ) , stimulating its DNA synthesis activity more than fivefold in the presence or absence of proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The mRNA expression of DNA repair synthesis related genes ( DNA polymerase delta , replication factor C , and proliferating cell nuclear antigen ) were markedly decreased in the cells from multiple elderly subjects compared with those from young subjects . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These polymerases are located in replication factories during DNA replication and the polymerase sliding clamp PCNA plays an important role in mediating switching between different polymerases . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This suggests that E 5 sets the extent of cyclin A promoter activation by a mechanism similar to other , structurally unrelated , DNA tumour virus oncoproteins but distinct from the action of serum factors and so is inconsistent with E 5 acting through constitutive activation of tyrosine kinase growth factor receptors . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The host cells were arrested in G2 / M phase following virus infection and thus , the virus cyclin in association with other proteins maintains the host cells at the G2 / M phase while permitting the virus DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The interactions between the tumor suppressor protein p21WAF1 and the cyclin dependent kinase ( CDK ) complexes and with proliferating cell nuclear antigen ( PCNA ) regulate and coordinate the processes of cell cycle progression and DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
When constitutively expressed in uninfected T lymphocytes , IRF 4 caused reduced expression of critical DNA repair genes , including Rad 51 , XRCC 1 , Ung 1 , RPA , and proliferative cell nuclear antigen ( PCNA ) , a transcriptional phenotype with striking similarities to the profile observed in HTLV infected T lymphocytes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We studied the effects of 2 methoxyestradiol ( 2 ME 2 ) and 16alpha hydroxyestrone ( 16alpha OHE 1 ) , two metabolites of estradiol ( E 2 ) , on DNA synthesis , cell cycle progression and cyclin D 1 protein levels in estrogen receptor positive MCF 7 cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
For FISH analysis DNA probes specific for Cyclin D 1 , centromere 11 and painting probes for whole chromosome 11 were used . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cdk1p cyclin B 1 complexes shuttle between the nucleus and cytoplasm , and preventing nuclear accumulation of Cdk1p cyclin B 1 in mammalian cells appears to be one mechanism of preventing entry into mitosis during a DNA damage induced checkpoint delay . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 2 induced DNA synthesis and proliferation of cardiomyocytes and impaired hypertrophy induced by angiotensin 2 and serum . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Germline genomic instability in PCNA mutants of Drosophila : DNA fingerprinting and microsatellite analysis . ^^^ PCNA participates in multiple processes of DNA metabolism with an essential role in DNA replication and intervening in DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proof of principle has been established that inhibition of several cellular proto oncogenes , including DNA binding protein c myb , non muscle myosin heavy chain , PCNA proliferating cell nuclear antigen , platelet derived growth factor , basic fibroblast growth factor and c myc , inhibits smooth muscle cell proliferation in vitro and in several animal models . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Differential protein expression of P I 3 K , phosphorylated Akt ( Ser 473 ) , 1 kappa Balpha and its phosphorylation , IKK kinase activity , NF kappaB / p65 , p 50 , DNA binding , and transcriptional regulated genes , viz . , Bc l 2 , cyclin D 1 , MMP 9 , and VEGF were observed during prostate cancer progression in TRAMP mice , compared to male non transgenic littermates . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The RAD6 / RAD18 heterodimer promotes translesion synthesis via the monoubiquitination of the DNA sliding clamp , PCNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Human polymerase delta interacting protein 1 ( PDIP 1 ) is a tumor necrosis factor alpha and interleukin 6 inducible protein that interacts directly with proliferating cell nuclear antigen ( PCNA ) and the small subunit ( p 50 ) of DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study , complementary DNA microarray analysis identified cyclin A and several groups of genes as being significantly upregulated by Delta S 2 LHBs in the HuH 7 cell line . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Eighteen cases of OSCC were examined by immunohistochemistry for MIB 1 , PCNA and survivin expression ; presence of HPV DNA was investigated in exfoliated oral mucosa cells by nested PCR ( nPCR , MY 09 MY11 / GP5 GP 6 ) , and HPV genotype was determined by direct DNA sequencing . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin B 1 , DNA content , and caspase 3 expression were measured by flow cytometry to assess cell cycle kinetics and apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Phosphorylation of cyclin D 1 at Thr 286 during S phase leads to its proteasomal degradation and allows efficient DNA synthesis . ^^^ Growth factors stimulate high levels during G 2 phase , which commits the cell to continue through G 1 phase with sufficient cyclin D 1 to initiate DNA synthesis . ^^^ Finally , high cyclin D 1 levels during S phase are shown to inhibit DNA synthesis . ^^^ In such cells , however , the levels of cyclin D 1 would presumably be too high to be suppressed during S phase , resulting in the inhibition of DNA synthesis . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
METHODS : Synovial tissue from 20 patients with active proliferative RA and 28 patients with RA in remission was immunohistochemically examined for expression of p 53 , p 63 , p 21 , p 27 , p 16 , cyclin D 1 , CDK 4 , RB , E2F , Ki 67 on tissue microarrays and by DNA flow cytometry for cell cycle phases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The objective of this study was to determine correlation among extent of S phase DNA synthesis , activation of transcription factors , expression of G ( 1 ) / S cyclins , cyclin dependent kinases ( CDKs ) , and CDK inhibitors downstream of ERK 1 / 2 following DCVC induced ARF in autoprotection . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In response to DNA damage , p 53 accumulates and regulates expression of several genes , including cyclin dependent kinase inhibitor p 21 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Upon UV irradiation , ING 1 causes cell cycle arrest and interacts with proliferating cell nuclear antigen to promote DNA repair or induce apoptosis in cells to prevent tumorigenesis depending upon the severity of DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A protein is not expressed unless the cells are in active DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The WICH complex , consisting of the ISWI type ATPase SNF2H and the Williams Syndrome Transcription Factor ( WSTF ) , binds to replication foci using PCNA , a key factor in DNA and chromatin replication and DNA repair , as an interaction platform . ^^^ Our model may provide an explanation for the long standing observation of a delay in chromatin `` maturation ' ' on newly replicated DNA , by connecting this delay with the action of PCNA bound WSTF ISWI , and highlights chromatin remodeling shortly after DNA replication as a critical point for regulation . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DA increased number of cells with a G 1 DNA content , decreased BrdU incorporation and simultaneously increased cyclin A but had no effect on cyclin D 2 , D 3 , E , nor on cdk 4 and p 21 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Histone deacetylase inhibition down regulates cyclin D 1 transcription by inhibiting nuclear factor kappaB / p65 DNA binding . ^^^ Together , the results provide the first demonstration that HDAC inhibitor trichostatin A inhibits cyclin D 1 gene transcription through targeting transcription factor NF kappaB / p65 DNA binding . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , we found the phosphorylation of p 65 subunit of NF kappaB in addition to the phosphorylation of IkappaBalpha and the activation of NF kappaB DNA binding and that various target genes of NF kappaB including bcl 10 ( L ) , XIAP , c IAP 1 , cyclin D 1 , and IL 6 are up regulated . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Originally detected in fixed cells , DNA replication foci ( RFi ) were later visualized in living cells by using green fluorescent protein ( GFP ) tagged proliferating cell nuclear antigen ( PCNA ) and DNA ligase 1 . ^^^ Here , we used the FRAP assay to study the dynamics of the GFP tagged PCNA binding proteins : Flap endonuclease 1 ( Fen 1 ) and DNA polymerase eta ( Pol eta ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The expression pattern of 16 genes , including those for RNA helicase related protein ( RNAHP ) , heat shock 105kD ( HSP105B ) , interferon related developmental regulator 1 ( IFRD 1 ) , cyclin C ( CCNC ) , and DNA damage inducible transcript 3 ( DDIT 3 ) , which are usually seen in BMNCs from typical MDS patients , was observed in this case . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Much more intense were the smoke induced alterations of a variety of intermediate biomarkers , such as cytogenetic end points in pulmonary alveolar macrophages , bone marrow and peripheral blood erythrocytes ; apoptosis , p 53 oncoprotein , and proliferating cell nuclear antigen in the bronchial epithelium ; bulky DNA adducts , 8 hydroxy 2 deoxyguanosine ; multigene expression , and thiobarbituric acid reactive aldehydes in whole lung and several other organs . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Different ubiquitin modifications to proliferating cell nuclear antigen ( PCNA ) signal distinct modes of lesion bypass in the RAD 6 pathway of DNA damage tolerance . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Coincidentally , IR differentially activates expression of the cell cycle inhibitor , p21 / WAF1 , and the DNA replication protein , proliferating cell nuclear antigen ( PCNA ) . p21 / WAF1 mRNA levels remain elevated through 48 h post exposure to IR , while PCNA mRNA levels increase transiently at early times . ^^^ Since p21 / WAF1 inhibits DNA replication by directly binding PCNA , the relative levels of the two proteins can determine cell cycle progression . ^^^ Limited activation of the PCNA promoter by p 53 and its modified forms would restrict the amount of PCNA made available for DNA repair . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Overexpression of C 53 promoted Cdk 1 activity and nuclear accumulation of cyclin B 1 , whereas C 53 deficiency led to more cytoplasmic retention of cyclin B 1 , suggesting that C 53 acts as a pivotal player in modulating the G ( 2 ) / M DNA damage checkpoint . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
MATERIALS AND METHODS : Tumour tissues from 24 patients were investigated by Dot blot DNA hybridisation for c myc , Ha ras amplification and p 53 deletion , and by immunohistochemical method for cyclin D 1 , p 53 and p 21 overexpression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Together , our data supports a model that chromatin remodeling by chromatin assembly factor 1 ( and , possibly , many other cellular activities ) are tightly coupled with DNA replication ( and repair ) through a PCNA double trimer complex . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
ATM knockdown in p 53 defective PC 3 prostate cancer cells accelerated their cell cycle transition , increased both E2F activity and proliferating cell nuclear antigen expression , and compromised cell cycle checkpoints , which are normally induced by DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In these cells , the inability of KLF 4 to become activated in response to DNA damage was directly associated with an increase in cyclin E level and Cdk 2 activity , both essential for regulating centrosome duplication . ^^^ The results of this study demonstrated that KLF 4 is both necessary and sufficient in preventing centrosome amplification following gamma radiation induced DNA damage and does so by transcriptionally suppressing cyclin E expression . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Interaction between proliferating cell nuclear antigen ( PCNA ) and a DnaJ induced by DNA damage . ^^^ Proliferating cell nuclear antigen ( PCNA ) is an essential protein for both DNA replication and DNA repair . ^^^ Proliferating cell nuclear antigen ( PCNA ) is an essential protein for both DNA replication and DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PDIP 38 was also found to interact with proliferating cell nuclear antigen , which suggested that it might play a role in vivo in the processes of DNA replication and DNA repair in the nucleus . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Loading of the proliferating cell nuclear antigen , PCNA , dissociates DNA polymerase ca and recruits DNA polymerase S and the flap endonuclease FEN 1 for elongation and in preparation for its requirement during maturation , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
After performing Cyclin B 1 RNAi , Cyclin B 1 , Cyclin A and Cdk 2 protein levels were found to be markedly downregulated , whereas Cdc 2 was almost unaffected ; S phase fraction increased significantly ; HeLa cell viability and cell colony forming ability were markedly diminished after the RNAi ; Bcl 2 was noticeably attenuated but Bax was hardly changed ; and HeLa cells displayed typical DNA ladder . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA from peripheral blood samples was genotyped for single nucleotide polymorphisms ( SNP ) in 12 genes : NF 2 , XRCC 1 , XRCC 3 , XRCC 5 , ERCC 2 , Ki ras , p 16 , cyclin D 1 , PTEN , E cadherin , TGFB 1 , and TGFBR 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We investigated survival rates , TGF beta 1 expression in the liver , liver regeneration by proliferating cell nuclear antigen labeling index , hepatocyte apoptosis by single stranded DNA labeling index , and perisinusoidal fibrosis using Masson ' s trichrome staining . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
After 2 , 4 or 8 weeks , nuclear DNA fragmentation was detected in periodontal ligament ( PDL ) fibroblasts using the terminal deoxynucleotidyl transferase mediated dUTP biotin nick end labeling ( TUNEL ) method , and proliferative activities of the basal cells and fibroblasts were evaluated through expression of proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In response to DNA damage , p 53 activates G ( 1 ) / S blocking and apoptotic genes through sequence specific binding . p 53 also represses genes with no target site , such as those for Cdc 2 and cyclin B , key regulators of the G ( 2 ) / M transition . ^^^ Chromatin immunoprecipitation experiments indicated that p 53 is associated with cyclin B 2 , CDC25C , and Cdc 2 promoters in vivo before and after DNA damage , requiring DNA bound NF Y . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Immunoelectron microscopy confirmed the colocalization of kin 17 protein with replication proteins like RPA , PCNA , and DNA polymerase alpha . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
However , we show that adenosine increases porcine coronary artery smooth muscle cell ( CASMC ) number , cellular DNA content , protein synthesis , and PCNA staining . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this experiment , proliferating cell nuclear antigen , a DNA repair protein and known ubiquitin substrate , was confidently identified . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Two daily 2 . 5 fold peaks in cancer cell cyclin E protein , a marker of DNA synthesis , are followed by two daily up to 3 fold peaks in cancer cell mitosis ( one minor , and one major peak ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The toroidal Rad 9 Rad1 Hus 1 checkpoint complex ( 9 1 1 ) is structurally similar to the proliferating cell nuclear antigen ( PCNA ) , which serves as a sliding clamp platform for DNA replication and repair . 9 1 1 has been characterized as a sensor of DNA damage that functions in concert with the checkpoint control proteins ATM and ATR . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This critical event is controlled in yeast and Xenopus oocytes by the degradation of cyclin inhibitory proteins , while in mammalian cells over expression of cyclin E or cyclin D 1 promotes rapid entry into DNA synthesis . ^^^ To directly assess the roles of the cyclin inhibitory protein p27Kip1 ( p 27 ) and of cyclin D 1 in the regulation of DNA synthesis initiation in mammalian cells , we have utilized a quantitative cytometric approach for the study of cell cycle control in actively proliferating cultures . ^^^ We propose that p 27 directly regulates the initiation of DNA synthesis in NIH3T3 cells , and that cyclin D 1 serves to modulate this activity . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA polymerases that function in a processive complex with the replication clamp proliferating cell nuclear antigen ( PCNA ) have been shown to possess a close match to the consensus PCNA binding motif QxxLxxFF . ^^^ In particular , translesion synthesis of UV damage containing DNA is dramatically stimulated by PCNA such that translesion synthesis rates are comparable with replication rates by Pol zeta on undamaged DNA . ^^^ Proliferating cell nuclear antigen promotes translesion synthesis by DNA polymerase zeta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Between borderline and malignant tumors , the increased expression levels of P 53 , Bax , Cyclin E , and cyclin dependent kinase 2 as well as the decreased expression levels of growth arrest and DNA damage ( GADD 45 ) and murine double minute 2 ( MDM 2 ) were significantly associated with malignancy ( P < 0 . 01 , each ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Other distinctive PHX proteins of Archaea , absent from Bacteria , include the proliferating cell nuclear antigen PCNA , a replication auxiliary factor responsible for tethering the catalytic unit of DNA polymerase to DNA during high speed replication , and the acidic RP P 0 , which helps to initiate mRNA translation at the ribosome . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Microglial turnover was assessed using terminal deoxynucleotidyl transferase mediated dUTP nick end labelling ( TUNEL ) ( DNA damage ) , BAX ( proapoptotic marker ) , Fas ( CD 95 ) ( proapoptotic ) , proliferating cell nuclear antigen ( PCNA ) ( proliferation and DNA repair ) , Ki 67 ( cell proliferation ) and BCL 2 ( antiapoptosis ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
MATERIALS AND METHODS : We immunohistochemically examined the expression of cell proliferating markers , Ki 67 , cyclin D 1 , p 27 , and retinoblastoma gene product ( pRb ) , apoptotic markers , single strand DNA ( ssDNA ) , and metastatic suppressor , kangai 1 ( KAI 1 ) for 19 microcarcinoma patients with clinically apparent metastasis , 14 patents with occult metastasis , and 22 patients without metastasis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In budding yeast cells lacking Asf 1 , the amounts of several DNA replication proteins , including replication factor C ( RFC ) , proliferating cell nuclear antigen ( PCNA ) , and DNA polymerase epsilon ( Pol epsilon ) , are reduced at stalled replication forks . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the present study , we evaluated the protein expression of p 53 and PCNA and DNA mutations of p 53 and H ras genes in both hyperplastic and neoplastic squamous cell lesions from the NTP study . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Notably , the ability of DNA ligase 1 to promote the recombinational repair of DNA double strand breaks was dependent upon its interaction with proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 gene activation in human myeloma cells is independent of DNA hypomethylation or histone hyperacetylation . ^^^ METHODS : Using 6 MM cell lines representative of different cyclin D 1 expression levels and exhibiting various chromosome 11 abnormalities , as well as normal B cells , we studied DNA methylation and histone acetylation of the cyclin D 1 promoter . ^^^ RESULTS : With the bisulfite sequencing technique , we have studied the DNA methylation status of the core minimal cyclin D 1 promoter containing Sp 1 and CRE binding sites . ^^^ Treatment with the DNA methyltransferase inhibitor 5 aza deoxycytidine ( 5 Aza ) had no effect on cyclin D 1 gene transcription . ^^^ CONCLUSION : The cyclin D 1 gene is silenced within the B lineage by a mechanism different from DNA methylation or histone deacetylation . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Gadd 45 deficient keratinocytes fail to repair UV induced DNA damage , but the mechanism by which Gadd 45 stimulates repair of UV induced DNA damage is unknown . p21WAF1 / Cip1 ( p 21 ) is a well characterized downstream target of p 53 that binds to Gadd 45 and proliferating cell nuclear antigen ( PCNA ) . ^^^ The role of p 21 in NER is somewhat controversial , however , recent studies appear to suggest that it inhibits DNA repair by inhibiting PCNA activity . ^^^ Since a physical interplay exists between p 21 , Gadd 45 and PCNA , we hypothesized that Gadd 45 promoted DNA repair via p 21 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
After confirming 22 human papillomavirus ( HPV ) types using a DNA chip from 30 cervical swabs , previously confirmed as 15 cervical low grade and 15 high grade intraepithelial lesions , the activity of molecules involved in the G 2 checkpoint was evaluated using western blotting for cyclin B 1 , cdc 2 , and phospho cdc 2 ( Y 15 and T 161 ) , a nuclear extraction fractional assay , and a reverse transcription polymerase chain reaction assay . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using complementary DNA arrays in hemimegalencephaly specimens , we found increased expression of cyclin D 1 and c myc messenger ribonucleic acids ( RNAs ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In primary neuronal and astrocyte cultures , cell cycle inhibition ( including the cyclin dependent kinase inhibitors flavopiridol , roscovitine , and olomoucine ) reduced up regulation of cell cycle proteins , limited neuronal cell death after etoposide induced DNA damage , and attenuated astrocyte proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Additional experiments showed that DNA synthesis was induced as early as 2 days after T 3 treatment ( the labeling index was 9 . 4 vs 1 . 9 % in controls ) and was associated with increased protein levels of cyclin D 1 , cyclin A and proliferating cell nuclear antigen , with no substantial differences in the expression of the cyclin dependent kinase inhibitor p 27 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Two main bypasses are controlled by ubiquitin modification of proliferating cell nuclear antigen ( PCNA ) , a homotrimeric DNA encircling protein that functions as a polymerase processivity factor and regulator of replication linked functions . ^^^ Upon DNA damage , PCNA is modified at the conserved lysine residue 164 by either mono ubiquitin or a lysine 63 linked multi ubiquitin chain , which induce error prone or error free replication bypasses of the lesions . ^^^ In S phase , even in the absence of exogenous DNA damage , yeast PCNA can be alternatively modified by the small ubiquitin related modifier protein SUMO ; however the consequences of this remain controversial . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Conversely , increased EDG 1 expression results in inhibition of cyclin T 1 recruitment and ERalpha DNA binding . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RESULTS : The protein endothelial cell growth factor 1 ( platelet derived ) , rhotekin protein ( RTKN ) , septin 1 , cyclin dependent kinase 1 , sialic acid binding Ig like lectin 11 , tyrosinase related protein 2 , translin like protein , and DNA directed RNA polymerase 2 polypeptide J related gene isoform 2 appeared in metastatic but were not detected in non metastatic cell lines , whereas integrin linked kinase associated protein phosphatase 2C isoform 2 , MHC class 1 promoter binding protein , protein phosphatase 2A regulatory subunit B ' ( PR 53 ) , carboxypeptidase A 5 , paired box transcription factor , zinc finger protein 79 , and apolipoprotein B 48 were detected in non metastatic but were absent in metastatic cell lines . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The objectives of the studies were : ( 1 ) to determine whether the increase in S phase in tumor cells seen 24 h after CPT 11 administration in animal studies is seen in advanced solid tumors in patients , ( 2 ) to determine the dose of CPT 11 required to produce this effect , ( 3 ) to compare two methods ( immunohistochemistry , IHC , for cyclin A , and DNA flow cytometry , FC ) for evaluating S phase in tumor biopsies from patients , and ( 4 ) to establish the maximum tolerated dose ( MTD ) and dose limiting toxicity ( DLT ) of CPT 11 , given 24 h before gemcitabine ( GEM , 1000 mg / m ( 2 ) ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , also known as cyclin , is an auxiliary protein of DNA polymerase delta , and the level of synthesis correlates directly with rates of cellular proliferation and DNA synthesis . ^^^ Proliferating cell nuclear antigen ( PCNA ) , also known as cyclin , is an auxiliary protein of DNA polymerase delta , and the level of synthesis correlates directly with rates of cellular proliferation and DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Genes with the highest upregulation throughout the time course included tubulin genes , ezrin , c1qr1 , fos , pcna , mcm 6 , ung , and dnmt 1 , genes that play an essential role in reorganization of the cytoskeleton system , stabilization of DNA , and methylation patterns . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Time lapse microscopy of microirradiated mammalian cells expressing GFP tagged Dnmt 1 , Dnmt3a , or Dnmt3b1 together with red fluorescent protein tagged proliferating cell nuclear antigen ( PCNA ) revealed that Dnmt 1 and PCNA accumulate at DNA damage sites as early as 1 min after irradiation in S and non S phase cells , whereas recruitment of Dnmt3a and Dnmt3b was not observed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this report , we investigated the inhibitory effect of cEPA on a human promyelocytic leukemia cell line , HL 60 , to determine which enzymes influence cell proliferation . cEPA inhibited the proliferation of HL 60 cells ( LD ( 50 ) =20 . 0 microM ) , and the inhibitory effect was stronger than that of non conjugated EPA . cEPA arrested the cells at G1 / S phase , increased cyclin A and E protein levels , and prevented the incorporation of thymidine into the cells , indicating that it blocks the primary step of in vivo DNA replication by inhibiting the activity of replicative pols rather than topos . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the present study , we demonstrated that the expression of hLRH 1 and cyclin E 1 in BEL 7402 cells could be suppressed by up to approximately 80 % via DNA vector based RNA interference . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin degradation is required for exit from mitosis and enables a new round of DNA replication in the subsequent S phase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The replication clamp PCNA is loaded around DNA by replication factor C ( RFC ) and functions in DNA replication and repair . ^^^ Regulated unloading of PCNA during the progression and termination of DNA replication may require additional factors . ^^^ Ctf 18 RFC was also a weak loader of PCNA onto naked template primer DNA . ^^^ However , when the single stranded DNA template was coated by the yeast single stranded DNA binding protein replication protein A ( RPA ) but not by a mutant form of RPA or a heterologous single stranded DNA binding protein , both binding of Ctf 18 RFC to substrate DNA and loading of PCNA were strongly inhibited , and unloading predominated . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Together our genetic and biochemical analysis suggests that , although DNA ligase 1 seals DNA nicks during replication , repair , and recombination , higher than normal levels can yield genetic instability by disrupting the normal interplay of PCNA with other proteins such as Fen1 . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here , we show that Pol lambda directly binds to proliferating cell nuclear antigen ( PCNA ) , an auxiliary protein for DNA replication and repair enzymes , both in vitro and in vivo . ^^^ Pol micro , which also belongs to the family 10 of DNA polymerases , binds to PCNA by a pivotal amino acid residue . . ^^^ DNA polymerase lambda directly binds to proliferating cell nuclear antigen through its confined C terminal region . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These clones , which were present in apparently normal urothelium and in hyperplastic and dysplastic urothelial lesions , showed higher percent values of PCNA positive cells , in comparison to the values estimated in the areas with negatively stained DNA instability testing , and the former values were statistically not different from those in carcinoma lesions . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Both IRS 1 and beta catenin are recruited to the cyclin D 1 promoter , an established target for beta catenin , but only IRS 1 is recruited to the ribosomal DNA ( rDNA ) promoter . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Flavopiridol ( 1 microM ) inhibited DNA synthesis as measured by BrdU incorporation , thus enhancing proliferating cell nuclear antigen expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have used a combination of in situ extraction and dual color photobleaching to compare the dynamic properties of three proteins essential for lagging strand synthesis : the polymerase clamp proliferating cell nuclear antigen ( PCNA ) and two proteins that bind to it , DNA Ligase 1 and Fen 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
STE treatment of these cells resulted in loss of pRb , RARbeta , p 21 waf1 / cip1 and O 6 methyl guanine DNA methyl transferase ( MGMT ) while the expression of cyclin D 1 was increased . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
KCTD 10 shares significant similarity in amino acid sequence to PDIP 1 and can interact with the small subunit of DNA polymerase delta and PCNA as PDIP 1 does . ^^^ A novel PDIP 1 related protein , KCTD 10 , that interacts with proliferating cell nuclear antigen and DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Posttranslational modification of proliferating cell nuclear antigen ( PCNA ) , an essential processivity clamp for DNA polymerases , by ubiquitin and SUMO contributes to the coordination of DNA replication , damage tolerance , and mutagenesis . ^^^ As both modifiers target the same site on PCNA , an antagonistic action of SUMO on ubiquitin dependent DNA damage tolerance has been proposed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Impact of simultaneous assay , the PCNA , cyclinD 1 , and DNA content with specimens before and after preoperative radiotherapy on prognosis of esophageal cancer possible incorporation into clinical TNM staging system . ^^^ Immunohistochemical stain was done for PCNA , cyclinD 1 protein expression and DNA content analyzed by image cytometry . ^^^ While , tumor cell proliferating marked PCNA , cyclinD 1 and DNA content served as independent prognostic factors of esophageal carcinoma . ^^^ CONCLUSION : It is possible that tumor cell proliferating marked PCNA , cyclinD 1 and DNA content would become the endpoints for evaluating the prognosis of esophageal carcinoma . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These agents functioned by decreasing DNA synthesis , through an inhibition of the S phase regulatory protein , cyclin A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Mitotic index , immunochemistry for PCNA , 3 [ H ] thymidine incorporation into DNA and thymidine kinase activity were used as indices of liver regeneration . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have analysed the interactions of the human p 66 DNA polymerase delta subunit with PCNA and with components of the DNA polymerase delta complex in vivo . ^^^ Expression of EGFP p 66 shows that it is a nuclear protein which co localises with PCNA throughout the cell cycle . p 66 is localised to sites of DNA replication during S phase and to repair foci following DNA damage . ^^^ We demonstrate a functional link between PCNA interaction and localisation to replication foci and show that there is a direct interaction between p 66 and PCNA in living cells during DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Expression of PCNA was also increased ; however , DNA synthesis was not significantly changed . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA was also expressed in spermatogonial stem cells and intestine crypts , consistent with its role in cell proliferation and DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Improved compounds including tubulin interacting agents , bioreductive agents , angiogenesis inhibitors , DNA interactive agents , anthracyclines , taxanes , cyclin and tyrosine kinase inhibitors have recently reached the stage of clinical trials . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proteins and enzymatic activities that were found to copurify with the NB DNA synthesome include : DNA polymerases alpha , delta , and epsilon , proliferating cell nuclear antigen , replication factor A , replication factor C , topoisomerases 1 and 2 , flap endonuclease 1 , and DNA ligase 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The immunocytochemical expression of Proliferating Cell Nuclear Antigen ( PCNA ) ( a cycline that coadjuvates DNA polymerase delta ) becomes appreciable in the cell cycle when DNA synthesis occurs ; hence cells in the S phase can be revealed by means of monoclonal antibodies . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen loading onto DNA by replication factor C ( RFC ) is a key step in eukaryotic DNA replication and repair processes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RESULTS : Compared with controls , hepatocyte DNA synthesis , and induction of cyclin D 1 and p 21 ( CIP 1 ) proteins were delayed but not suppressed in porcine serum induced fibrotic rats and markedly inhibited in thioacetamide induced cirrhotic rats . p 27 ( KIP 1 ) protein levels were unaffected by partial hepatectomy and did not differ among all three groups . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA affinity immunoblot assays showed a six to eightfold increase in the binding of ATF 2 to a 74 mer ATF / CRE oligonucleotide ( ODN 1 ) from cyclin D 1 promoter in the presence of 4 nM E 2 and 0 . 5 mM spermine , compared to untreated control . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
However , 0 . 4 microg / kg bw TCDD also altered the expression of Gadd45a and Cyclin D 1 , suggesting that even low dose TCDD exposure can alter the expression of genes indicative of cellular stress or DNA damage and associated with cell cycle control . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These results suggest that PCNA mediates the entry of the flap endonuclease and DNA ligase 1 into the process of Okazaki fragment joining , and this ordered entry is necessary to prevent CAG repeat tract expansions . . ^^^ Interactions among DNA ligase 1 , the flap endonuclease and proliferating cell nuclear antigen in the expansion and contraction of CAG repeat tracts in yeast . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
CDP / Cux p 110 makes stable interactions with DNA during S phase but is inhibited in G 2 following the phosphorylation of serine 1237 by cyclin A / Cdk1 . ^^^ In contrast to cyclin A / Cdk1 , however , cyclin A / Cdk2 did not efficiently phosphorylate CDP / Cux p 110 on serine 1237 and did not inhibit its DNA binding activity in vitro . ^^^ Accordingly , co expression with cyclin A / Cdk2 in cells did not inhibit the DNA binding and transcriptional activities of CDP / Cux p 110 . ^^^ Both cyclin A / Cdk2 and Cdk 1 efficiently phosphorylated the CDP / Cux ( Cdc 6 ) mutant and inhibited its DNA binding activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We show that agmatine induced the accumulation of cells in the S and G2 / M phases , reduced the rate of DNA synthesis and decreased cyclin A and B 1 expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In this study , we have studied the ability of MG to cause DNA damage , cell cycle arrest in mimosine synchronised and the possible roles of Chk 1 , Chk 2 , Cdc 2 , Cdc25C , 14 3 3 and Cyclin B 1 in control and MG transformed SHE cells in order to understand the differential mechanisms associated with G2 / M checkpoint control . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating activity of the cells was determined using immunostaining of proliferating cell nuclear antigen ( a cell proliferation marker ) , 5 bromo 2 ' deoxyuridine incorporation into DNA and cell count . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The mitotic index in hematoxylin eosin stained liver sections , immunochemical detection of PCNA and Ki 67 nuclear antigens and the rate of [ 3H ] thymidine incorporation into hepatic DNA were used as indices of liver regeneration . ^^^ RESULTS : Liver regeneration , as evaluated by [ 3H ] thymidine incorporation into hepatic DNA , mitotic index , PCNA and Ki 67 nuclear antigens , peaked at 40 h in groups 1 , 2 and 3 of rats and no significant differences were observed between the studied groups . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , the DNA repair pathway and tumor proliferation mediated by YB 1 linking to PCNA may be responsible for controlling the growth of NSCLC . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA is known to be associated with S phase and DNA replication of the cell cycle . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The Xenopus cyclin dependent kinase ( CDK ) inhibitor , p 27 ( Xic 1 ) ( Xic 1 ) , binds to CDK 2 cyclins and proliferating cell nuclear antigen ( PCNA ) , inhibits DNA synthesis in Xenopus extracts , and is targeted for ubiquitin mediated proteolysis . ^^^ Here we demonstrate that Xic 1 proteolysis is temporally restricted to late replication initiation following the requirements for DNA polymerase alpha primase , replication factor C , and PCNA . ^^^ Importantly , while the addition of recombinant wild type PCNA alone restores Xic 1 degradation , the addition of a PCNA mutant defective for trimer formation does not restore Xic 1 proteolysis in PCNA depleted extracts , suggesting Xic 1 proteolysis requires both PCNA binding to Xic 1 and the ability of PCNA to be loaded onto primed DNA by replication factor C . ^^^ Taken together , our studies suggest that Xic 1 is targeted for ubiquitination and degradation during DNA polymerase switching through its interaction with PCNA at a site of initiation . . ^^^ Proliferating cell nuclear antigen recruits cyclin dependent kinase inhibitor Xic 1 to DNA and couples its proteolysis to DNA polymerase switching . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This compromises the activation of cyclin destruction and interferes with mitotic exit and DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
However , at variance with current concepts mostly derived from fibroblast models , DNA synthesis induction and cyclin D 3 cyclin dependent kinase 4 activation were resistant to actin depolymerization by dihydrocytochalasin B in canine thyrocytes , which provides a first such example in a normal adherent cell . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To evaluate in oral leukoplakia the relationship between HPV infection and markers of apoptosis ( bcl 2 , survivin ) and proliferation ( PCNA ) , also conditionally to age , gender , smoking and drinking habits of patients , by means of Fuzzy neural networks ( FNN ) system 21 cases of oral leukopakia , clinically and histologically diagnosed , were examined for HPV DNA presence , bcl 2 , survivin and PCNA expression . ^^^ HPV DNA was found in 8 / 21 OL ( 38 . 1 % ) ; survivin , PCNA , and tobacco smoking were associated in univariate analysis ( p = 0 . 04 ) with HPV DNA status . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Chromatin immunoprecipitation analyses and in vitro DNA binding assays indicated that 11 of the 15 histone H 4 genes interact with the cell cycle regulatory histone nuclear factor P , which forms a complex with the cyclin E / CDK2 responsive co regulator p 220 ( NPAT ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
When CDK 2 activity or pronuclear accumulation of cyclin A 2 was inhibited with CDK 2 inhibitors or by microinjected siRNAs , respectively , DNA replication was not inhibited but the increase of transcriptional activity was prevented . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These subunits show structural similarities with the replication clamp PCNA and indeed , it was demonstrated in vitro that Rad17 / 3 / 1 could be loaded onto DNA by checkpoint specific clamp loader Rad 24 RFC , analogous to the PCNA RFC clamp clamp loader system . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , we found that cyclin A induction was delayed and p 21 was over expressed , both of these processes were correlated with reduced and delayed DNA replication in Atm ( / ) mice during liver regeneration . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
CAF 1 mediated resistance to DNA damage is dependent on the ability of CAF 1 to bind PCNA , indicating that PCNA may recruit CAF 1 to sites of double strand DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We examined relationship between PTHrP receptor and various prognostic factors such as hormone receptors , MIB 1 index , proliferation of cell nuclear antigen ( PCNA ) , DNA ploidy , S phase fraction , age , tumor diameter , c erbB 2 , and Cathepsin D . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A literature search was undertaken using PubMed and MEDLINE search engines , using the keywords p 53 , p 21 , p 16 , p 27 , SMAD 4 , K ras , cyclin D 1 , Bax , Bcl 2 , EGFR , EGF , c erbB 2 , HB EGF , TGFbeta , FGF , MMP , uPA , cathepsin , heparanase , E cadherin , laminins , integrins , TMSF , CD 44 , cytokines , angiogenesis , VEGF , IL 8 , beta catenin , DNA microarray , and gene profiling . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Nicotine administration ( 10 ( 6 ) M ) stimulated cell cycle entry marked by increased DNA synthesis , PCNA and cyclin D 1 production , and increased cell division . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The rv cyclin activates transcription from GAL 4 promoters when fused to the GAL 4 DNA binding domain . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
S phase DNA synthesis measured by [ 3H ] thymidine incorporation , and advancement of cells through the cell division cycle measured by PCNA immunohistochemistry , were substantially inhibited in the DB rats compared to the non DB rats challenged with TA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These findings suggest that DNA damage of differentiated neuroblastoma cells induces a rapid p 53 mediated inhibition of cell cycle progression and induction of cdk 2 cyclin E , followed by caspase 3 activation , phosphorylation of histone and cell death . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Studies included kidney weight , renal content of protein , DNA , and insulin like growth factor 1 ( IGF 1 ) , serum IGF 1 , mean glomerular area , and immunostaining for proliferating cell nuclear antigen ( PCNA ) . ^^^ Unx altered kidney weight , glomerular area , DNA content , IGF 1 content , and PCNA regardless of sex or genotype . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Different growth capacity between infant and adult mouse hepatocytes in vitro correlates to the cyclin D 1 level without relation to oxidative DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The Saccharomyces cerevisiae checkpoint proteins Ddc 1 , Rad 17 , and Mec 3 form a clamp like structure ( the 9 1 1 clamp ) that has physical similarity to the homotrimeric sliding clamp proliferating cell nuclear antigen , which interacts with and promotes the processivity of the replicative DNA polymerases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Phosphorylation of human DNA polymerase lambda by the cyclin dependent kinase Cdk2 / cyclin A complex is modulated by its association with proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin dependent kinases ( CDKs ) restrict DNA replication origin firing to once per cell cycle by preventing the assembly of prereplicative complexes ( pre RCs ; licensing ) outside of G 1 phase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Bidirectional mismatch repair directed by a strand break located 3 ' or 5 ' to the mispair has been reconstituted using seven purified human activities : MutSalpha , MutLalpha , EXOI , replication protein A ( RPA ) , proliferating cell nuclear antigen ( PCNA ) , replication factor C ( RFC ) and DNA polymerase delta . ^^^ In addition to DNA polymerase delta , PCNA , RFC , and RPA , 5 ' directed repair depends on MutSalpha and EXOI , whereas 3 ' directed mismatch correction also requires MutLalpha . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We investigated 44 single nucleotide polymorphisms ( SNPs ) in 20 DNA repair genes including nucleotide excision repair ( NER ) genes XPA , ERCC 1 , ERCC2 / XPD , ERCC4 / XPF and ERCC5 / XPG ; base excision repair ( BER ) genes APE1 / APEX , OGG 1 , MPG , XRCC 1 , PCNA , POLB , POLiota , LIG 3 and EXO 1 ; double strand break repair ( DSB R ) genes XRCC 2 , XRCC 3 , XRCC 9 , NBS 1 and ATR ; and direct damage reversal ( DR ) gene MGMT / AGT . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA MutSalpha mediated binding of MutLalpha to replicative DNA with mismatched bases to induce apoptosis in human cells . ^^^ In human cells treated with N methyl N nitrosourea , we detected a protein complex composed of MutSalpha , MutLalpha and PCNA on damaged DNA by immunoprecipitation method using chromatin extracts , in which protein protein interactions were stabilized by chemical crosslinking . ^^^ Time course experiments revealed that MutSalpha , consisting of MSH 2 and MSH 6 proteins , and PCNA bind to DNA to form an initial complex , and MutLalpha , composed of MLH 1 and PMS 2 , binds to the complex when the DNA is damaged . ^^^ Moreover , reduction in the PCNA content by small interfering RNA or inhibition of DNA replication by aphidicolin , an inhibitor of DNA polymerase , significantly reduced the levels of the PCNA MutSalpha MutLalpha complex and also suppressed an increase in the caspase 3 activity , a hallmark for the induction of apoptosis . ^^^ These observations imply that the induction of apoptosis is coupled with the progression of DNA replication through the action of PCNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The evaluation of markers of cell proliferation included the NF kappaB DNA binding assay , the NF kappaB inhibition complex , the proliferating cell nuclear antigen expression and the methyl tetrazolium salt test . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
On the other hand , the well characterised DNA clamp proliferating cell nuclear antigen ( PCNA ) also interacts with and stimulates several of these factors . ^^^ The two DNA clamps Rad9 / Rad1 / Hus1 complex and proliferating cell nuclear antigen differentially regulate flap endonuclease 1 activity . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In human cells , the nuclear form of uracil DNA glycosylase ( UNG 2 ) contains a conserved PCNA binding motif located at the N terminus that has been implicated experimentally in binding PCNA . ^^^ Addition of PCNA ( 30 810 pmol ) to standard uracil DNA glycosylase reactions containing linear [ uracil ( 3 ) H ] DNA stimulated UNG 2 catalytic activity up to 2 . 6 fold . ^^^ Loading of PCNA onto the DNA substrate was required for stimulation , as the activity of UNG 2 on circular DNA substrates was not affected by the addition of PCNA . ^^^ Addition of replication factor C and ATP to reactions containing 90 pmol of PCNA resulted in two fold stimulation of UNG 2 activity on circular DNA . . ^^^ Physical and functional interaction of human nuclear uracil DNA glycosylase with proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here , we report the electron microscopic structure of an archaeal RFC PCNA DNA complex at 12 A resolution . ^^^ This complex exhibits excellent fitting of each atomic structure of RFC , PCNA , and the primed DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , we determined the DNA ploidy in tongue lesions and examined the immunohistochemical expression of five biomarkers such as cyclin D 1 , glutathione S transferase placental form , cyclooxygenase ( COX ) 2 , inducible nitric oxide synthase ( iNOS ) and beta catenin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In recent studies , roles have been identified for replication factors in reinstating heterochromatin , particularly functions for origin recognition complex , proliferating cell nuclear antigen , and chromatin assembly factor 1 in recruiting the heterochromatin binding protein HP 1 , a histone methyltransferase , a DNA methyltransferase , and a chromatin remodeling complex . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Tolerance to replication blocking DNA lesions is achieved by means of ubiquitylation of PCNA , the processivity clamp for replicative DNA polymerases , by components of the RAD 6 pathway . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These procedures identified > 60 MGMT interacting proteins with diverse functions including those involved in DNA replication and repair ( MCM 2 , PCNA , ORC 1 , DNA polymerase delta , MSH 2 , and DNA dependent protein kinase ) , cell cycle progression ( CDK 1 , cyclin B , CDK 2 , CDC 7 , CDC 10 , 14 3 3 protein , and p 21 ( waf1 / cip1 ) ) , RNA processing and translation ( poly ( A ) binding protein , nucleolin , heterogeneous nuclear ribonucleoproteins , A2 / B1 , and elongation factor 1alpha ) , several histones ( H 4 , H3 . 4 , and H2A . 1 ) , and topoisomerase 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Distinct populations of human PCNA are required for initiation of chromosomal DNA replication and concurrent DNA repair . ^^^ Recombinant histidine tagged human PCNA can substitute for purified endogenous human PCNA to initiate human chromosomal DNA replication . ^^^ A separate population of chromatin bound PCNA is already present in these template nuclei at discrete DNA damage foci , co localising with gamma H2AX , RPA and Rad 51 . ^^^ This DNA damage associated PCNA population is marked by mono ubiquitination , suggesting that it is involved in DNA repair . ^^^ Importantly , the population of damage focus associated PCNA is neither involved in , nor required for , the initiation of chromosomal DNA replication in the same nuclei . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Nuclear dynamics of PCNA in DNA replication and repair . ^^^ The DNA polymerase processivity factor proliferating cell nuclear antigen ( PCNA ) is central to both DNA replication and repair . ^^^ The ring shaped homotrimeric PCNA encircles and slides along double stranded DNA , acting as a `` sliding clamp ' ' that localizes proteins to DNA . ^^^ We determined the behavior of green fluorescent protein tagged human PCNA ( GFP hPCNA ) in living cells to analyze its different engagements in DNA replication and repair . ^^^ To simultaneously monitor PCNA action in DNA replication and repair , we locally inflicted UV induced DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
AIM : Detection of methylation in the p 16 gene , an inhibitor of cyclin D dependent protein kinase , as a new tumor marker for early detection of esophageal squamous cell carcinoma ( ESCC ) in DNA derived from blood and serum . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
MATERIALS AND METHODS : We have studied two tissue microarrays that include 103 familial and 104 sporadic breast tumors , with a panel of DNA repair markers including ATM , CHEK 2 , RAD 51 , RAD 50 , XRCC 3 , and proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , we found several genes associated with DNA repair namely p53R2 , DDB 2 , XPC , PCNA , BTG 2 , and MSH 2 that were highly induced in TK 6 compared to WTK 1 and NH 32 . p53R2 , which is regulated by the tumor suppressor p 53 , is a small subunit of ribonucleotide reductase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have found that both structures contain ( a ) proteins involved in DNA replication ( DNA polymerase alpha , PCNA ) , ( b ) regulators of the cell cycle ( cyclin A , cdk 2 ) , and ( c ) RNA processing components like Sm and SS B / La auto antigens , p 80 coilin , hnRNPs A 1 and C1 / C2 . ^^^ For example , while DNA polymerase alpha , PCNA and hnRNP A 1 were diffusely spread throughout RB , hnRNP C1 / C2 was found only at the very outside . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
All three groups had a similar P 21 index . proliferating cell nuclear antigen labeling index , hepatit B virus DNA levels , ALT levels , and HAI scores were not different in patients with and without P 21 staining . ^^^ Spearman ' s correlation analysis found no correlation between P 21 staining and ALT and hepatit B virus DNA levels , HAI score and proliferating cell nuclear antigen labeling index . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Growth arrest and DNA damage 45 alpha ( GADD 45 alpha ) is a nuclear protein involved in maintenance of genomic stability , DNA repair , and suppression of cell growth through interaction with nuclear elements , including cyclin dependent kinase inhibitor 1A ( CDKN1A ) and PCNA . ^^^ In this study , GADD 45 alpha expression was assessed in 28 cases of hepatocellular carcinoma ( HCC ) and matched cirrhosis tissues , and correlated with the presence of DNA bound PCNA and CDKN1A as markers of DNA repair , as well as with clinicopathologic variables including histopathologic grade , tumor size , nodularity , viral status , alpha fetoprotein serum levels , and p 53 and Ki 67 immunostaining . ^^^ PCNA and CDKN1A DNA bound fractions were determined by WB . ^^^ DNA bound PCNA and CDKN1A were present in 5 HCCs and were associated with higher GADD 45 alpha protein levels assessed by ELISA . ^^^ GADD 45 alpha protein levels were higher in HCCs with DNA bound CDKN1A and PCNA , suggesting a possible role in DNA repair . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Although its deoxycytidyl transferase activity is dispensable for tolerance of DNA damage caused by a number of mutagens , its extreme C terminus , which interacts with other translesion polymerases and PCNA , is essential . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This repopulation process correlated with the remarkable upregulation of proliferating cell nuclear antigen ( PCNA ) , which is a protein involved in DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA is a ubiquitous intracellular antigen of the cycline family ( proteins that regulate the cell cycle ) , which acts as an auxiliary protein to DNA polymerase delta ; it can be detected immunocytochemically with monoclonal antibodies to reveal cell cycle phases that coincide with DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We analyzed 13 polymorphisms in seven DNA repair genes belonging to different repair pathways [ 10 ray repair cross complementing group 1 ( XRCC 1 ) : 26304C > T , 26651A > G , 28152A > G ; xeroderma pigmentosum D ( XPD ) : 23591A > G , 35931A > C ; excision repair complementing defective in Chinese hamster , group 1 ( ERCC 1 ) : 19007C > T ; XRCC 3 : 4541T > C , 17893A > G , 18067C > T ; proliferating cell nuclear antigen ( PCNA ) : 6084G > C ; ERCC 4 : 30028C > T , 30147A > G ; and XRCC 2 31479A > G ] in 317 incident bladder cancer patients and 317 controls . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Furthermore , we demonstrate that cyclin D 3 negatively regulates the transactivation activity of AML 1 in a dose dependent manner by competing with CBFbeta for AML 1 association , leading to a decreased binding affinity of AML 1 for its target DNA sequence . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA is involved in DNA replication and damage repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Leukemia inhibitory factor induces DNA synthesis in Swiss mouse 3T3 cells independently of cyclin D 1 expression through a mechanism involving MEK / ERK1 / 2 activation . ^^^ In contrast , LIF fails to promote increases in cyclin D mRNA / protein levels ; consequently , LIF induces DNA synthesis without promoting full phosphorylation of retinoblastoma protein ( Rb ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Recent findings demonstrate how SUMO modification of PCNA , the processivity clamp for replicative DNA polymerases , prevents unscheduled recombination during DNA replication by means of directly enhancing physical interactions with an anti recombinogenic helicase , Srs 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In eukaryotes , the DNA replication factor PCNA is loaded onto primer template junctions to act as a processivity factor for DNA polymerases . ^^^ Genetic and biochemical studies suggest that PCNA also functions in early steps in mismatch repair ( MMR ) to facilitate the repair of misincorporation errors generated during DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin A is an increasingly utilized proliferation marker that has functions in both S phase ( DNA replication ) and initiation of mitosis , whereas alterations of beta catenin , the molecule involved in cell cell adhesion and in signalling transduction , could promote invasive and proliferative capacities of malignant tumours . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Arteries exposed to CO also demonstrated significantly reduced DNA synthesis in the medial wall two days after injury as suggested by proliferating cell nuclear antigen immunostaining , and this was associated with a decrease in the protein expression of the G 1 cyclins , cyclin E and A , and transforming growth factor beta 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
These studies provide new insights to the interaction of WRN and BLM helicases with FEN 1 , and how these interactions might be regulated with the PCNA FEN 1 interaction during DNA replication and repair . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In contrast , KP 772 potently inhibited DNA synthesis paralleled by a massive block of cell cycle in G0 / G1 phase and a selective decrease of cyclin B 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA replication related element ( DRE ) and the DRE binding factor ( DREF ) play an important role in regulating DNA replication related genes such as PCNA and DNA polymerase alpha in Drosophila . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The homotrimeric DNA replication protein proliferating cell nuclear antigen ( PCNA ) is regulated by both ubiquitylation and sumoylation . ^^^ Our findings expand the repertoire of functions for PCNA ubiquitylation and sumoylation by elucidating a role for these modifications during the replication of undamaged DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In response to DNA damage , the Rad6 / Rad18 ubiquitin conjugating complex monoubiquitinates the replication clamp proliferating cell nuclear antigen ( PCNA ) at Lys 164 . ^^^ Significantly , only those PCNA clamps that are appropriately loaded around effector DNA by its loader , replication factor C , are ubiquitinated . ^^^ These functions include loading onto DNA by replication factor C , as well as Okazaki fragment synthesis and maturation by the PCNA coordinated actions of DNA polymerase delta , the flap endonuclease FEN 1 , and DNA ligase 1 . ^^^ However , whereas the activity of DNA polymerase zeta remains unaffected by ubiquitination of PCNA , ubiquitinated PCNA specifically activates two key enzymes in translesion synthesis : DNA polymerase eta , the yeast Xeroderma pigmentosum ortholog , and Rev 1 , a deoxycytidyl transferase that functions in organizing the mutagenic DNA replication machinery . ^^^ We propose that ubiquitination of PCNA increases its functionality as a sliding clamp to promote mutagenic DNA replication . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Upon DNA damage , ubiquitination of proliferating cell nuclear antigen ( PCNA ) induces bypass of the lesion by directing the replication machinery into the TLS pathway . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Two recent papers illuminate a key step in DNA sliding clamp loading : one reveals the structure of the PCNA clamp wrapped around DNA still open from being loaded while the other finds that the clamp may assist this process by forming a right handed helix upon opening . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here , we report that replication dependent proteolysis of Cdt 1 requires its interaction with proliferating cell nuclear antigen ( PCNA ) , a homotrimeric processivity factor for DNA polymerases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Jentsch , RAD 6 dependent DNA repair is linked to modification of PCNA by ubiquitin and SUMO , Nature 419 ( 2002 ) 135 141 ; P . ^^^ In particular they have shown that mono ubiquitinated PCNA directs translesion synthesis via DNA polymerases with low stringency , and that polyubiquitinated PCNA is associated with error free avoidance of lesions . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The human cytomegalovirus DNA polymerase is composed of a catalytic subunit , UL 54 , and an accessory protein , UL 44 , which has a structural fold similar to that of other processivity factors , including herpes simplex virus UL 42 and homotrimeric sliding clamps such as proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Apoptosis and cell proliferation were evaluated by DNA fragmentation and proliferating cell nuclear antigen assays , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Downregulation of cyclin D 1 expression by eupatilin was accompanied by a reduced expression of c Jun and the DNA binding activity of the transcription factor AP l . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Thyroid hormone induces cyclin D 1 nuclear translocation and DNA synthesis in adult rat cardiomyocytes . ^^^ These changes were accompanied by the re entry of cardiomyocytes into the cell cycle , as demonstrated by increased levels of cyclin A , PCNA , and incorporation of bromodeoxyuridine into DNA ( labeling index was 30 . 2 % in T 3 treated rats vs . 2 . 2 % in controls ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Silencing PCNA in cultured mammalian cells or repression of pcn 1 expression in fission yeast blocked Cdt 1 degradation in response to DNA damage . ^^^ We suggest that the Cul 4 Ddb1 ligase evolved to ubiquitinate Cdt 1 during normal cell growth as well as in response to DNA damage and a separate E 3 ligase , possibly SCF ( Skp 2 ) , evolved to either share or take over the function of Cdt 1 ubiquitination during normal cell growth and that PCNA is involved in mediating Cdt 1 degradation by the Cul 4 Ddb1 ligase in response to DNA damage . . ^^^ An evolutionarily conserved function of proliferating cell nuclear antigen for Cdt 1 degradation by the Cul 4 Ddb1 ubiquitin ligase in response to DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we show that the N terminus of Cdt 1 contains a second degradation signal that is active after DNA damage and in S phase and is dependent on the interaction of Cdt 1 with proliferating cell nuclear antigen ( PCNA ) through a PCNA binding motif . ^^^ Therefore PCNA , the matchmaker for many proteins involved in DNA and chromatin metabolism , also serves to promote the targeted degradation of associated proteins in S phase or after DNA damage . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) has no intrinsic enzymatic function , but functions as a sliding platform to mediate protein interactions with the DNA strand . ^^^ Proliferating cell nuclear antigen ( PCNA ) has no intrinsic enzymatic function , but functions as a sliding platform to mediate protein interactions with the DNA strand . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
P21Cip1 / WAF1 downregulation is required for efficient PCNA ubiquitination after UV irradiation . p 21 ( Cip1 / WAF1 ) is a known inhibitor of the short gap filling activity of proliferating cell nuclear antigen ( PCNA ) during DNA repair . ^^^ Recent reports have identified ubiquitination of PCNA as a relevant feature for PCNA dependent DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The examination of proliferating cell nuclear antigen expression indicated that OP 18 / animals have increased proliferative or DNA repair activity for a more prolonged duration . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
At 24 h after PH , DNA synthesis and PCNA expression were identical in treated and control rats and thus occurred irrespectively of the status of NF kappa B activation at 0 . 5 h . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This correlates with a reduction of the levels of cyclin A , cyclin A dependent kinase activity , p 27 ( kip 1 ) and the catalytic subunit of DNA polymerase delta . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Several proliferation markers , such as DNA ploidy , Ki 67 , MiB 1 and proliferating cell nuclear antigen have been shown to correlate with clinical course and prognosis in several epithelial tumours and lymphomas . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Etoposide also triggers the dispersal of replicative proteins , proliferating cell nuclear antigen and DNA ligase 1 , from replication factories . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
After confirming 22 HPV types among 95 cervical swabs , 10 cervical tissues , and seven established cell lines using a DNA chip , we evaluated the functional activities of G 2 molecules assays , that included ; western blotting for cyclin B 1 , cdc 2 and phospho cdc 2 ( Y 15 and T 161 ) , immunoprecipitation for cdc 2 , a nuclear extraction fractional assay , and RT PCR for cyclin B 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Results indicate that overexpression of GAPDH does not affect the timing of DNA replication but induces an increase in the number of mitosis , an advancement of the peak of cyclin B cdk 1 activity and an acceleration of cell cycle progression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA ploidy , cyclin D 1 , bcl 2 and lymphocytic infiltration of the tumor microenvironment as prognostic factors in laryngeal cancer patients . ^^^ The aim of this study was to evaluate correlations between DNA ploidy type , the immunostaining of cyclin D 1 , bcl 2 and the intensity of lymphocytic infiltration of the tumor microenvironment in relation to the histopathological G differentiation and pTNM classification . ^^^ DNA ploidy value correlated with cyclin D 1 expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here we investigate the role of chromatin assembly factor 1 ( CAF 1 ) and its interacting protein , PCNA , in the response of quiescent human cells to DNA double strand breaks ( DSBs ) . ^^^ CAF 1 and PCNA are recruited to damaged chromatin undergoing DNA repair of single and double strand DNA breaks by the base excision repair and nonhomologous end joining pathways , respectively , in the absence of extensive DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Additional APC / C antagonists are known to block complete cyclin destruction between meiosis 1 and 2 , thereby ensuring that cyclin dependent kinases remain active and that DNA replication does not occur . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA is essential for Cul 4 but not Skp 2 directed degradation during DNA replication and following ultraviolet irradiation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We also found that the clones with cytoplasmic PELP 1 overexpression had significantly less antiapoptotic protein Bcl 2 and nuclear factor kappaB DNA binding , but increased cyclin E expression , further supporting evidence that these cells are sensitive to apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Mammalian DNA polymerase delta ( pol delta ) , a key enzyme of chromosomal DNA replication , consists of four subunits as follows : the catalytic subunit ; p 125 , which is tightly associated with the p 50 subunit ; p 68 , a proliferating cell nuclear antigen ( PCNA ) binding protein ; and a fourth subunit , p 12 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We report here that proliferating cell nuclear antigen ( PCNA ) , the clamp loader complex ( RF C ) , and a series of MMR proteins like MSH 2 , MSH 6 , MLH 1 , and hPSM 2 can be assembled to Epstein Barr virus replication compartments , the sites of viral DNA synthesis . ^^^ Levels of the DNA bound form of PCNA increased with progression of viral productive replication . ^^^ Bromodeoxyuridine labeled chromatin immunodepletion analyses confirmed that PCNA is loaded onto newly synthesized viral DNA as well as BALF 2 and BMRF 1 viral proteins during lytic replication . ^^^ Furthermore , the anti PCNA , MSH 2 , MSH 3 , or MSH 6 antibodies could immunoprecipitate BMRF 1 replication protein probably via the viral DNA genome . ^^^ PCNA loading might trigger transfer of a series of host MMR proteins to the sites of viral DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Stoichiometric complex formation by proliferating cell nuclear antigen ( PCNA ) and its interacting protein : purification and crystallization of the DNA polymerase and PCNA monomer mutant complex from Pyrococcus furiosus . ^^^ Replicative DNA polymerase interacts with processivity factors , the beta subunit of DNA polymerase 3 or proliferating cell nuclear antigen ( PCNA ) , in order to function with a long template DNA . ^^^ The archaeal replicative DNA polymerase from Pyrococcus furiosus interacts with PCNA via its PCNA interacting protein ( PIP ) motif at the C terminus . ^^^ A stable complex of the DNA polymerase with PCNA , using a PCNA monomer mutant , has been purified and crystallized . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Clinical diagnosis is made by using modern diagnostic procedures ( ECHO , CT , MRI , PET scan ) , and tumor markers ( DNA content , p 53 , E Catherine , pRb retinoblastoma , BCL 2 , PCNA , telomerase , NMP 22 , BTA test , etc . ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Deubiquitinating PCNA : a downside to DNA damage tolerance . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Inhibition of PCNA prevented GFP induction in veins and reduced viral DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin dependent kinase inhibitor p21CDKN1A plays a fundamental role in the DNA damage response by inducing cell cycle arrest , and by inhibiting DNA replication through association with the proliferating cell nuclear antigen ( PCNA ) . ^^^ Here , we provide evidence that a pool of p 21 protein is rapidly recruited to UV induced DNA damage sites , where it colocalises with PCNA and PCNA interacting proteins involved in nucleotide excision repair ( NER ) , such as DNA polymerase delta , XPG and CAF 1 . ^^^ These results indicate that early recruitment of p 21 protein to DNA damage sites is a NER related process dependent on interaction with PCNA , thus suggesting a direct involvement of p 21 in DNA repair . . ^^^ Spatiotemporal dynamics of p21CDKN1A protein recruitment to DNA damage sites and interaction with proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 genotypes ( AA , AG , GG ) were determined using PCR RFLP analysis on genomic DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
REV 3 and REV 1 play major roles in recombination independent repair of DNA interstrand cross links mediated by monoubiquitinated proliferating cell nuclear antigen ( PCNA ) . ^^^ Indeed , the monoubiquitination defective Proliferating Cell Nuclear Antigen ( PCNA ) mutant exhibits impaired recombination independent ICL repair as well as drastically reduced mutation rate , indicating that the PCNA switch is utilized to enable lesion bypass during DNA repair synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Ectoexpression of cyclin A counteracts p 16 mediated inhibition of DNA binding of Sp 1 and activates MMP 2 promoter activity and mRNA expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , a co factor of DNA polymerases delta and epsilon , is essential for DNA replication and repair . ^^^ PCR using genomic DNA as the template yielded multiple products whose sequences revealed multiple copies of pcna in tandem repeats separated by an unknown sequence . ^^^ Proliferating cell nuclear antigen ( PCNA ) , a co factor of DNA polymerases delta and epsilon , is essential for DNA replication and repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here , we show that the DUB ubiquitin specific protease 1 ( USP 1 ) deubiquitinates the DNA replication processivity factor , PCNA , as a safeguard against error prone translesion synthesis ( TLS ) of DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The eukaryotic replication factor C ( RFC ) clamp loader is an AAA+ spiral shaped heteropentamer that opens and closes the circular proliferating cell nuclear antigen ( PCNA ) clamp processivity factor on DNA . ^^^ Consistent with this result , Rfc2 . 3 . 4 . 5 and Rfc2 . 5 subassemblies are capable of opening and unloading PCNA from circular DNA . ^^^ RFC DNA damage checkpoint clamp loader unloads PCNA clamps from DNA . ^^^ RFC may clear PCNA from DNA to facilitate shutdown of replication in the face of DNA damage . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Mutational mapping of receptor reveals a requirement for its N terminal region and DNA binding domain to support cyclin G 2 repression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The candidate genes belong to different DNA repair pathways : base excision repair ( OGG 1 , LIG 3 , APEX , POLB , XRCC 1 , PCNA , and MUTYH ) , nucleotide excision repair ( ERCC 1 , ERCC 2 , ERCC 4 , and ERCC 5 ) , double strand breaks repair ( XRCC 2 , XRCC 3 , and XRCC 9 ) , and reversion repair ( MGMT ) genes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In DNA damaged yeast cells proliferating cell nuclear antigen ( PCNA ) becomes monoubiquitylated at the K 164 residue , and genetic studies in yeast have indicated a requirement for this modification in TLS mediated by Poleta and Polzeta . ^^^ We show that , in addition to the requirement for Rad 6 Rad18 , the reaction depends on the loading of the PCNA homotrimeric ring onto the DNA by replication factor C and that all three PCNA monomers become efficiently ubiquitylated . ^^^ The availability of PCNA monoubiquitylated on all of its three monomers has enabled us to examine the effects of this PCNA modification on DNA synthesis by Pols delta , eta , zeta , and Rev 1 . ^^^ Ubiquitylation of yeast proliferating cell nuclear antigen and its implications for translesion DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis as well as p 21 ( Cip 1 ) , p 27 ( Kip 1 ) , and cyclin D1mRNA and protein levels were evaluated at different times ( 12 , 24 , 36 , and 48 hours ) of incubation . ^^^ E 2 increased DNA synthesis was correlated with cyclin D 1 and p 21 ( Cip 1 ) ( mRNA and protein ) variations that were reversed by the addition of ICI 182780 . p 27 ( Kip 1 ) protein levels progressively increased regardless of the presence of E 2 or ICI 182780 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
From these results , the CHP samples with low mitotic index were classified into either the aneuploid group with higher PCNA index or the diploid group with lower PCNA index , suggesting that DNA ploidy and proliferative activity may give an indication about malignancy of CHPs with a low mitotic index . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The gene promoter of Drosophila proliferating cell nuclear antigen ( dPCNA ) contains several transcriptional regulatory elements , such as upstream regulatory element ( URE ) , DNA replication related element ( DRE , 5 ' TATCGATA ) , and E2F recognition sites . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Tissue regeneration was assessed by ( 3 ) H thymidine incorporation into hepato and nephro nuclear DNA and by proliferating cell nuclear antigen staining . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Reversible monoubiquitination of PCNA : A novel slant on regulating translesion DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Prostaglandin F2alpha ( PGF2alpha ) induces cyclin D 1 expression and DNA synthesis in Swiss 3T3 cells . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Ubiquitination of proliferating cell nuclear antigen ( PCNA ) plays a crucial role in regulating replication past DNA damage in eukaryotes , but the detailed mechanisms appear to vary in different organisms . ^^^ We show that PCNA modification and cell cycle checkpoints represent two independent signals in response to DNA damage . ^^^ Finally , we unexpectedly find that PCNA is ubiquitinated in response to DNA damage when cells are arrested in G2 . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To investigate the response of tumour growth to cisplatin treatment , in relation to p 53 mutation and cyclin D 1 dysregulation on DNA and protein level , biopsies from seven xenografted human squamous cell carcinomas from the head and neck were analysed with immunohistochemistry for p 53 expression and cyclin D 1 expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RNA interference mediated depletion and chromatin immunoprecipitation assays show that endogenous ACTR directly controls the expression of genes important for initiation of DNA replication , which include cdc 6 , cdc25A , MCM 7 , cyclin E , and Cdk 2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Levels of cell cycle specific markers [ p 21 , p 27 , cyclin A , cyclin B 1 , and pcdc 2 ( Y 15 ) ] and DNA damage signaling proteins [ gammaH2AX , pChk 1 ( S 317 ) , and pChk 2 ( T 68 ) ] supported these altered cell cycle kinetics . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A circular DNA substrate is used for detection of both DNA polymerase beta dependent and proliferating cell nuclear antigen ( PCNA ) dependent pathways . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Analysis of proliferating cell nuclear antigen ( PCNA ) associated with DNA . ^^^ Proliferating cell nuclear antigen ( PCNA ) is a homotrimeric protein adopting a ring structure that may encircle DNA . ^^^ In this form , PCNA functions as a sliding platform to which different types of catalytic and regulatory proteins are tethered to perform DNA transactions such as replication and repair synthesis , methylation , chromatin assembly and remodeling , as well as sister chromatid cohesion . ^^^ In addition , PCNA coordinates DNA metabolism with cell cycle progression by interacting with cyclins , cyclin dependent kinases ( CDK ) , and CDK inhibitors . ^^^ PCNA participates in different pathways of DNA repair , including nucleotide and base excision repair , as well as mismatch repair , by interacting with proteins involved in these processes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) is a homotrimeric ring shaped protein that , by encircling DNA , may function as a sliding platform for proteins participating in various DNA transactions . ^^^ PCNA plays a fundamental role in DNA replication and repair , but also in postreplicative events , like DNA methylation , chromatin assembly and remodeling , sister chromatid cohesion , and coordinates these activities with cell cycle control . ^^^ Based on emerging evidence , 1 suggest that 1 ) PCNA interacting proteins may be reclassified in three major categories , namely , a ) cell cycle control ; b ) DNA replication / repair ; c ) chromatin regulation / transcription . 2 ) PCNA is a negative regulator , rather than a processivity / recruitment factor , of chromatin modifying enzymes . 3 ) At DNA replication sites , PCNA function may be envisaged with a model of `` dynamic hand off ' ' of interacting partners that rapidly and transiently exchange in a mutually exclusive manner , while cyclin dependent kinase ( Cdk ) 2 ( CDK 2 ) is stably bound to PCNA . ^^^ The partner exchange might occur through a conformational change of the PCNA / protein / DNA complex allowing CDK 2 to phosphorylate the partner protein , thereby enabling its hand off from PCNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
This regulation may be mediated by binding of p 21 to PCNA and via DNA damage induced ubiquitination of PCNA , which is stimulated by p 53 and p 21 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Epigenetic and proteolytic inactivation of 14 3 3sigma in breast and prostate cancers . 14 3 3sigma is an epithelial marker whose expression is induced by DNA damage through a p 53 dependent pathway . 14 3 3sigma functions sequesters cyclin B 1 CDC2 complexes outside the nucleus and thereby contributes to a G 2 arrest . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) , clamp loader of DNA polymerase , was phosphorylated in WT MEFs after 1 Gy irradiation and redistributed to form foci in the nuclei . ^^^ These results demonstrate that the novel low dose specific p 53 dependent S phase DNA damage checkpoint is likely to regulate the replication fork movement through phosphorylation of PCNA . . ^^^ Proliferating cell nuclear antigen ( PCNA ) , clamp loader of DNA polymerase , was phosphorylated in WT MEFs after 1 Gy irradiation and redistributed to form foci in the nuclei . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Radiations also induced activation and induction of some antioxidant enzymes , increase in DNA repair related proteins ( p 53 and Proliferating Cell Nuclear Antigen ) and variations of the transcription factors Peroxisome Proliferator Activated Receptors . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin like uracil DNA glycosylase ( UDG ) of murine oocytes and its relationship to human and chimpanzee homologues . ^^^ Examination of electrophoretically resolved randomly generated PCR amplicons from mature murine oocytes revealed the presence of a short sequence with partial homology to a cyclin like human uracil DNA glycosylase ( UDG 2 ) , a member of an important group of base excision enzymes that remove misincorporated or cytosine derived uracil from nascent DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 repressed ROCKII and TSP 1 expression , and the migratory defect of cyclin D 1 ( / ) cells was reversed by ROCK inhibition or TSP 1 immunoneutralizing antibodies . cyclin E knockin to the cyclin D 1 ( / ) MEFs rescued the DNA synthesis defect of cyclin D 1 ( / ) MEFs but did not rescue either the migration defect or the abundance of ROCKII . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Proliferating cell nuclear antigen ( PCNA ) is essential for the replication of deoxyribonucleic acid ( DNA ) . ^^^ Proliferating cell nuclear antigen ( PCNA ) is essential for the replication of deoxyribonucleic acid ( DNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
P 21 ( Waf 1 ) cyclin dependent kinase inhibitor blocks cell cycle transition from G 1 phase into DNA replication after DNA damage . ^^^ The main targets of p 21 ( Waf 1 ) are Cyc 1E Cdk 2 and Cyc 1A Cdk 2 complexes , PCNA ( proliferating cell nuclear antigen ) , a subunit of DNA polymerase delta , and E2F 1 transcription factor . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RESULTS : 5 FU treatment for 24 hours resulted in S phase arrests , p 53 accumulation , up regulation of p 53 target genes on DNA damage response ( ATF 3 , GADD 34 , GADD45A , PCNA ) , cell cycle regulatory ( CDKN1A ) , and apoptosis regulatory pathways ( FAS ) , and apoptosis induction in the parental and resistant cell lines . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
After confirming functionality of the cyclin T 1 , we immunized mice intramuscularly once or twice with the replication defective HIV vector pseudotyped with vesicular stomatitis virus ( VSV ) G protein ( RD HIV ) , a plasmid encoding CMV driven gag ( gag DNA ) , or adenovirus gag ( Ad 5 gag ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the presence of GINS , Pol epsilon is more processive and dissociates more readily from replicated DNA , while under identical conditions , proliferating cell nuclear antigen slightly stimulates Pol epsilon in vitro . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In Drosophila , PcG factors associate with specific DNA regions termed PcG response elements ( PREs ) , and a PRE was recently identified in the gene encoding Cyclin A . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
So were biosynthetic activities such as DNA repair / synthesis , immunohistochemically assessed by proliferating cell nuclear antigen , transcription activity by spliceosome component of 35 kDa , and translation efficiency by 70 kDa S 6 protein kinase . ^^^ Additionally , most of the proliferating cell nuclear antigen positive nuclei co expressed oxidative DNA damage markers . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have analyzed the CO outcome in the absence of the Srs 2 and Sgs 1 helicases , DNA damage checkpoint proteins as well as in a mutant proliferating cell nuclear antigen ( PCNA ) and found that they all contribute to genome stability . ^^^ Our results support the view that Mrc 1 plays a specific role in DNA replication , promoting the Srs 2 recruitment to PCNA independently of checkpoint signaling . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA fragmentation and expression of Bax , caspase 3 , caspase 8 , caspase 9 , Fas L , Bcl 2 , GATA 4 , Ki 67 , and PCNA were observed in the whole ovary in both groups . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
It binds the DNA glycosylase MutY homolog , and stimulates DNA polymerase beta , flap endonuclease 1 , and DNA ligase 1 . 9 1 1 resembles proliferating cell nuclear antigen ( PCNA ) , which stimulates some of these same repair enzymes , and is loaded onto DNA in a similar manner . ^^^ Unlike PCNA , 9 1 1 stimulates DNA ligase 1 activity to the same extent on both linear and circular substrates , indicating that encirclement is not a requirement for stimulation . ^^^ These data are consistent with a direct role for 9 1 1 in DNA repair , but possibly employing a different mechanism than PCNA . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
However , antioxidant treated cells failed to accumulate cyclin A protein , a requisite step for initiation of DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The supernatants not only significantly enhanced the PCNA labeling index and ( 3 ) H thymidine incorporation of proliferating hepatocytes isolated from rats after partial hepatectomy but also obviously increased the DNA synthesis of quiescent hepatocytes from the control rats . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
MYC may induce inappropriate DNA replication through the activation of Cyclin E / CDK2 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Using DNA microarray technology , we found that more than 20 % of genes induced by PMA require cyclin T 1 for their normal level of induction , and approximately 15 % of genes repressed by PMA require cyclin T 1 for their normal level of repression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The proliferating cell nuclear antigen ( PCNA ) functions as a sliding clamp for DNA polymerase , and is thus a key actor in DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Taken together , our results suggest that diubiquitinated Mcm 10 interacts with PCNA to facilitate an essential step in DNA elongation . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Unlike other REV genes , which encode DNA polymerases and an associated subunit , REV 6 has been found to be identical to POL 30 , which encodes proliferating cell nuclear antigen ( PCNA ) , the subunit of the homotrimeric sliding clamp , in which the rev 6 1 mutation produces a G178S substitution . ^^^ This substitution appears to abolish all DNA damage tolerance activities normally carried out by the RAD6 / RAD18 pathway , including translesion replication by DNA polymerase zeta / Rev1 and DNA polymerase eta , and the error free , recombination dependent component of this pathway , but has little effect on the growth rate , suggesting that G178S may prevent ubiquitination of lysine 164 in PCNA . ^^^ The Saccharomyces cerevisiae rev 6 1 mutation , which inhibits both the lesion bypass and the recombination mode of DNA damage tolerance , is an allele of POL 30 , encoding proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In both humans and yeast , lesion bypass and restart of DNA synthesis can occur through an error prone pathway activated following mono ubiquitination of proliferating cell nuclear antigen ( PCNA ) , a protein found at sites of replication , and recruitment of specialized translesion synthesis polymerases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The replication clamp PCNA and its loader RFC ( Replication Factor C ) are central factors required for processive replication and coordinated DNA repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition to FFA 1 , DNA polymerase delta ( Poldelta ) and replication protein A , but not DNA polymerase epsilon and proliferating cell nuclear antigen , accumulated increasingly on replication arrested chromatin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We show that MLCK ( myosin light chain kinase ) plays a key role in cell cycle progression of hepatocytes : either chemical inhibitor ML 7 or RNA interference led to blockade of cyclin D 1 expression and DNA replication , providing evidence that MLCK regulated S phase entry . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
As proof of principle , we illustrate MEP using assays of p 16 and cyclin A 1 promoters in a methylated DNA dilution matrix and also in a clinical setting using paired saliva and oral tumour specimens . ^^^ In our clinical example , MEP of saliva derived DNA was more sensitive than standard non methylation specific pyrosequencing as illustrated using p 16 and cyclin A 1 promoter methylation assays . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
OBJECTIVES : Cyclin E 1 is expressed during the late G 1 phase of the cell cycle and mediates the initiation of DNA synthesis by activating cyclin dependent kinases 2 ( CDK 2 ) . ^^^ METHODS : RNA interference , expressed from a DNA based retroviral vector , was used to knockdown cyclin E 1 in adenocarcinoma ( HeLa ) , breast ( MDA MB 31 ) and glioblastoma ( U 373 MG ) cell lines and an explant from one glioma patient ( GB LP 2 ) . ^^^ DISCUSSION : Our results indicate that retrovirus carrying the DNA to be transcribed into a short hairpin RNA ( shRNA ) against cyclin E 1 could be used as a therapeutic agent for cancer therapy . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The cyclin D 1 gene encodes a regulatory subunit of the holoenzyme that phosphorylates and inactivates the pRb tumor suppressor to promote nuclear DNA synthesis . cyclin D 1 is overexpressed in human breast cancers and is sufficient for the development of murine mammary tumors . ^^^ Cyclin D 1 thus integrates nuclear DNA synthesis and mitochondrial function . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Functional and physical interaction of yeast Mgs 1 with PCNA : impact on RAD 6 dependent DNA damage tolerance . ^^^ Proliferating cell nuclear antigen ( PCNA ) , a sliding clamp required for processive DNA synthesis , provides attachment sites for various other proteins that function in DNA replication , DNA repair , cell cycle progression and chromatin assembly . ^^^ We provide evidence that Mgs 1 physically associates with PCNA and that Mgs 1 helps suppress the RAD 6 DNA damage tolerance pathway in the absence of exogenous DNA damage . ^^^ We also show that PCNA sumoylation inhibits the growth of mgs 1 rad18 double mutants , in which PCNA sumoylation and the Srs 2 DNA helicase coordinately prevent RAD 52 dependent homologous recombination . ^^^ Proliferating cell nuclear antigen ( PCNA ) , a sliding clamp required for processive DNA synthesis , provides attachment sites for various other proteins that function in DNA replication , DNA repair , cell cycle progression and chromatin assembly . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Rad 9 , Rad 1 , and Hus 1 proteins form a toroidal complex , termed the 9 1 1 complex , that is involved in checkpoint signaling . 9 1 1 shares high structural similarity to the DNA replication protein proliferating cell nuclear antigen ( PCNA ) and 9 1 1 has been shown in vitro to stimulate steps of the repair process known as long patch base excision repair . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
TAT p 16 inhibited DNA synthesis in B 1a cells stimulated by PMA , CD40L , or LPS as well as endogenous pRb phosphorylation by cyclin D cyclin dependent kinase 4 / 6 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
DNA synthesis was analyzed by proliferating cell nuclear antigen ( PCNA ) , Ki 67 , and BrdU . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In addition , recently reported cases of IPM have been seen with cyclin 1 overexpression and also with human herpes virus ( HHV ) 8 and EBV DNA sequences . ^^^ In our case , there was no evidence of HHV 8 and EBV DNA sequences and we were not able to find cyclin 1 overexpression . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Conversely , CAF 1 recruitment is reduced in a PCNA / DNA loading assay using Cdc 7 depleted extracts . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Herein , we show the physical and functional interaction between DNA ligase and proliferating cell nuclear antigen ( PCNA ) from the hyperthermophilic Euryarchaea Pyrococcus furiosus . ^^^ The stimulatory effect of P . furiosus PCNA on the enzyme activity of P . furiosus DNA ligase was observed not at low ionic strength , but at a high salt concentration , at which a DNA ligase alone can not bind to a nicked DNA substrate . ^^^ On the basis of mutational analyses , we identified the amino acid residues that are critical for PCNA binding in a loop structure located in the N terminal DNA binding domain of P . furiosus DNA ligase . ^^^ Identification of a novel binding motif in Pyrococcus furiosus DNA ligase for the functional interaction with proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
How SAM regulates hepatocyte growth is unclear , but because SAM blocks hepatocyte growth factor ( HGF ) induced cyclin D 1 expression and DNA synthesis without affecting HGF induced extracellular signal regulated kinase phosphorylation , the mitogen activated protein kinase ( MAPK ) pathway is probably not the target . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Mutational analysis and binding studies revealed that DNA Ligase 1 was recruited to DNA repair sites by interaction with PCNA while DNA Ligase 3 was recruited via its BRCT domain mediated interaction with XRCC 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In situ nick end labeling of genomic DNA ( TUNEL ) and immunohistochemistry of proliferating cells nuclear antigen ( PCNA ) were used as indicators of apoptosis and cell proliferations , respectively . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We assessed the biological effects of mammalian Nit 1 expression in comparison with Fhit and observed that : 1 ) Nit 1 expression was observed in most normal tissues and overlapped partially with Fhit expression ; 2 ) Nit 1 deficient mouse kidney cells exhibited accelerated proliferation , resistance to DNA damage stress , and increased cyclin D 1 expression ; 3 ) cyclin D 1 was up regulated in Nit 1 null mammary gland and skin ; 4 ) Nit 1 overexpression induced caspase dependent apoptosis in vitro ; and 5 ) Nit 1 allele deficiency led to increased incidence of N nitrosomethylbenzylamine induced murine forestomach tumors . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cyclin D 1 repression of nuclear respiratory factor 1 integrates nuclear DNA synthesis and mitochondrial function . ^^^ Cyclin D 1 promotes nuclear DNA synthesis through phosphorylation and inactivation of the pRb tumor suppressor . ^^^ Cyclin D 1 abundance thus coordinates nuclear DNA synthesis and mitochondrial function . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Although pre replicative complexes ( pre RCs ) were formed soon after mixing plasmids with egg extracts , binding of CDC 45 , RPA , Pol alpha , delta and epsilon , and PCNA to the circular plasmid was delayed , but still correlated with DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
During DNA replication , recruitment of error prone translesion polymerases may be mediated by Rad6 / Rad18 mediated ubiquitination of proliferating cell nuclear antigen , a major switchboard controlling the fidelity of DNA lesion bypass in eukaryotes . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Ubiquitination of proliferating cell nuclear antigen ( PCNA ) at K 164 by RAD6 / RAD18 has a key role in DNA damage tolerance in yeast . ^^^ As in yeast , mutation of K 164 of PCNA to arginine in the avian cell line DT 40 results in sensitivity to DNA damage but , by contrast , the DT 40 pcnaK164R mutant is more sensitive than the rad 18 mutant . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
With multiple interacting partners , PCNA is involved in processes ranging from DNA replication and repair to cell cycle control and apoptosis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Cell proliferation was detected in tissue sections by immunostaining for proliferating cell nuclear antigen , and apoptotic cells were detected by terminal deoxynucleotidyl transferase mediated dUTP nick end labeling of fragmented DNA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Hepatic regeneration was evaluated by the dry weight of the remaining liver , the hepatic regeneration rate , the hepatic DNA content , and the hepatocyte proliferation rate using the `` proliferating cell nuclear antigen ' ' ( PCNA ) content . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We have shown previously that cyclin dependent kinases ( CDKs ) , along with their downstream effectors , Rb ( retinoblastoma ) and E2F / DP1 ( E 2 promoter binding factor / deleted in polyposis 1 ) , regulate neuronal death evoked by the DNA damaging agent camptothecin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Here , we report that in yeast and humans Eco 1 is directly physically coupled to the replication protein PCNA , a ring shaped cofactor of DNA polymerases . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
RPA and PCNA suppress formation of large deletion errors by yeast DNA polymerase delta . ^^^ In fulfilling its biosynthetic roles in nuclear replication and in several types of repair , DNA polymerase delta ( pol delta ) is assisted by replication protein A ( RPA ) , the single stranded DNA binding protein complex , and by the processivity clamp proliferating cell nuclear antigen ( PCNA ) . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In particular , evidences suggest that Rb loss and target gene deregulation impacts on the repair of UV induced pyrimidine pyrimidone photoproducts ( 6 4 PP ) by regulating the expression of several DNA damage factors involved in UV DNA damage repair processes , including proliferating cell nuclear antigen . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In mouse and human fibroblasts , we found a significant positive correlation between the levels of SIRT 1 and proliferating cell nuclear antigen ( PCNA ) , a DNA processing factor expressed during S phase . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We recently showed that phosphorylation of Thr 286 is responsible for a decline in cyclin D 1 levels during S phase , an event required for efficient DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The archaeal / eukaryotic proliferating cell nuclear antigen ( PCNA ) toroidal clamp interacts with a host of DNA modifying enzymes , providing a stable anchorage and enhancing their respective processivities . ^^^ The structure explains the specificity of the individual archaeal PCNA subunits for selected repair enzyme ' clients ' , and provides insights into the co ordinated assembly of sequential enzymatic steps in PCNA scaffolded DNA repair cascades . . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A novel function of DNA polymerase zeta regulated by PCNA . ^^^ These replication defects lead to ubiquitination of PCNA even in the absence of DNA damage . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The expression of cyclin A , cyclin B 1 , cdk 1 , and cdc25C , as well as the cdk 1 associated kinase activities , is upregulated after DNA damage , provoking a mutant p53 / NF Y dependent increase in DNA synthesis . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Analysis of DNA replication proteins loaded onto DNA during S phase showed that the amount of proliferating cell nuclear antigen ( PCNA ) , a cofactor of DNA replication enzymes , was significantly reduced by roscovitine . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
To better understand this central role in mutagenesis in vivo , here we report the fidelity of DNA synthesis in vitro by yeast pol zeta alone and with RFC , PCNA and RPA . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Genetic deletion studies demonstrated a requirement for cyclin D 1 in DACH 1 mediated inhibition of DNA synthesis . ^^^ DACH 1 repressed cyclin D 1 through a novel mechanism via a c Jun DNA binding partner , requiring the DACH 1 alpha helical DS domain which recruits corepressors to the local chromatin . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
A portion of this decrease can be attributed to cell cycle arrest as evidenced by decreased DNA synthesis , increased p 21 protein expression , and decreased cyclin D 1 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In cells infected with the recombinant virus , cyclin A mRNA and protein are induced , and there is a significant delay in viral early gene expression and DNA replication . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
PCNA is a ring shaped protein that encircles DNA , providing a platform for the association of a wide variety of DNA processing enzymes that utilize the PCNA sliding clamp to maintain proximity to their DNA substrates . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
In the present work , the influence of several BER proteins such as flap endonuclease 1 ( FEN 1 ) , PCNA , and apurinic / apyrimidinic endonuclease 1 ( APE 1 ) on the activity of Pol lambda was investigated . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The in vitro and in vivo activities of MYH can be modulated by several proteins including apurinic / apyrimidinic endonuclease ( APE 1 ) , proliferating cell nuclear antigen ( PCNA ) , and mismatch recognition enzymes MSH2 / MSH6 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The mRNA detected using BnCYC 1 was restricted to young leaves and the shoot apex , suggesting divergent , organ specific roles for cyclin family members . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
The expression patterns of cyclin B ( mitotic cyclin ) and cyclin E ( G 1 cyclin , essential for G1 / S transition in both mitotic and endoreplicative cell cycles ) in the course of silk gland development revealed that mitotic cell divisions take place only in the apex of the growing silk gland . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Selected SNPs belong to the following genes : ADH1B , ALDH 2 , APEX , CDKN2A , COMT , CYP1A1 , CYP1A2 , CYP1B1 , CYP2A6 , CYP2C19 , CYP2C9 , CYP2E1 , CYP3A4 , DRD 2 , DRD 4 , EPHX 1 , ERCC 1 , ERCC 2 , ERCC 4 , ERCC 5 , GRPR , GSTA 4 , GSTM 3 , GSTP 1 , GSTT 2 , LIG 3 , MDM 2 , MGMT , MPO , NAT 1 , NAT 2 , NQO 1 , OGG 1 , PCNA , POLB , SLC6A3 , SOD 2 , TP 53 , XRCC 1 , XRCC 2 , XRCC 3 , and XRCC 9 . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
We found that Ref 1 over expression enhances the ability of p 53 to transactivate a number of p 53 target promoters and increases the ability of p 53 to stimulate endogenous p 21 and cyclin G expression . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Finally , the relative abundance of the large form of Ref 1 was found to correlate with proliferating cell nuclear antigen levels , suggesting a correlation with increased proliferation . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
Hepatic expression of polymerase beta , Ref 1 , PCNA , and Bax in WY 14 , 643 exposed rats and hamsters . ^^^ The hepatic levels of three protein markers of oxidative stress , polymerase beta , Ref 1 , and PCNA , and of the pro apoptotic protein , Bax , were quantitated after exposure to WY 14 , 643 ( 500 ppm in the feed ) for 6 or 34 days in a rodent that is susceptible peroxisome proliferator ( PP ) induced liver tumors ( the Sprague Dawley rat ) and in a rodent that is relatively resistant PP induced liver tumors ( the Syrian hamster ) . ^^^ The analysis of detergent extracted whole liver homogenates by immunoblotting showed a marked increase in the abundance of a 45 kDa variant of polymerase beta immunoreactivity and significant increases in the expression of Ref 1 and PCNA in WY 14 , 643 exposed rats . ^^^ WY 14 , 643 exposed hamsters expressed only trace levels of the polymerase beta variant and showed significant decreases in the expression of Ref 1 and PCNA . ^^^ The analysis of subcellular fractions of rat liver showed that the pathological increases in the levels of polymerase beta , Ref 1 , and PCNA were especially prominent in mitochondria enriched particulate liver subfractions . ^^^
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA
Interacting proteins: P27695 and P12004	Pubmed	SVM Score :0.0
NA