Pubmed abstracts for Protein-Protein Interaction search result :


Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
GST 4 forms with GST 1 a heterodimeric band . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
NA
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.55506099
In this retrospective cohort , we have investigated associations between common GSTM 1 , GSTM 3 and GSTP 1 polymorphisms with factors known to influence clinical out come and patient survival in colorectal cancer . 0.55506099^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Human muscle specific glutathione S transferase ( RX : glutathione R transferase , EC 2 . 5 . 1 . 18 ) ( GST 4 ) and liver GST 1 have been purified and subjected to N terminal sequence analysis . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
A polymorphism in exon 7 of the cytochrome P 450 1A1 ( CYP1A1 ) and A homozygous gene deletion at the glutathione S transferase M 1 ( GSTM 1 ) locus of genomic DNA isolated from peripheral blood were investigated for its relationship with lung , oral and urothelial cancer using the polymerase chain reaction ( PCR ) technique . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Glutathione S transferase mu 1 ( GSTM 1 ) : susceptibility gene of breast cancer ] . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The genes glutathione S transferase M 1 ( GSTM 1 ) ( chromosome 1p13 . 3 ) and glutathione S transferase T 1 ( GSTT 1 ) ( 22q11 . 2 ) code for cytosolic enzymes glutathione S transferase ( GST ) mu and GST theta , respectively , which are involved in phase 2 metabolism . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Blood was analyzed with aldehyde dehydrogenase 2 ( ALDH 2 ) and glutathione S transferase M 1 ( GSTM 1 ) genotyping . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Increased risk for acute myeloid leukaemia in individuals with glutathione S transferase mu 1 ( GSTM 1 ) and theta 1 ( GSTT 1 ) gene defects . ^^^ Both the GST mu 1 ( GSTM 1 ) and GST theta 1 ( GSTT 1 ) genes have a null variant allele in which the entire gene is absent . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
With the assay , we tested the effectiveness of a set of 15 phosphorothioate ODNs against rat glutathione S transferase Mu 1 ( GSTM 1 ) and / or Mu 2 ( GSTM 2 ) . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
OBJECTIVE : The objective was to determine the prevalence of the polymorphisms of the microsomal epoxide hydrolase ( Ephx 1 ) , glutathione S transferase mu 1 ( GSTM ) , theta 1 ( GSTT 1 ) , and pi 1 ( GSTP 1 ) genes in patients with oropharyngeal carcinoma . ^^^ There was an overrepresentation of homozygosity for the GSTT 1 ( glutathione S transferase theta 1 ) null allele [ but not for the GSTM 1 ( glutathione S transferase mu 1 ) null allele ] in ever smokers , when compared with controls . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The GST mu 1 ( GSTM 1 ) and GST theta 1 ( GSTT 1 ) genes have a null allele variant in which the entire gene is absent . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The primary hepatic transcript was that encoding GSTM 1 1 with much lesser amounts of GSTM 3 3 , but livers were devoid of GSTM 2 2 , and GSTM 5 5 . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
GSTM ( GSTM 1 1 ) was found in 9 controls and in 7 patients with TCC but not in the other 7 patients , whereas GSTP ( GSTP 1 1 ) could be detected in all samples . ^^^ The levels of GSTM 1 1 and GSTP 1 1 were similar in mucosa of patients and controls . ^^^ In the 7 patients with GSTM 1 1 detectable expression in adjacent normal mucosa , mean GSTM 1 1 levels in TCC were increased 2 . 8 fold compared with mean levels in normal adjacent mucosa ( P < 0 . 02 ) . ^^^ CONCLUSIONS : Overexpression of GSTP 1 1 and GSTM 1 1 may suggest that in the process of TCC carcinogenesis , a selection pressure occurs , resulting in a tumor with enhanced detoxification properties , including that of therapeutic drugs . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The conformational stabilities of two homodimeric class mu glutathione transferases ( GSTM 1 1 and GSTM 2 2 ) were studied by urea and guanidinium chloride induced denaturation . ^^^ Changes in tertiary structure occur as two transitions ; the first is protein concentration dependent , while the second is weakly dependent ( GSTM 1 1 ) or independent ( GSTM 2 2 ) . ^^^ Loss in catalytic activity occurs as two transitions for GSTM 1 1 and as one transition for GSTM 2 2 . ^^^ Although GSTM 1 1 and GSTM 2 2 are homologous ( 78 % identity / 94 % homology ) , their N ( 2 ) tertiary structures are not identical . ^^^ Dissociation of the GSTM 1 1 dimer to structured monomers ( 1 ) occurs at lower denaturant concentrations than for GSTM 2 2 . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Although cytosolic glutathione S transferase ( GST ) enzymes occupy a key position in biological detoxification processes , two of the most relevant human isoenzymes , GSTT 1 1 and GSTM 1 1 , are genetically deleted ( non functional alleles GSTT1 * 0 and GSTM1 * 0 ) in a high percentage of the human population , with major ethnic differences . ^^^ GSTM 1 1 is particularly relevant in the deactivation of carcinogenic intermediates of polycyclic aromatic hydrocarbons . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
They have apparent isoelectric points at pH 8 . 37 ( GST 1 ) , 8 . 22 ( GST 2 ) , 8 . 10 ( GST 3 ) , 7 . 84 ( GST 4 ) , 7 . 37 ( GST 5 ) and 7 . 12 ( GST 6 ) , and each displayed an apparent subunit molecular mass of 23 kDa by SDS / PAGE . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
These studies suggest that GST zeta corresponds to a locus distinct from GST 1 , GST 2 , and GST 3 and probably corresponds to the GST 4 locus as suggested previously by Laisney et al . ( 1984 , Human Genet . 68 , 221 227 ) . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Our data suggest that the GST 1 and GST 4 loci are part of the same multi gene family . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
GST 6 cross reacted with antibody raised against GST 4 , but not with antisera raised against GST 1 , GST 2 or GST 3 . ^^^ The present results indicate that GST 6 is another member of the Mu evolutionary class which in man also includes GST 1 , GST 4 and GST 5 . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
This sequence conservation suggests that gene conversion has occurred between the human GST 1 and GST 4 glutathione transferase gene loci . ^^^ The GTHMUS cDNA shares 93 . 7 % nucleotide sequence identity with a human liver cDNA clone , GTH 411 , that is encoded at the GST 1 locus . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The sensitivity of GST 4 to inhibitors also appeared similar to that of the GST 1 2 isoenzyme . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
An apparently muscle specific isozyme termed GST 4 has been identified and shown to differ structurally from GST 1 , GST 2 and GST 3 . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
GST 1 ( pI 6 . 8 ) and GST 4 ( pI 4 . 9 ) are dimers of 24 kDa subunits whereas GST 2 ( pI 6 . 1 ) and GST 3 ( pI 5 . 5 ) are dimers of 26 . 5 kDa subunits . ^^^ Even though GST 1 has a subunit molecular mass identical to GST 4 , several lines of evidence , including catalytic and immunological properties , indicate that they are different from each other . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The apparent Km values with 1 chloro 2 , 4 dinitrobenzene ( CDNB ) as substrate for the isozymes at the GST 1 , GST 2 , GST 3 , and GST 4 loci were 604 , 1345 , 776 , and 591 microM , respectively . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The safener induced maize ( Zea mays L . ) glutathione S transferase , GST 2 ( EC 2 . 5 . 1 . 18 ) and another predominant isoform , GST 1 , were purified from extracts of maize roots treated with the safeners R 25788 ( N , N diallyl 2 dichloroacetamide ) or R 29148 ( 3 dichloroacetyl 2 , 2 , 5 trimethyl 1 , 3 oxazolidone ) . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
GST 1 is a homodimer of 29 kDa subunits , GST 2 a hetrodimer of 27 kDa and 29 kDa subunits and GST 4 a homodimer of 27 kDa subunits . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
GST 5 is the newest member of an emerging family of carbohydrate 6 O sulfotransferases that includes chondroitin 6 sulfotransferase ( GST 0 ) , keratan sulfate galactose 6 O sulfotransferase ( GST 1 ) , the ubiquitously expressed GlcNAc 6 O sulfotransferase ( GST 2 ) , high endothelial cell GlcNAc 6 O sulfotransferase ( GST 3 ) , and intestinal GlcNAc 6 O sulfotransferase ( GST 4 ) . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Chromosomal assignment and linkage analysis of the human glutathione S transferase mu gene ( GSTM 1 ) using intron specific polymerase chain reaction . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Relationship between hprt mutant frequency , aromatic DNA adducts and genotypes for GSTM 1 and NAT 2 in bus maintenance workers . ^^^ The age dependence was higher in the GSTM 1 negative slow acetylators ( 3 . 1 % / year ) as compared to the three other genotype combinations ( 2 . 4 2 . 5 % / year ) . ^^^ There was no significant difference in mutant frequency or in adduct level between the GSTM 1 negative ( 49 . 3 % of the population ) and positive individuals , or between the slow ( 60 . 9 % of the population ) and rapid acetylators . ^^^ Among the slow acetylators , however , a significantly higher adduct level ( P = 0 . 03 ) was obtained for the GSTM 1 negative individuals as compared to the GSTM 1 positive individuals . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
No connection between the genotype for GST mu ( GSTM 1 ) and the glutatione conjugation with methyl chloride in erythrocytes was found . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The gene encoding glutathione S transferase class mu ( GSTM 1 ) is polymorphic ; approximately 50 % of Caucasian individuals have a homozygous deletion of this gene and do not produce functional enzyme . ^^^ We conducted a cross sectional study to examine the prevalence of the homozygous deletion for the GSTM 1 gene in members of the carpentry trade occupationally exposed to asbestos . ^^^ Individual GSTM 1 status was determined using polymerase chain reaction methods . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Ten out of 14 individuals ( 71 % ) were homozygous null when genotyped for GSTM 1 . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Three human Mu class glutathione S transferase isoenzymes , GSTM 1 , GSTM 2 , and GSTM 3 , have been characterized previously , and we have recently cloned and characterized GSTM 4 , another member of this class . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The GSTM 1 , GSTM 2 , GSTM 3 , GSTM 4 , and GSTM 5 glutathione transferase genes have been mapped to human chromosome 1 by using locus specific PCR primer pairs spanning exon 6 , intron 6 , and exon 7 , as probes on DNA from human / hamster somatic cell hybrids . ^^^ The close physical proximity of the GSTM 1 and GSTM 2 loci , which share 99 % nucleotide sequence identity over 460 nucleotides of 3 ' untranslated mRNA , suggests that the GSTM 1 null allele may result from unequal crossing over . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The deduced amino acid sequence of GSTM 4 is 87 % ( GSTM 1 ) , 83 % ( GSTM 2 ) , and 70 % ( GSTM 3 ) identical to the previously described human Mu class GSTs . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The odds ratio of having the GST mu negative phenotype and testicular cancer was 1 . 08 , ( 0 . 72 1 . 64 ; 95 % confidence interval ( CI ) ) , and the odds ratio of having the GSTM 1 null genotype and testicular cancer was 1 . 10 ; CI 95 % ( 0 . 71 1 . 70 ) . ^^^ This study provides no evidence of an association between phenotypically determined GST mu deficiency or GSTM 1 null genotype and testicular cancer . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
To check whether or not this association exists in the Portuguese population with lung cancer , we used polymerase chain reaction ( PCR ) based genotyping to examine GSTM 1 polymorphism ( nulled and non nulled ) in 84 individuals as a control healthy population and a group of 98 lung cancer patients . ^^^ In this study we were able to find a frequency of the GSTM 1 phenotype among our healthy control subjects consistent with earlier genotyping studies in other Caucasoid populations . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Characterization of a human glutathione S transferase mu cluster containing a duplicated GSTM 1 gene that causes ultrarapid enzyme activity . ^^^ The mu class glutathione S transferase gene GSTM 1 is polymorphic in humans , with approximately half of the Caucasian population being homozygous deleted for this gene . ^^^ GSTM 1 enzyme deficiency has been suggested to predispose people to lung and bladder cancer . ^^^ Some people in a Saudi Arabian population , however , have been described previously with ultrarapid GSTM 1 enzyme activity . ^^^ Genomic DNA from two Saudi Arabian subjects exhibiting ultrarapid enzyme activity and from 13 Swedish subjects having null , one , or two GSTM 1 genes were subjected to restriction fragment length polymorphism analysis using the restriction enzymes EcoRI , EcoRV , and HindIII and combinations thereof . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The left repeated region is 5 kb downstream from the 3 ' end of the GSTM 2 gene and 5 kb upstream from the beginning of the GSTM 1 gene ; the right repeated region is 5 kb downstream from the 3 ' end of the GSTM 1 and 10 kb upstream from the 5 ' end of the GSTM 5 gene . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
In liver , lead injection caused GSH depletion ( 61 % of control 12 h after lead treatment ) and increased MDA production ( 2 . 5 fold increase 6 h after lead exposure ) , while GSTA 1 , GSTA 2 , GSTM 1 and GSTM 2 did not increase . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The use of specific primers for the detection of the phase 2 isoenzymes belonging to the glutathione S transferase mu ( GST mu ) and N acetyl transferase ( NAT ) families showed that GSTM 1 was expressed in 40 % of the bronchial mucosa and 25 % of the peripheral lung tissues , whereas GSTM 3 and NAT 1 mRNAs were found in all bronchial and lung samples . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The medical consequences of this deficiency have been extensively investigated in molecular epidemiological studies , but possible differences of the highly active homozygous genotype versus the moderately active heterozygous genotype could not be considered because many currently used polymerase chain reaction ( PCR ) assays can not distinguish the homozygous genotypes GSTM 1 * A / A and GSTM1 * B / B from the heterozygous genotypes GSTM1 * A / 0 and GSTM1 * B / 0 . ^^^ Based on the published cluster of GSTM genes ( GSTM 1 to M 5 ) , a 13 kb segment spanning the site of the GSTM 1 deletion was amplified using a GSTM 2 specific forward primer ( 5 ' CATCGCTTATGATGTCCTTGAGAGAAACCAAG 3 ' ) and a reverse primer , which is specific for the upstream region of GSTMS ( 5 ' GCGTTTCTGAGGACTGGACTGATGATCG 3 ' ) . ^^^ While conventional PCR assays for detection of the GSTM 1 deletion differentiated homozygously deficient from hetero or homozygously active individuals , this long PCR assay differentiates homozygously active from hetero or homozygously deficient individuals . ^^^ Using both assays , an unambiguous differentiation into carriers of zero , one or two active alleles of GSTM 1 is possible . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
We compared the enzymatic activities and mRNA levels of GSTs in GSTM 1 positive human cervical keratinocytes ( HCKs ) that had been transfected with HPV 16 with those in the parental cells . ^^^ The GSTM 1 activity toward the substrate trans stilbene oxide was 5 to 7 fold lower than in the parental cells . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Secretion of glutathione S transferase isoforms in the seminiferous tubular fluid , tissue distribution and sex steroid binding by rat GSTM 1 . ^^^ The major GST isoforms present in STF in vivo share extensive N terminal similarity with rat GSTM 1 ( rGSTM 1 ) , rGSTM 2 , rGSTM 3 and rGST Alpha . ^^^ Molecular masses of rGSTM 2 , rGSTM 3 and rGST Alpha from liver and testis sources were similar , unlike STF GSTM 1 , which was larger by 325 Da than its liver counterpart . ^^^ Functionally , STF GSTM 1 appeared to serve as a steroid binding protein by its ability to bind to testosterone and oestradiol , two important hormones in the ST that are essential for spermatogenesis , with binding constants of < 9 . 8x10 ( 7 ) M for testosterone and 9x10 ( 6 ) M for oestradiol respectively . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Glutathione S transferase mu ( GSTM 1 ) and theta ( GSTT 1 ) genotypes in the etiology of prostate cancer . ^^^ Common homozygous germ line deletions exist in the genes that encode GST mu ( GSTM 1 ) and GST theta ( GSTT 1 ) and preclude enzyme expression . ^^^ To evaluate whether GSTM 1 and / or GSTT 1 contribute to prostate cancer ( CaP ) etiology , we studied 237 incident CaP cases and 239 age and race matched controls . ^^^ The probability of having CaP was increased in men who had nondeleted ( functional ) genotypes at GSTT 1 ( odds ratio , 1 . 83 ; 95 % confidence interval , 1 . 19 2 . 80 ) but not GSTM 1 ( odds ratio , 1 . 07 ; 95 % confidence interval , 0 . 74 1 . 55 ) . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Polymorphism of GSTM 1 gene in patients with colorectal cancer and colonic polyps . ^^^ The frequency of the GSTM 1 gene in patients with nonpolyposis colorectal cancer ( CRC ) ( n = 70 ) and in subjects with colonic polyps ( n = 27 ) was evaluated and compared with healthy individuals ( n = 145 ) . ^^^ A simple polymerase chain reaction ( PCR ) based assay to identify GSTM 1 nulled and positive ( non nulled ) genotype was used . ^^^ Twenty individuals ( 71 . 4 % ) of the group were GSTM 1 deficient which was significantly different from the control population ( p < 0 . 04 ) . ^^^ The above data indicate that the absence of the GSTM 1 gene is associated with a greater risk of sporadic colorectal cancer . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Genotypes of epoxide hydrolase ( EH ) and glutathione S transferase class mu 1 ( GSTM 1 ) were also characterised . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Two members of the mu class of glutathione S transferase ( GST ) genes , GSTM 1 and GSTM 3 , have polymorphic alleles which have been associated with altered levels of GST mu protein expression and may be linked to increased risk for several tobacco related cancers . ^^^ To examine the potential role of GSTM polymorphisms in risk for oral cancer in African Americans and Caucasians , the prevalences of the GSTM 1 null and GSTM 3 intron 6 polymorphisms were examined in 63 African American and 101 Caucasian patients with histologically confirmed primary oral cancer , as well as in 133 African American and 213 Caucasian matched control subjects . ^^^ In African Americans , the odds ratio for oral cancer associated with the GSTM 1 ( 0 / 0 ) genotype was 3 . 1 [ 95 % confidence interval ( CI ) = 1 . 1 8 . 5 ] , with the association between the GSTM 1 ( 0 / 0 ) genotype and oral cancer risk strongest in heavy smokers [ i . e . > 24 pack years ; odds ratio ( OR ) = 5 . 4 , 95 % CI = 1 . 2 24 ] . ^^^ These results suggest that the GSTM 1 null and GSTM 3 intron 6 polymorphisms play an important role in risk for oral cancer among African Americans and implicates the mu class of GSTs as important tobacco carcinogen detoxifying enzymes in this population . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The GSTT 1 and GST mu 1 ( GSTM 1 ) genotypes were determined by PCR using lymphocyte or bone marrow DNA from 297 AML patients and 152 controls . ^^^ No association was observed between the GSTT 1 gene deletion and AML [ race adjusted odds ratio ( OR ) , 0 . 94 ; 95 % confidence interval ( CI ) , 0 . 55 1 . 60 ] or between the GSTM 1 gene deletion and AML ( race adjusted OR , 1 . 26 ; 95 % CI , 0 . 85 1 . 88 ) . ^^^ Patients with secondary AML had a slightly higher prevalence of the GSTT 1 and GSTM 1 gene deletions compared with de novo AML patients or controls , but this was consistent with chance . ^^^ Exploratory analyses of AML cytogenetics suggested a few associations , i . e . , between the GSTT 1 gene deletion and trisomy 8 , and between the GSTM 1 gene deletion and non 8 trisomies or inv ( 16 ) . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The M 1 member of GST mu class ( GSTM 1 ) is polymorphic and only expressed in 55 60 % of Caucasians because of the homozygous deletion of the gene ( null genotype ) . ^^^ Recent studies have provided evidence that the GSTM 1 null genotype , i . e . lack of the GSTM 1 activity , is associated with an increased susceptibility to lung cancer and colorectal cancer . ^^^ GSTM 1 genotyping was performed by polymerase chain reaction . ^^^ GSTM 1 null genotype was observed in 48 . 6 % of patients with nephropathy versus 55 . 1 % of patients without nephropathy . ^^^ The frequency of GSTM 1 null genotype was not significantly higher in the patient group with nephropathy than in the patient group without nephropathy . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
GSTM 1 gene polymorphism in patients with head and neck tumors ] . ^^^ The lack of GSTM 1 has been linked with an increased susceptibility of smoking related cancers . ^^^ The objective of this study was to investigate the frequency of the GSTM 1 null genotype in squamous cell carcinoma of head and neck , especially the larynx and hypopharynx and to analyse the occurrence with respect to certain anatomical sites of cancer . ^^^ MATERIAL AND METHODS : The GSTM 1 genotypes of 83 patients with head and neck cancers and 60 healthy controls were determined by polymerase chain reaction ( PCR ) using blood leukocyte DNA . ^^^ RESULTS : The absence of the GSTM 1 gene ( null genotype ) was found in 64 % of all head and neck cancer patients and in 48 % of the healthy controls ( p < 0 . 05 ) . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Three GST subunits ( GSTA1 / 2 , GSTM 1 , and GSTM 2 ) were examined by Western blot for changes in protein level affected by EGCG ( 1 mg / kg weight ) . ^^^ The differential effect of EGCG on GST subunit expression was also verified by immunocytochemical examination and showed strong induction of the GSTM 2 ( but not the GSTA1 / 2 and GSTM 1 ) level in liver section . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
In the present study , polymorphism of GSTM 1 were detected by polymerase chain reaction ( PCR ) in 38 patients with acute lymphocytic leukemia and 75 normal subjects . ^^^ The null genotype of GSTM 1 was significantly more common among leukemic patients compared with the normal control group ( 55 . 3 vs . 32 . 0 % ; P < 0 . 025 ) . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
GSTP 1 and GSTM 1 predominated in lymphoid lines whilst T 1 expression was relatively greatest in erythroid lines but was absent in 7 / 12 non null lines . ^^^ This implies a greater cytoprotective role for GSTT 1 and GSTA 1 in erythroid cells and GSTM 1 in lymphoid cells . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
There was little influence of known polymorphisms of GSTM 1 , GSTM 3 and GSTP 1 upon the activities towards the test substrates , whereas the influence of GSTT 1 polymorphism on the activity towads methyl chloride was straightforward . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Glutathione S transferase gene polymorphisms in colorectal cancer patients : interaction between GSTM 1 and GSTM 3 allele variants as a risk modulating factor . ^^^ Odds ratios ( OR ) after stratification by age , gender and smoking were slightly higher in the cancer group as a whole for GSTM 1 null ( * 0 / * 0 ) , GSTT 1 null ( * 0 / * 0 ) and GSTM 3 * A / * B or * B / * B when compared with the control group , but the differences did not reach statistical significance . ^^^ Taking into account strong linkage between the GSTM1 * A and GSTM3 * B alleles , a separate analysis of the GSTM 1 nulled individuals was undertaken . ^^^ The combination of GSTM 1 null genotype with GSTM3 * B allele presence ( * A / * B or * B / * B ) was significantly overrepresented among patients with proximal and distal tumours taken together ( OR = 2 . 12 ; 95 % CI = 1 . 24 3 . 63 ) , and especially in distal cancer patients ( OR = 2 . 75 ; 95 % CI = 1 . 56 4 . 84 ) . ^^^ Male individuals displayed a stronger association between the presence of the GSTM 1 null in combination with GSTM 3 * A / * B or * B / * B and distal tumours with a higher odds ratio ( OR = 3 . 57 ; 95 % CI = 1 . 73 7 . 36 ) . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
GSTA ( GSTA 1 + GSTA 2 ) concentrations were moderate as compared with GSTP 1 , whereas GSTM 1 was present in only low amounts . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Using a randomized cross over design , we tested the hypothesis that , in humans , serum GST alpha concentration ( GST alpha ) and GST activity increase with vegetable consumption and that this effect is GSTM 1 genotype dependent . ^^^ Twenty one men ( 10 GSTM 1 null and 11 GSTM1+ ) and 22 women ( 15 GSTM 1 null and 7 GSTM1+ ) , nonsmokers , 20 40 years of age and not on medications , ate four 6 day controlled diets : basal ( vegetable free ) , and basal supplemented with three botanically defined groups of vegetables ( i . e . , brassica , allium , and apiaceous ) . ^^^ The brassica , but not allium or apiaceous , vegetable diets ( relative to the basal diet ) increased GST alpha by 26 % ( P = 0 . 005 ) and GST ( NBD Cl ) activity by 7 % ( P = 0 . 02 ) in the GSTM 1 null individuals , particularly the women . ^^^ The vegetable diets had no effect on GST ( CDNB ) activity , irrespective of GSTM 1 genotype or sex . ^^^ These results demonstrate that GSTM 1 genotype has a significant effect on GST responses to diet and that brassica vegetables are most effective at inducing GST alpha , whereas both brassica and allium vegetables induce GST mu . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The polymorphisms of the NAT 2 and GSTmu genes ( GSTM 1 ) were defined by use of a polymerase chain reaction on white cell DNA from peripheral blood . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The GSTM 1 gene codes for the enzyme glutathione S transferase mu , the GSTT 1 gene codes for the enzyme glutathione S transferase theta , and the GSTP 1 gene codes for the enzyme glutathione S transferase pi . ^^^ GSTM 1 is polymorphically expressed , and three alleles have been identified ( GSTM 1 0 , GSTM1a , and GSTM1b ) . ^^^ However , results of epidemiologic studies do not confirm associations between GSTM 1 , GSTT 1 , and GSTP 1 and epithelial ovarian cancer . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
We sought to determine if there is a gene environment interaction between GSTM 1 ( GSTM1A and GSTM1B ) , and GSTT 1 genotypes and cigarette smoking in the risk of breast cancer . ^^^ A total of 338 cases and 345 controls were genotyped for GSTM 1 and GSTT 1 . ^^^ RESULTS : None of the GSTM 1 genotypes , either alone or in combination with cigarette smoking , was associated with breast cancer risk . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Loss of glutathione S transferase ( GST ) mu phenotype in colorectal adenocarcinomas from patients with a GSTM 1 positive genotype . ^^^ Glutathione S transferase ( GST ) mu phenotype was assessed in colon tissue from patients with ulcerative colitis and colorectal neoplasms that were positive for GSTM 1 genotype . ^^^ These results indicate that GSTM 1 genotype may not necessarily reflect GST mu phenotype in colorectal tumors . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Subjects were also genotyped for polymorphism in several genes involved in the metabolism of PAH , including GSTM 1 and GSTP 1 . ^^^ Among non HCC controls , there were no significant associations between adduct levels and cigarette smoking , GSTM 1 null genotype and HBsAg positivity . ^^^ These results suggest that PAHs may play a role in human hepatocarcinogenesis in conjunction with HBsAg carrier status , GSTM 1 and GSTP 1 genotypes and exposure to 4 ABP and AFB ( 1 ) . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Loss of the Nrf 2 transcription factor causes a marked reduction in constitutive and inducible expression of the glutathione S transferase Gsta 1 , Gsta 2 , Gstm 1 , Gstm 2 , Gstm 3 and Gstm 4 genes in the livers of male and female mice . ^^^ Among the class Alpha and class Mu transferases , constitutive expression of Gsta 1 , Gsta 2 , Gstm 1 , Gstm 2 , Gstm 3 , Gstm 4 and Gstm 6 subunits was reduced in the livers of Nrf 2 mutant mice to between 3 % and 60 % of that observed in WT mice . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
In addition , no difference in the frequencies of GSTM 1 and GSTT 1 null genotypes were observed between cases and controls . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
OBJECTIVE : To understand the effects of exposure to asbestos and GSTM 1 genotypes on plasma activity of glutathione S transferases ( GSTs ) . ^^^ Venous blood specimen was collected from each of them and plasma was separated for detection of GSTs activity and lymphocytes for DNA extraction and GSTM 1 genotyping . ^^^ Stratification of workers by GSTM 1 genotypes showed that plasma activity of GSTs in asbestos exposed workers with GSTM1+ / + or GSTM 1 / were ( 24 . 0 + / 6 . 1 ) and ( 22 . 5 + / 7 . 3 ) U / L , respectively , lower than those in the controls with the same genotypes ( 38 . 1 + / 13 . 2 ) and ( 26 . 8 + / 6 . 6 ) U / L . ^^^ CONCLUSION : Exposure to asbestos could significantly decrease plasma activity of GSTs , and GSTM 1 genotypes could affect on the activity of GSTs in the control workers , which was not so obvious in asbestos exposed workers . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The aim of the present study was to identify functional antisense oligodeoxynucleotides ( ODNs ) against the rat glutathione S transferase Mu ( GSTM ) isoforms , GSTM 1 and GSTM 2 . ^^^ Four phosphodiester ODNs specific for GSTM 1 , two ODNs specific for GSTM 2 , and four ODNs targeted at both GSTM isoforms were found to be potent , sequence specific , and RNase H dependent inhibitors of protein expression . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Higher glutathione transferase GSTM 1 0 / 0 genotype frequency in young thyroid carcinoma patients . ^^^ RESEARCH DESIGN AND METHODS : In this study the association between the variant GSTM 1 0 / 0 genotype and thyroid carcinoma was investigated . ^^^ Polymorphisms of GSTM 1 0 / 0 ( i . e . the null allele of GSTM 1 ) in samples from 32 cases and 44 controls were detected by polymerase chain reaction ( PCR ) methodology . ^^^ The proportions of GSTM 1 deleted genotype in cases and controls were 59 . 4 % and 54 . 5 % , respectively . ^^^ CONCLUSION : GSTM 1 deleted genotype may be a useful genetic biomarker for thyroid carcinoma susceptibility in young subjects . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Epoxide hydrolase genotype and orolaryngeal cancer risk : interaction with GSTM 1 genotype . ^^^ A significant association between predicted high EH activity genotypes and orolaryngeal cancer risk was observed in Caucasian subjects with the GSTM 1 null ( OR=3 . 5 , 95 % CI=1 . 3 9 . 3 ) but not GSTM [ + ] ( OR=0 . 9 , 95 % CI=0 . 4 2 . 1 ) genotype . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
We measured five GST protein subunits ( GSTA1 / 2 composed of GST A 1 1 , A 1 2 and A 2 2 GSTM 1 , GSTM 2 , GSTP 1 , GSTT 1 ) by western blot , GST activity using 1 chloro 2 , 4 dinitrobenzene as substrate and GSTM 2 mRNA expression with RT PCR . ^^^ Cells isolated from colon tissue were identified to be colonocytes and colon fibroblasts , both of which also expressed substantial levels of GSTM 1 and GSTM 2 . ^^^ In HT 29 , butyrate significantly enhanced GSTA1 / 2 ( 3 . 5 fold ) , GSTM 2 ( not detectable in controls ) , GSTP 1 ( 1 . 5 fold ) and GST activity ( 1 . 4 fold ) , but not GSTM 1 or GSTT 1 . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Interaction between smoking , GSTM 1 deletion and colorectal cancer : results from the GSEC study . ^^^ The gene that codes for this enzyme is GSTM 1 . ^^^ In this study , we evaluated the associations and interaction between GSTM 1 deletion , smoking behaviour and the development of colorectal cancer . ^^^ The prevalence of the GSTM 1 null genotype was within the range reported in other studies : 51 . 8 % of the cases had the GSTM 1 null genotype versus 56 . 6 % of the controls . ^^^ No significant association between the GSTM 1 null genotype and colorectal cancer was found ( odds ratio 0 . 92 , 95 % confidence interval 0 . 73 1 . 14 ) . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Relationship of tobacco smoking with GSTM 1 gene polymorphism in laringeal cancer . ^^^ This paper aimed to analyze the association of polymorphism of GSTM 1 0 / 0 genotype with laryngeal cancer along a hospital based case control study . ^^^ Polymorphisms of GSTM 1 0 / 0 of samples from 36 patients with laryngeal cancer and 35 healthy controls were detected by PCR method . ^^^ The reaction used as GSTM 1 primers , using the sequence sense : 5 ' CTGCCCTACTTGGATTGATGGG 3 ' and antisense : 5 ' TGGATTGTAGCAGATCATGC 3 ' . ^^^ The proportions of GSTM 1 deleted genotype in cases and controls were 47 . 2 % and 54 . 3 % , respectively . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Western blotting data demonstrated that geniposide induced increased protein levels of GSTM 1 and GSTM 2 ( approximately 1 . 7 and 1 . 8 fold of control , respectively ) , but did not increase those of GSTA 1 . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Absence of GSTM 1 or GSTT 1 can be attributed to absence of the GSTM 1 or GSTT 1 gene products ( null genotype ) in approximately 50 % and 20 % of the Caucasian population , respectively . ^^^ We investigated whether polymorphisms in the GSTM 1 , GSTT 1 and GSTP 1 genes modified the risk for chronic pancreatitis ( CP ) . ^^^ However , GSTM 1 null genotypes were significantly less common in alcoholic CP patients ( OR = 0 . 56 , 95 % CI : 0 . 33 0 . 95 ) as compared to healthy controls and to alcoholic controls ( OR = 0 . 52 , 95 % CI : 0 . 26 1 . 04 ) . ^^^ The frequency of the GSTM 1 null genotype is significantly lower in alcoholic CP patients , especially young female . ^^^ This suggests that GSTM 1 null alcohol users , particularly young female , are less susceptible to CP . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The GSTT 1 , GSTM 1 and GSTP 1 gene polymorphism were detected using real time PCR . ^^^ GSTM 1 and GSTT 1 null genotypes were found to be associated with an increased risk of drug eruption ( OR 2 . 27 , 95 % CI 1 . 20 5 . 21 ; OR 2 . 48 , 95 % CI 1 . 12 6 . 39 , respectively ) . ^^^ No relationship was observed between the null combination of the GSTM 1 and GSTT 1 genotype polymorphisms and drug eruption risk ( OR 2 . 65 , 95 % CI 0 . 62 11 . 25 ) . ^^^ The GSTM 1 and GSTT 1 gene polymorphisms seem to be associated with the development of drug eruption . ^^^ Further studies may shed additional light on the role of GSTM 1 , GSTT 1 and GSTP 1 in drug eruption . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The GST mu 1 ( GSTM 1 ) and GST theta 1 ( GSTT 1 ) genes have a null allele variant in which the entire gene is absent . ^^^ The aim of this study was to determine the possible differences in increased oxidative stress susceptibility to smoking within the GSTM 1 and GSTT 1 genotypes and the impact of high tea drinking on this . ^^^ We designed a Phase 2 randomized , controlled , three arm tea intervention trial to study the effect of high consumption ( 4 cups / day ) of decaffeinated green or black tea , or water on oxidative DNA damage , as measured by urinary 8 hydroxydeoxyguanosine ( 8 OHdG ) , among heavy smokers over a 4 month period and to evaluate the roles of GSTM 1 and GSTT 1 genotypes as effect modifiers . ^^^ GSTM 1 and GSTT 1 genotype statuses were determined with a PCR based approach . ^^^ Finally , we studied whether the effect of treatment varied by GSTM 1 and GSTT 1 status of the individual . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
We evaluated the distribution of GST mu ( GSTM 1 ) and theta ( GSTT 1 ) genotypes in 594 individuals , by multiplex PCR based methods , using amplification of the exon 7 of CYP1A1 gene as an internal control . ^^^ The frequency of the GSTM 1 null genotype was significantly higher among whites ( 55 . 4 % ) than among mulattos ( 41 . 4 % ; P = 0 . 03 ) and blacks ( 32 . 8 % ; P < 0 . 0001 ) from So Paulo , or Bahian subjects in general ( 35 . 7 % ; P = 0 . 0003 ) . ^^^ The interviewer classification indicated a gradient of distribution of the GSTM 1 null genotype from whites ( 55 . 6 % ) to light mulattos ( 40 . 4 % ) , dark mulattos ( 32 . 0 % ) and blacks ( 28 . 6 % ) . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
OBJECTIVE : Association of glutathione S transferase M 1 ( GSTM 1 ) polymorphisms and cancer has been demonstrated . ^^^ The aim of this study was to investigate the influence of the GSTM 1 null genotype on the level of GSTM enzyme concentration and on the enzyme activity of GST in patients with head and neck cancer ( HNC ) . ^^^ METHODS : We investigated in 83 patients and 91 healthy controls the GSTM 1 polymorphisms , GSTM 1 protein concentration , GSTM 1 protein in tumor tissues , and total GST enzyme activity . ^^^ RESULTS : Total GST enzyme activity was significantly lower in patients with HNC ( 208 + / 9 micromol / min * l ) than in controls ( 264 + / 11 micromol / min * l , P < 0 . 0001 ) but did not depend on GSTM 1 genotype ( P = 0 . 1 ) . ^^^ GSTM protein concentration in null genotype patients ( 3 . 6 + / 2 . 5 microg / mL , mean + / SE ) was significantly lower than in GSTM 1 allele carriers ( 26 . 7 + / 9 . 6 microg / ml , P < 0 . 0001 ) ; GSTM protein expression did not depend on GSTM 1 genotype ( P > 0 . 5 ) . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Glutathione S transferase genotype GSTM 1 as a predictor of elevated angiogenic phenotype in patients with early onset breast cancer . ^^^ The genes coding for separate isoforms of both the human glutathione S transferase class ( GST ) mu and class theta enzymes ( GSTM 1 and GSTT 1 ) are polymorphic with a percentage of normal individuals exhibiting a homozygous deletion of the genes . ^^^ The mean intratumoral microvessel density ( MVD index ) was higher for the cases with GSTM 1 wild type genotype in comparison with the cases with the GSTM 1 null genotype ( 89 . 6 + / 10 . 0 vs . 60 . 9 + / 6 . 7 ; P = 0 . 022 ) . ^^^ Multivariate logistic regression analysis of GSTM 1 and GSTT 1 genotypes , histologic grade , axillary node status and age at diagnosis demonstrate the independent association between GSTM 1 genotypes and angiogenesis and the association of GSTM 1 wild type genotype with high MVD index ( adjusted OR = 5 . 98 , 95 % CI 1 . 28 28 . 10 , P = 0 . 023 ) . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
This article reports the first absolute quantitative analysis of expression patterns of murine transcripts ( Gsta1 / 2 , Gsta 3 , Gsta 4 , Gstm 1 , Gstm 2 , Gstm 3 , Gsto 1 , Gstp1 / 2 , Gstt 1 , Gstt 2 ) coding for most glutathione S transferases ( GSTs ) of alpha , mu , omega , pi , and theta classes . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
The top 20 differentially expressed genes included 10 genes ( Spp 1 , Cyp1b1 , Btg 1 , Cfh , Mt 1 , Mt 2 , Igfbp 5 , Gstm 1 , Gstm 2 , and Esr 1 ) implicated in various aspects of ovarian carcinomas , and other 3 genes ( Gsto 1 , Lcn 7 , and Alcam ) associated to breast cancer . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
PATIENTS AND METHODS : We examined CYP3A4 * 1B , CYP3A5 * 3 , and deletions in GST mu ( GSTM 1 ) and theta ( GSTT 1 ) , as well as a priori defined combinations of polymorphisms in these genes . ^^^ RESULTS : Patients who carried homozygous CYP3A4 * 1B and CYP3A5 * 3 variants and did not carry homozygous deletions in both GSTM 1 and GSTT 1 ( denoted low drug genotype group ) had a 4 . 9 fold poorer DFS ( P = . 021 ) and a four fold poorer OS ( P = . 031 ) compared with individuals who did not carry any CYP3A4 * 1B or CYP3A5 * 3 variants but had deletions in both GSTT 1 and GSTM 1 ( denoted high drug genotype group ) . ^^^ CONCLUSION : Combined genotypes at CYP3A4 , CYP3A5 , GSTM 1 , and GSTT 1 influence the probability of treatment failure after high dose adjuvant chemotherapy for node positive breast cancer . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
Polymorphisms of the GSTM 1 and GSTT 1 genes in patients with allergic diseases in the Czech population . ^^^ AIMS OF THE STUDY : Relationships among allergic diseases including asthma and variations in the GST mu ( GSTM 1 ) and GST theta ( GSTT 1 ) genes were investigated in 1 , 006 Caucasian subjects . ^^^ However , when compared with patients homozygous or heterozygous for GSTM 1 functional allele , asthmatics carrying both GSTM 1 null alleles displayed significantly worse lung function , assessed by forced expiratory volume in 1 s / forced vital capacity ( FEV ( 1 ) / FVC ) ratio ( Tiffenau index ) , ( P < 0 . 01 ) . ^^^ CONCLUSIONS : Genetic polymorphisms of the GSTM 1 and GSTT 1 genes , both individually and in combination , were not associated with the development of allergic diseases including asthma in the Czech population , the GSTM 1 gene variability , however , may influence lung functions in our asthmatics . . ^^^
Interacting proteins: P09488 and P28161 Pubmed SVM Score :0.0
OBJECTIVES : To examine whether the interaction of polymorphism of GSTM 1 gene and occupational sunlight exposure modulate the risk of cataract . ^^^ The genotypes of GSTM 1 were determined using PCR . ^^^ RESULTS : The null genotype of GSTM 1 was associated with an increase in cataract risk in the indoor workplace , but this association was not significant in the outdoor subjects . ^^^ CONCLUSION : The active genotype of GSTM 1 has lost its protective role in persons who work outdoors . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.55506099
In this retrospective cohort , we have investigated associations between common GSTM 1 , GSTM 3 and GSTP 1 polymorphisms with factors known to influence clinical out come and patient survival in colorectal cancer . 0.55506099^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Human muscle specific glutathione S transferase ( RX : glutathione R transferase , EC 2 . 5 . 1 . 18 ) ( GST 4 ) and liver GST 1 have been purified and subjected to N terminal sequence analysis . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The safener induced maize ( Zea mays L . ) glutathione S transferase , GST 2 ( EC 2 . 5 . 1 . 18 ) and another predominant isoform , GST 1 , were purified from extracts of maize roots treated with the safeners R 25788 ( N , N diallyl 2 dichloroacetamide ) or R 29148 ( 3 dichloroacetyl 2 , 2 , 5 trimethyl 1 , 3 oxazolidone ) . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The primary hepatic transcript was that encoding GSTM 1 1 with much lesser amounts of GSTM 3 3 , but livers were devoid of GSTM 2 2 , and GSTM 5 5 . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The conformational stabilities of two homodimeric class mu glutathione transferases ( GSTM 1 1 and GSTM 2 2 ) were studied by urea and guanidinium chloride induced denaturation . ^^^ Changes in tertiary structure occur as two transitions ; the first is protein concentration dependent , while the second is weakly dependent ( GSTM 1 1 ) or independent ( GSTM 2 2 ) . ^^^ Loss in catalytic activity occurs as two transitions for GSTM 1 1 and as one transition for GSTM 2 2 . ^^^ Although GSTM 1 1 and GSTM 2 2 are homologous ( 78 % identity / 94 % homology ) , their N ( 2 ) tertiary structures are not identical . ^^^ Dissociation of the GSTM 1 1 dimer to structured monomers ( 1 ) occurs at lower denaturant concentrations than for GSTM 2 2 . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
They have apparent isoelectric points at pH 8 . 37 ( GST 1 ) , 8 . 22 ( GST 2 ) , 8 . 10 ( GST 3 ) , 7 . 84 ( GST 4 ) , 7 . 37 ( GST 5 ) and 7 . 12 ( GST 6 ) , and each displayed an apparent subunit molecular mass of 23 kDa by SDS / PAGE . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
These studies suggest that GST zeta corresponds to a locus distinct from GST 1 , GST 2 , and GST 3 and probably corresponds to the GST 4 locus as suggested previously by Laisney et al . ( 1984 , Human Genet . 68 , 221 227 ) . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Our data suggest that the GST 1 and GST 4 loci are part of the same multi gene family . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
GST 6 cross reacted with antibody raised against GST 4 , but not with antisera raised against GST 1 , GST 2 or GST 3 . ^^^ The present results indicate that GST 6 is another member of the Mu evolutionary class which in man also includes GST 1 , GST 4 and GST 5 . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
This sequence conservation suggests that gene conversion has occurred between the human GST 1 and GST 4 glutathione transferase gene loci . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The sensitivity of GST 4 to inhibitors also appeared similar to that of the GST 1 2 isoenzyme . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
An apparently muscle specific isozyme termed GST 4 has been identified and shown to differ structurally from GST 1 , GST 2 and GST 3 . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
GST 1 ( pI 6 . 8 ) and GST 4 ( pI 4 . 9 ) are dimers of 24 kDa subunits whereas GST 2 ( pI 6 . 1 ) and GST 3 ( pI 5 . 5 ) are dimers of 26 . 5 kDa subunits . ^^^ Even though GST 1 has a subunit molecular mass identical to GST 4 , several lines of evidence , including catalytic and immunological properties , indicate that they are different from each other . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The apparent Km values with 1 chloro 2 , 4 dinitrobenzene ( CDNB ) as substrate for the isozymes at the GST 1 , GST 2 , GST 3 , and GST 4 loci were 604 , 1345 , 776 , and 591 microM , respectively . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
GST 4 forms with GST 1 a heterodimeric band . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
GST 1 is a homodimer of 29 kDa subunits , GST 2 a hetrodimer of 27 kDa and 29 kDa subunits and GST 4 a homodimer of 27 kDa subunits . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
GST 5 is the newest member of an emerging family of carbohydrate 6 O sulfotransferases that includes chondroitin 6 sulfotransferase ( GST 0 ) , keratan sulfate galactose 6 O sulfotransferase ( GST 1 ) , the ubiquitously expressed GlcNAc 6 O sulfotransferase ( GST 2 ) , high endothelial cell GlcNAc 6 O sulfotransferase ( GST 3 ) , and intestinal GlcNAc 6 O sulfotransferase ( GST 4 ) . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Chromosomal assignment and linkage analysis of the human glutathione S transferase mu gene ( GSTM 1 ) using intron specific polymerase chain reaction . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Relationship between hprt mutant frequency , aromatic DNA adducts and genotypes for GSTM 1 and NAT 2 in bus maintenance workers . ^^^ The age dependence was higher in the GSTM 1 negative slow acetylators ( 3 . 1 % / year ) as compared to the three other genotype combinations ( 2 . 4 2 . 5 % / year ) . ^^^ There was no significant difference in mutant frequency or in adduct level between the GSTM 1 negative ( 49 . 3 % of the population ) and positive individuals , or between the slow ( 60 . 9 % of the population ) and rapid acetylators . ^^^ Among the slow acetylators , however , a significantly higher adduct level ( P = 0 . 03 ) was obtained for the GSTM 1 negative individuals as compared to the GSTM 1 positive individuals . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
No connection between the genotype for GST mu ( GSTM 1 ) and the glutatione conjugation with methyl chloride in erythrocytes was found . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The gene encoding glutathione S transferase class mu ( GSTM 1 ) is polymorphic ; approximately 50 % of Caucasian individuals have a homozygous deletion of this gene and do not produce functional enzyme . ^^^ We conducted a cross sectional study to examine the prevalence of the homozygous deletion for the GSTM 1 gene in members of the carpentry trade occupationally exposed to asbestos . ^^^ Individual GSTM 1 status was determined using polymerase chain reaction methods . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Ten out of 14 individuals ( 71 % ) were homozygous null when genotyped for GSTM 1 . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
A polymorphism in exon 7 of the cytochrome P 450 1A1 ( CYP1A1 ) and A homozygous gene deletion at the glutathione S transferase M 1 ( GSTM 1 ) locus of genomic DNA isolated from peripheral blood were investigated for its relationship with lung , oral and urothelial cancer using the polymerase chain reaction ( PCR ) technique . ^^^ The frequency of GSTM 1 deletion genotype was 39 . 8 % in the healthy controls and 45 . 5 % , 50 . 0 % and 61 . 2 % in lung cancer , oral cancer and urothelial cancer patients , respectively . ^^^ The odds ratio of combined genotypes of CYP1A1 Val / Val and GSTM 1 deletion was 1 . 42 ( 95 % confidence interval 0 . 12 16 . 8 ) , 3 . 64 ( 95 % confidence interval 0 . 47 27 . 9 ) , 1 . 02 ( 95 % confidence interval 0 . 14 7 . 53 ) in lung cancer , oral cancer and urothelial cancer patients , respectively . ^^^ Thus , the GSTM 1 deletion genotype as a host factor predisposing to urothelial cancer was proved in this study . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The odds ratio of having the GST mu negative phenotype and testicular cancer was 1 . 08 , ( 0 . 72 1 . 64 ; 95 % confidence interval ( CI ) ) , and the odds ratio of having the GSTM 1 null genotype and testicular cancer was 1 . 10 ; CI 95 % ( 0 . 71 1 . 70 ) . ^^^ This study provides no evidence of an association between phenotypically determined GST mu deficiency or GSTM 1 null genotype and testicular cancer . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
To check whether or not this association exists in the Portuguese population with lung cancer , we used polymerase chain reaction ( PCR ) based genotyping to examine GSTM 1 polymorphism ( nulled and non nulled ) in 84 individuals as a control healthy population and a group of 98 lung cancer patients . ^^^ In this study we were able to find a frequency of the GSTM 1 phenotype among our healthy control subjects consistent with earlier genotyping studies in other Caucasoid populations . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Glutathione S transferase mu 1 ( GSTM 1 ) : susceptibility gene of breast cancer ] . ^^^ Glutathione S transferase mu 1 ( GSTM 1 ) : susceptibility gene of breast cancer ] . ^^^ The gene GSTM 1 is localized on chromosome 1p13 , it has drawn attention because it is absent approximately in 50 % of the white population . ^^^ GSTM 1 null genotype seems linked with susceptibility to cancers as lung , colon and bladder cancers . ^^^ We have studied GSTM 1 genotype from 373 primary breast tumours . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Characterization of a human glutathione S transferase mu cluster containing a duplicated GSTM 1 gene that causes ultrarapid enzyme activity . ^^^ The mu class glutathione S transferase gene GSTM 1 is polymorphic in humans , with approximately half of the Caucasian population being homozygous deleted for this gene . ^^^ GSTM 1 enzyme deficiency has been suggested to predispose people to lung and bladder cancer . ^^^ Some people in a Saudi Arabian population , however , have been described previously with ultrarapid GSTM 1 enzyme activity . ^^^ Genomic DNA from two Saudi Arabian subjects exhibiting ultrarapid enzyme activity and from 13 Swedish subjects having null , one , or two GSTM 1 genes were subjected to restriction fragment length polymorphism analysis using the restriction enzymes EcoRI , EcoRV , and HindIII and combinations thereof . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The use of specific primers for the detection of the phase 2 isoenzymes belonging to the glutathione S transferase mu ( GST mu ) and N acetyl transferase ( NAT ) families showed that GSTM 1 was expressed in 40 % of the bronchial mucosa and 25 % of the peripheral lung tissues , whereas GSTM 3 and NAT 1 mRNAs were found in all bronchial and lung samples . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
GSTM ( GSTM 1 1 ) was found in 9 controls and in 7 patients with TCC but not in the other 7 patients , whereas GSTP ( GSTP 1 1 ) could be detected in all samples . ^^^ The levels of GSTM 1 1 and GSTP 1 1 were similar in mucosa of patients and controls . ^^^ In the 7 patients with GSTM 1 1 detectable expression in adjacent normal mucosa , mean GSTM 1 1 levels in TCC were increased 2 . 8 fold compared with mean levels in normal adjacent mucosa ( P < 0 . 02 ) . ^^^ CONCLUSIONS : Overexpression of GSTP 1 1 and GSTM 1 1 may suggest that in the process of TCC carcinogenesis , a selection pressure occurs , resulting in a tumor with enhanced detoxification properties , including that of therapeutic drugs . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Glutathione S transferase mu ( GSTM 1 ) and theta ( GSTT 1 ) genotypes in the etiology of prostate cancer . ^^^ Common homozygous germ line deletions exist in the genes that encode GST mu ( GSTM 1 ) and GST theta ( GSTT 1 ) and preclude enzyme expression . ^^^ To evaluate whether GSTM 1 and / or GSTT 1 contribute to prostate cancer ( CaP ) etiology , we studied 237 incident CaP cases and 239 age and race matched controls . ^^^ The probability of having CaP was increased in men who had nondeleted ( functional ) genotypes at GSTT 1 ( odds ratio , 1 . 83 ; 95 % confidence interval , 1 . 19 2 . 80 ) but not GSTM 1 ( odds ratio , 1 . 07 ; 95 % confidence interval , 0 . 74 1 . 55 ) . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The medical consequences of this deficiency have been extensively investigated in molecular epidemiological studies , but possible differences of the highly active homozygous genotype versus the moderately active heterozygous genotype could not be considered because many currently used polymerase chain reaction ( PCR ) assays can not distinguish the homozygous genotypes GSTM 1 * A / A and GSTM1 * B / B from the heterozygous genotypes GSTM1 * A / 0 and GSTM1 * B / 0 . ^^^ Based on the published cluster of GSTM genes ( GSTM 1 to M 5 ) , a 13 kb segment spanning the site of the GSTM 1 deletion was amplified using a GSTM 2 specific forward primer ( 5 ' CATCGCTTATGATGTCCTTGAGAGAAACCAAG 3 ' ) and a reverse primer , which is specific for the upstream region of GSTMS ( 5 ' GCGTTTCTGAGGACTGGACTGATGATCG 3 ' ) . ^^^ While conventional PCR assays for detection of the GSTM 1 deletion differentiated homozygously deficient from hetero or homozygously active individuals , this long PCR assay differentiates homozygously active from hetero or homozygously deficient individuals . ^^^ Using both assays , an unambiguous differentiation into carriers of zero , one or two active alleles of GSTM 1 is possible . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
We compared the enzymatic activities and mRNA levels of GSTs in GSTM 1 positive human cervical keratinocytes ( HCKs ) that had been transfected with HPV 16 with those in the parental cells . ^^^ The GSTM 1 activity toward the substrate trans stilbene oxide was 5 to 7 fold lower than in the parental cells . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Secretion of glutathione S transferase isoforms in the seminiferous tubular fluid , tissue distribution and sex steroid binding by rat GSTM 1 . ^^^ The major GST isoforms present in STF in vivo share extensive N terminal similarity with rat GSTM 1 ( rGSTM 1 ) , rGSTM 2 , rGSTM 3 and rGST Alpha . ^^^ Molecular masses of rGSTM 2 , rGSTM 3 and rGST Alpha from liver and testis sources were similar , unlike STF GSTM 1 , which was larger by 325 Da than its liver counterpart . ^^^ Functionally , STF GSTM 1 appeared to serve as a steroid binding protein by its ability to bind to testosterone and oestradiol , two important hormones in the ST that are essential for spermatogenesis , with binding constants of < 9 . 8x10 ( 7 ) M for testosterone and 9x10 ( 6 ) M for oestradiol respectively . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The genes glutathione S transferase M 1 ( GSTM 1 ) ( chromosome 1p13 . 3 ) and glutathione S transferase T 1 ( GSTT 1 ) ( 22q11 . 2 ) code for cytosolic enzymes glutathione S transferase ( GST ) mu and GST theta , respectively , which are involved in phase 2 metabolism . ^^^ No consistent associations between GSTM 1 or GSTT 1 genotype and colorectal cancer have been observed . ^^^ No interactions between GSTM 1 or GSTT 1 genotype and smoking and colorectal cancer risk have been reported . ^^^ One polyp study suggests an interaction between GSTM 1 genotype and smoking . ^^^ One study suggests a strong inverse relation between colorectal adenomas and broccoli consumption , particularly in subjects who are GSTM 1 null . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Two members of the mu class of glutathione S transferase ( GST ) genes , GSTM 1 and GSTM 3 , have polymorphic alleles which have been associated with altered levels of GST mu protein expression and may be linked to increased risk for several tobacco related cancers . ^^^ To examine the potential role of GSTM polymorphisms in risk for oral cancer in African Americans and Caucasians , the prevalences of the GSTM 1 null and GSTM 3 intron 6 polymorphisms were examined in 63 African American and 101 Caucasian patients with histologically confirmed primary oral cancer , as well as in 133 African American and 213 Caucasian matched control subjects . ^^^ In African Americans , the odds ratio for oral cancer associated with the GSTM 1 ( 0 / 0 ) genotype was 3 . 1 [ 95 % confidence interval ( CI ) = 1 . 1 8 . 5 ] , with the association between the GSTM 1 ( 0 / 0 ) genotype and oral cancer risk strongest in heavy smokers [ i . e . > 24 pack years ; odds ratio ( OR ) = 5 . 4 , 95 % CI = 1 . 2 24 ] . ^^^ These results suggest that the GSTM 1 null and GSTM 3 intron 6 polymorphisms play an important role in risk for oral cancer among African Americans and implicates the mu class of GSTs as important tobacco carcinogen detoxifying enzymes in this population . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Polymorphism of GSTM 1 gene in patients with colorectal cancer and colonic polyps . ^^^ The frequency of the GSTM 1 gene in patients with nonpolyposis colorectal cancer ( CRC ) ( n = 70 ) and in subjects with colonic polyps ( n = 27 ) was evaluated and compared with healthy individuals ( n = 145 ) . ^^^ A simple polymerase chain reaction ( PCR ) based assay to identify GSTM 1 nulled and positive ( non nulled ) genotype was used . ^^^ Twenty individuals ( 71 . 4 % ) of the group were GSTM 1 deficient which was significantly different from the control population ( p < 0 . 04 ) . ^^^ The above data indicate that the absence of the GSTM 1 gene is associated with a greater risk of sporadic colorectal cancer . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Genotypes of epoxide hydrolase ( EH ) and glutathione S transferase class mu 1 ( GSTM 1 ) were also characterised . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The GSTT 1 and GST mu 1 ( GSTM 1 ) genotypes were determined by PCR using lymphocyte or bone marrow DNA from 297 AML patients and 152 controls . ^^^ No association was observed between the GSTT 1 gene deletion and AML [ race adjusted odds ratio ( OR ) , 0 . 94 ; 95 % confidence interval ( CI ) , 0 . 55 1 . 60 ] or between the GSTM 1 gene deletion and AML ( race adjusted OR , 1 . 26 ; 95 % CI , 0 . 85 1 . 88 ) . ^^^ Patients with secondary AML had a slightly higher prevalence of the GSTT 1 and GSTM 1 gene deletions compared with de novo AML patients or controls , but this was consistent with chance . ^^^ Exploratory analyses of AML cytogenetics suggested a few associations , i . e . , between the GSTT 1 gene deletion and trisomy 8 , and between the GSTM 1 gene deletion and non 8 trisomies or inv ( 16 ) . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
GSTP 1 and GSTM 1 predominated in lymphoid lines whilst T 1 expression was relatively greatest in erythroid lines but was absent in 7 / 12 non null lines . ^^^ This implies a greater cytoprotective role for GSTT 1 and GSTA 1 in erythroid cells and GSTM 1 in lymphoid cells . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Blood was analyzed with aldehyde dehydrogenase 2 ( ALDH 2 ) and glutathione S transferase M 1 ( GSTM 1 ) genotyping . ^^^ ALDH 2 genotyping was performed by polymerase chain reaction ( PCR ) Restriction fragment length polymorphism ( RFLP ) method and GSTM 1 genotyping was amplified with PCR using GSTM 1 specific primers . ^^^ The incidence of inactive ALDH 2 and GSTM 1 in the cancer group with an alcohol drinking habit was 34 . 2 and 67 . 5 % and was higher than in the non cancer group with an alcohol drinking habit ( 15 . 1 , 45 . 5 % ) . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The M 1 member of GST mu class ( GSTM 1 ) is polymorphic and only expressed in 55 60 % of Caucasians because of the homozygous deletion of the gene ( null genotype ) . ^^^ Recent studies have provided evidence that the GSTM 1 null genotype , i . e . lack of the GSTM 1 activity , is associated with an increased susceptibility to lung cancer and colorectal cancer . ^^^ GSTM 1 genotyping was performed by polymerase chain reaction . ^^^ GSTM 1 null genotype was observed in 48 . 6 % of patients with nephropathy versus 55 . 1 % of patients without nephropathy . ^^^ The frequency of GSTM 1 null genotype was not significantly higher in the patient group with nephropathy than in the patient group without nephropathy . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
GSTM 1 gene polymorphism in patients with head and neck tumors ] . ^^^ The lack of GSTM 1 has been linked with an increased susceptibility of smoking related cancers . ^^^ The objective of this study was to investigate the frequency of the GSTM 1 null genotype in squamous cell carcinoma of head and neck , especially the larynx and hypopharynx and to analyse the occurrence with respect to certain anatomical sites of cancer . ^^^ MATERIAL AND METHODS : The GSTM 1 genotypes of 83 patients with head and neck cancers and 60 healthy controls were determined by polymerase chain reaction ( PCR ) using blood leukocyte DNA . ^^^ RESULTS : The absence of the GSTM 1 gene ( null genotype ) was found in 64 % of all head and neck cancer patients and in 48 % of the healthy controls ( p < 0 . 05 ) . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
In the present study , polymorphism of GSTM 1 were detected by polymerase chain reaction ( PCR ) in 38 patients with acute lymphocytic leukemia and 75 normal subjects . ^^^ The null genotype of GSTM 1 was significantly more common among leukemic patients compared with the normal control group ( 55 . 3 vs . 32 . 0 % ; P < 0 . 025 ) . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Using a randomized cross over design , we tested the hypothesis that , in humans , serum GST alpha concentration ( GST alpha ) and GST activity increase with vegetable consumption and that this effect is GSTM 1 genotype dependent . ^^^ Twenty one men ( 10 GSTM 1 null and 11 GSTM1+ ) and 22 women ( 15 GSTM 1 null and 7 GSTM1+ ) , nonsmokers , 20 40 years of age and not on medications , ate four 6 day controlled diets : basal ( vegetable free ) , and basal supplemented with three botanically defined groups of vegetables ( i . e . , brassica , allium , and apiaceous ) . ^^^ The brassica , but not allium or apiaceous , vegetable diets ( relative to the basal diet ) increased GST alpha by 26 % ( P = 0 . 005 ) and GST ( NBD Cl ) activity by 7 % ( P = 0 . 02 ) in the GSTM 1 null individuals , particularly the women . ^^^ The vegetable diets had no effect on GST ( CDNB ) activity , irrespective of GSTM 1 genotype or sex . ^^^ These results demonstrate that GSTM 1 genotype has a significant effect on GST responses to diet and that brassica vegetables are most effective at inducing GST alpha , whereas both brassica and allium vegetables induce GST mu . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The polymorphisms of the NAT 2 and GSTmu genes ( GSTM 1 ) were defined by use of a polymerase chain reaction on white cell DNA from peripheral blood . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
There was little influence of known polymorphisms of GSTM 1 , GSTM 3 and GSTP 1 upon the activities towards the test substrates , whereas the influence of GSTT 1 polymorphism on the activity towads methyl chloride was straightforward . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Increased risk for acute myeloid leukaemia in individuals with glutathione S transferase mu 1 ( GSTM 1 ) and theta 1 ( GSTT 1 ) gene defects . ^^^ Both the GST mu 1 ( GSTM 1 ) and GST theta 1 ( GSTT 1 ) genes have a null variant allele in which the entire gene is absent . ^^^ In this study , we tested whether null genotypes for the GSTM 1 and GSTT 1 genes altered the risks for MDS , AML and AA . ^^^ RESULTS : The frequencies of GSTM 1 ( 73 . 6 % ) and GSTT 1 ( 34 . 2 % ) null genotypes were significantly higher in AML patients than in the controls ( 36 . 9 and 18 . 1 % , respectively ) . ^^^ CONCLUSION : Our observation of a 4 . 7 fold ( 95 % CI : 2 . 1 11 . 0 ) and 2 . 3 fold ( 95 % CI : 1 . 0 5 . 2 ) increased risk associated with the GSTM 1 and GSTT 1 null genotypes , respectively , and a 6 . 6 fold ( 95 % CI : 2 . 4 7 . 9 ) increased risk associated with the combined null genotype presents preliminary evidence that the inherited absence of this carcinogen detoxification pathway may be an important determinant of AML . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
GSTA ( GSTA 1 + GSTA 2 ) concentrations were moderate as compared with GSTP 1 , whereas GSTM 1 was present in only low amounts . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Loss of glutathione S transferase ( GST ) mu phenotype in colorectal adenocarcinomas from patients with a GSTM 1 positive genotype . ^^^ Glutathione S transferase ( GST ) mu phenotype was assessed in colon tissue from patients with ulcerative colitis and colorectal neoplasms that were positive for GSTM 1 genotype . ^^^ These results indicate that GSTM 1 genotype may not necessarily reflect GST mu phenotype in colorectal tumors . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Glutathione S transferase gene polymorphisms in colorectal cancer patients : interaction between GSTM 1 and GSTM 3 allele variants as a risk modulating factor . ^^^ Odds ratios ( OR ) after stratification by age , gender and smoking were slightly higher in the cancer group as a whole for GSTM 1 null ( * 0 / * 0 ) , GSTT 1 null ( * 0 / * 0 ) and GSTM 3 * A / * B or * B / * B when compared with the control group , but the differences did not reach statistical significance . ^^^ Taking into account strong linkage between the GSTM1 * A and GSTM3 * B alleles , a separate analysis of the GSTM 1 nulled individuals was undertaken . ^^^ The combination of GSTM 1 null genotype with GSTM3 * B allele presence ( * A / * B or * B / * B ) was significantly overrepresented among patients with proximal and distal tumours taken together ( OR = 2 . 12 ; 95 % CI = 1 . 24 3 . 63 ) , and especially in distal cancer patients ( OR = 2 . 75 ; 95 % CI = 1 . 56 4 . 84 ) . ^^^ Male individuals displayed a stronger association between the presence of the GSTM 1 null in combination with GSTM 3 * A / * B or * B / * B and distal tumours with a higher odds ratio ( OR = 3 . 57 ; 95 % CI = 1 . 73 7 . 36 ) . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Subjects were also genotyped for polymorphism in several genes involved in the metabolism of PAH , including GSTM 1 and GSTP 1 . ^^^ Among non HCC controls , there were no significant associations between adduct levels and cigarette smoking , GSTM 1 null genotype and HBsAg positivity . ^^^ These results suggest that PAHs may play a role in human hepatocarcinogenesis in conjunction with HBsAg carrier status , GSTM 1 and GSTP 1 genotypes and exposure to 4 ABP and AFB ( 1 ) . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
With the assay , we tested the effectiveness of a set of 15 phosphorothioate ODNs against rat glutathione S transferase Mu 1 ( GSTM 1 ) and / or Mu 2 ( GSTM 2 ) . ^^^ At 0 . 5 microm , AS 6 and AS 8 inhibited EGFP GSTM 1 expression by 95 + / 4 % and 81 + / 6 % , respectively . ^^^ AS 2 and AS 3 , targeted at homologous regions in GSTM 1 and GSTM 2 , inhibited both isoforms ( 77 95 % decrease ) . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
OBJECTIVE : The objective was to determine the prevalence of the polymorphisms of the microsomal epoxide hydrolase ( Ephx 1 ) , glutathione S transferase mu 1 ( GSTM ) , theta 1 ( GSTT 1 ) , and pi 1 ( GSTP 1 ) genes in patients with oropharyngeal carcinoma . ^^^ There was an overrepresentation of homozygosity for the GSTT 1 ( glutathione S transferase theta 1 ) null allele [ but not for the GSTM 1 ( glutathione S transferase mu 1 ) null allele ] in ever smokers , when compared with controls . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
In addition , no difference in the frequencies of GSTM 1 and GSTT 1 null genotypes were observed between cases and controls . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The GSTM 1 gene codes for the enzyme glutathione S transferase mu , the GSTT 1 gene codes for the enzyme glutathione S transferase theta , and the GSTP 1 gene codes for the enzyme glutathione S transferase pi . ^^^ GSTM 1 is polymorphically expressed , and three alleles have been identified ( GSTM 1 0 , GSTM1a , and GSTM1b ) . ^^^ However , results of epidemiologic studies do not confirm associations between GSTM 1 , GSTT 1 , and GSTP 1 and epithelial ovarian cancer . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
We sought to determine if there is a gene environment interaction between GSTM 1 ( GSTM1A and GSTM1B ) , and GSTT 1 genotypes and cigarette smoking in the risk of breast cancer . ^^^ A total of 338 cases and 345 controls were genotyped for GSTM 1 and GSTT 1 . ^^^ RESULTS : None of the GSTM 1 genotypes , either alone or in combination with cigarette smoking , was associated with breast cancer risk . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The GST mu 1 ( GSTM 1 ) and GST theta 1 ( GSTT 1 ) genes have a null allele variant in which the entire gene is absent . ^^^ We found a 2 . 6 increased risk of thyroid cancer in individuals with the GSTT 1 and GSTM 1 combined null inheritance , suggesting that this genotype may be associated with an increased susceptibility to thyroid cancer . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The aim of the present study was to identify functional antisense oligodeoxynucleotides ( ODNs ) against the rat glutathione S transferase Mu ( GSTM ) isoforms , GSTM 1 and GSTM 2 . ^^^ Four phosphodiester ODNs specific for GSTM 1 , two ODNs specific for GSTM 2 , and four ODNs targeted at both GSTM isoforms were found to be potent , sequence specific , and RNase H dependent inhibitors of protein expression . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Higher glutathione transferase GSTM 1 0 / 0 genotype frequency in young thyroid carcinoma patients . ^^^ RESEARCH DESIGN AND METHODS : In this study the association between the variant GSTM 1 0 / 0 genotype and thyroid carcinoma was investigated . ^^^ Polymorphisms of GSTM 1 0 / 0 ( i . e . the null allele of GSTM 1 ) in samples from 32 cases and 44 controls were detected by polymerase chain reaction ( PCR ) methodology . ^^^ The proportions of GSTM 1 deleted genotype in cases and controls were 59 . 4 % and 54 . 5 % , respectively . ^^^ CONCLUSION : GSTM 1 deleted genotype may be a useful genetic biomarker for thyroid carcinoma susceptibility in young subjects . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Epoxide hydrolase genotype and orolaryngeal cancer risk : interaction with GSTM 1 genotype . ^^^ A significant association between predicted high EH activity genotypes and orolaryngeal cancer risk was observed in Caucasian subjects with the GSTM 1 null ( OR=3 . 5 , 95 % CI=1 . 3 9 . 3 ) but not GSTM [ + ] ( OR=0 . 9 , 95 % CI=0 . 4 2 . 1 ) genotype . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
OBJECTIVE : To understand the effects of exposure to asbestos and GSTM 1 genotypes on plasma activity of glutathione S transferases ( GSTs ) . ^^^ Venous blood specimen was collected from each of them and plasma was separated for detection of GSTs activity and lymphocytes for DNA extraction and GSTM 1 genotyping . ^^^ Stratification of workers by GSTM 1 genotypes showed that plasma activity of GSTs in asbestos exposed workers with GSTM1+ / + or GSTM 1 / were ( 24 . 0 + / 6 . 1 ) and ( 22 . 5 + / 7 . 3 ) U / L , respectively , lower than those in the controls with the same genotypes ( 38 . 1 + / 13 . 2 ) and ( 26 . 8 + / 6 . 6 ) U / L . ^^^ CONCLUSION : Exposure to asbestos could significantly decrease plasma activity of GSTs , and GSTM 1 genotypes could affect on the activity of GSTs in the control workers , which was not so obvious in asbestos exposed workers . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Absence of GSTM 1 or GSTT 1 can be attributed to absence of the GSTM 1 or GSTT 1 gene products ( null genotype ) in approximately 50 % and 20 % of the Caucasian population , respectively . ^^^ We investigated whether polymorphisms in the GSTM 1 , GSTT 1 and GSTP 1 genes modified the risk for chronic pancreatitis ( CP ) . ^^^ However , GSTM 1 null genotypes were significantly less common in alcoholic CP patients ( OR = 0 . 56 , 95 % CI : 0 . 33 0 . 95 ) as compared to healthy controls and to alcoholic controls ( OR = 0 . 52 , 95 % CI : 0 . 26 1 . 04 ) . ^^^ The frequency of the GSTM 1 null genotype is significantly lower in alcoholic CP patients , especially young female . ^^^ This suggests that GSTM 1 null alcohol users , particularly young female , are less susceptible to CP . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Interaction between smoking , GSTM 1 deletion and colorectal cancer : results from the GSEC study . ^^^ The gene that codes for this enzyme is GSTM 1 . ^^^ In this study , we evaluated the associations and interaction between GSTM 1 deletion , smoking behaviour and the development of colorectal cancer . ^^^ The prevalence of the GSTM 1 null genotype was within the range reported in other studies : 51 . 8 % of the cases had the GSTM 1 null genotype versus 56 . 6 % of the controls . ^^^ No significant association between the GSTM 1 null genotype and colorectal cancer was found ( odds ratio 0 . 92 , 95 % confidence interval 0 . 73 1 . 14 ) . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Relationship of tobacco smoking with GSTM 1 gene polymorphism in laringeal cancer . ^^^ This paper aimed to analyze the association of polymorphism of GSTM 1 0 / 0 genotype with laryngeal cancer along a hospital based case control study . ^^^ Polymorphisms of GSTM 1 0 / 0 of samples from 36 patients with laryngeal cancer and 35 healthy controls were detected by PCR method . ^^^ The reaction used as GSTM 1 primers , using the sequence sense : 5 ' CTGCCCTACTTGGATTGATGGG 3 ' and antisense : 5 ' TGGATTGTAGCAGATCATGC 3 ' . ^^^ The proportions of GSTM 1 deleted genotype in cases and controls were 47 . 2 % and 54 . 3 % , respectively . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The GSTT 1 , GSTM 1 and GSTP 1 gene polymorphism were detected using real time PCR . ^^^ GSTM 1 and GSTT 1 null genotypes were found to be associated with an increased risk of drug eruption ( OR 2 . 27 , 95 % CI 1 . 20 5 . 21 ; OR 2 . 48 , 95 % CI 1 . 12 6 . 39 , respectively ) . ^^^ No relationship was observed between the null combination of the GSTM 1 and GSTT 1 genotype polymorphisms and drug eruption risk ( OR 2 . 65 , 95 % CI 0 . 62 11 . 25 ) . ^^^ The GSTM 1 and GSTT 1 gene polymorphisms seem to be associated with the development of drug eruption . ^^^ Further studies may shed additional light on the role of GSTM 1 , GSTT 1 and GSTP 1 in drug eruption . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The GST mu 1 ( GSTM 1 ) and GST theta 1 ( GSTT 1 ) genes have a null allele variant in which the entire gene is absent . ^^^ The aim of this study was to determine the possible differences in increased oxidative stress susceptibility to smoking within the GSTM 1 and GSTT 1 genotypes and the impact of high tea drinking on this . ^^^ We designed a Phase 2 randomized , controlled , three arm tea intervention trial to study the effect of high consumption ( 4 cups / day ) of decaffeinated green or black tea , or water on oxidative DNA damage , as measured by urinary 8 hydroxydeoxyguanosine ( 8 OHdG ) , among heavy smokers over a 4 month period and to evaluate the roles of GSTM 1 and GSTT 1 genotypes as effect modifiers . ^^^ GSTM 1 and GSTT 1 genotype statuses were determined with a PCR based approach . ^^^ Finally , we studied whether the effect of treatment varied by GSTM 1 and GSTT 1 status of the individual . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
We evaluated the distribution of GST mu ( GSTM 1 ) and theta ( GSTT 1 ) genotypes in 594 individuals , by multiplex PCR based methods , using amplification of the exon 7 of CYP1A1 gene as an internal control . ^^^ The frequency of the GSTM 1 null genotype was significantly higher among whites ( 55 . 4 % ) than among mulattos ( 41 . 4 % ; P = 0 . 03 ) and blacks ( 32 . 8 % ; P < 0 . 0001 ) from So Paulo , or Bahian subjects in general ( 35 . 7 % ; P = 0 . 0003 ) . ^^^ The interviewer classification indicated a gradient of distribution of the GSTM 1 null genotype from whites ( 55 . 6 % ) to light mulattos ( 40 . 4 % ) , dark mulattos ( 32 . 0 % ) and blacks ( 28 . 6 % ) . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
OBJECTIVE : Association of glutathione S transferase M 1 ( GSTM 1 ) polymorphisms and cancer has been demonstrated . ^^^ The aim of this study was to investigate the influence of the GSTM 1 null genotype on the level of GSTM enzyme concentration and on the enzyme activity of GST in patients with head and neck cancer ( HNC ) . ^^^ METHODS : We investigated in 83 patients and 91 healthy controls the GSTM 1 polymorphisms , GSTM 1 protein concentration , GSTM 1 protein in tumor tissues , and total GST enzyme activity . ^^^ RESULTS : Total GST enzyme activity was significantly lower in patients with HNC ( 208 + / 9 micromol / min * l ) than in controls ( 264 + / 11 micromol / min * l , P < 0 . 0001 ) but did not depend on GSTM 1 genotype ( P = 0 . 1 ) . ^^^ GSTM protein concentration in null genotype patients ( 3 . 6 + / 2 . 5 microg / mL , mean + / SE ) was significantly lower than in GSTM 1 allele carriers ( 26 . 7 + / 9 . 6 microg / ml , P < 0 . 0001 ) ; GSTM protein expression did not depend on GSTM 1 genotype ( P > 0 . 5 ) . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Glutathione S transferase genotype GSTM 1 as a predictor of elevated angiogenic phenotype in patients with early onset breast cancer . ^^^ The genes coding for separate isoforms of both the human glutathione S transferase class ( GST ) mu and class theta enzymes ( GSTM 1 and GSTT 1 ) are polymorphic with a percentage of normal individuals exhibiting a homozygous deletion of the genes . ^^^ The mean intratumoral microvessel density ( MVD index ) was higher for the cases with GSTM 1 wild type genotype in comparison with the cases with the GSTM 1 null genotype ( 89 . 6 + / 10 . 0 vs . 60 . 9 + / 6 . 7 ; P = 0 . 022 ) . ^^^ Multivariate logistic regression analysis of GSTM 1 and GSTT 1 genotypes , histologic grade , axillary node status and age at diagnosis demonstrate the independent association between GSTM 1 genotypes and angiogenesis and the association of GSTM 1 wild type genotype with high MVD index ( adjusted OR = 5 . 98 , 95 % CI 1 . 28 28 . 10 , P = 0 . 023 ) . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Polymorphisms of the GSTM 1 and GSTT 1 genes in patients with allergic diseases in the Czech population . ^^^ AIMS OF THE STUDY : Relationships among allergic diseases including asthma and variations in the GST mu ( GSTM 1 ) and GST theta ( GSTT 1 ) genes were investigated in 1 , 006 Caucasian subjects . ^^^ However , when compared with patients homozygous or heterozygous for GSTM 1 functional allele , asthmatics carrying both GSTM 1 null alleles displayed significantly worse lung function , assessed by forced expiratory volume in 1 s / forced vital capacity ( FEV ( 1 ) / FVC ) ratio ( Tiffenau index ) , ( P < 0 . 01 ) . ^^^ CONCLUSIONS : Genetic polymorphisms of the GSTM 1 and GSTT 1 genes , both individually and in combination , were not associated with the development of allergic diseases including asthma in the Czech population , the GSTM 1 gene variability , however , may influence lung functions in our asthmatics . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
OBJECTIVES : To examine whether the interaction of polymorphism of GSTM 1 gene and occupational sunlight exposure modulate the risk of cataract . ^^^ The genotypes of GSTM 1 were determined using PCR . ^^^ RESULTS : The null genotype of GSTM 1 was associated with an increase in cataract risk in the indoor workplace , but this association was not significant in the outdoor subjects . ^^^ CONCLUSION : The active genotype of GSTM 1 has lost its protective role in persons who work outdoors . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The deduced amino acid sequence of GSTM 4 is 87 % ( GSTM 1 ) , 83 % ( GSTM 2 ) , and 70 % ( GSTM 3 ) identical to the previously described human Mu class GSTs . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The left repeated region is 5 kb downstream from the 3 ' end of the GSTM 2 gene and 5 kb upstream from the beginning of the GSTM 1 gene ; the right repeated region is 5 kb downstream from the 3 ' end of the GSTM 1 and 10 kb upstream from the 5 ' end of the GSTM 5 gene . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
In liver , lead injection caused GSH depletion ( 61 % of control 12 h after lead treatment ) and increased MDA production ( 2 . 5 fold increase 6 h after lead exposure ) , while GSTA 1 , GSTA 2 , GSTM 1 and GSTM 2 did not increase . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
PATIENTS AND METHODS : We examined CYP3A4 * 1B , CYP3A5 * 3 , and deletions in GST mu ( GSTM 1 ) and theta ( GSTT 1 ) , as well as a priori defined combinations of polymorphisms in these genes . ^^^ RESULTS : Patients who carried homozygous CYP3A4 * 1B and CYP3A5 * 3 variants and did not carry homozygous deletions in both GSTM 1 and GSTT 1 ( denoted low drug genotype group ) had a 4 . 9 fold poorer DFS ( P = . 021 ) and a four fold poorer OS ( P = . 031 ) compared with individuals who did not carry any CYP3A4 * 1B or CYP3A5 * 3 variants but had deletions in both GSTT 1 and GSTM 1 ( denoted high drug genotype group ) . ^^^ CONCLUSION : Combined genotypes at CYP3A4 , CYP3A5 , GSTM 1 , and GSTT 1 influence the probability of treatment failure after high dose adjuvant chemotherapy for node positive breast cancer . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Relevance of the deletion polymorphisms of the glutathione S transferases GSTT 1 and GSTM 1 in pharmacology and toxicology . ^^^ Although cytosolic glutathione S transferase ( GST ) enzymes occupy a key position in biological detoxification processes , two of the most relevant human isoenzymes , GSTT 1 1 and GSTM 1 1 , are genetically deleted ( non functional alleles GSTT1 * 0 and GSTM1 * 0 ) in a high percentage of the human population , with major ethnic differences . ^^^ GSTM 1 1 is particularly relevant in the deactivation of carcinogenic intermediates of polycyclic aromatic hydrocarbons . ^^^ The GSTM1 * 0 status appears also associated with a modest increase in the risk of bladder cancer , consistent with a GSTM 1 interaction with carcinogenic tobacco smoke constituents . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Three human Mu class glutathione S transferase isoenzymes , GSTM 1 , GSTM 2 , and GSTM 3 , have been characterized previously , and we have recently cloned and characterized GSTM 4 , another member of this class . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The GSTM 1 , GSTM 2 , GSTM 3 , GSTM 4 , and GSTM 5 glutathione transferase genes have been mapped to human chromosome 1 by using locus specific PCR primer pairs spanning exon 6 , intron 6 , and exon 7 , as probes on DNA from human / hamster somatic cell hybrids . ^^^ The close physical proximity of the GSTM 1 and GSTM 2 loci , which share 99 % nucleotide sequence identity over 460 nucleotides of 3 ' untranslated mRNA , suggests that the GSTM 1 null allele may result from unequal crossing over . . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
The top 20 differentially expressed genes included 10 genes ( Spp 1 , Cyp1b1 , Btg 1 , Cfh , Mt 1 , Mt 2 , Igfbp 5 , Gstm 1 , Gstm 2 , and Esr 1 ) implicated in various aspects of ovarian carcinomas , and other 3 genes ( Gsto 1 , Lcn 7 , and Alcam ) associated to breast cancer . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Three GST subunits ( GSTA1 / 2 , GSTM 1 , and GSTM 2 ) were examined by Western blot for changes in protein level affected by EGCG ( 1 mg / kg weight ) . ^^^ The differential effect of EGCG on GST subunit expression was also verified by immunocytochemical examination and showed strong induction of the GSTM 2 ( but not the GSTA1 / 2 and GSTM 1 ) level in liver section . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Loss of the Nrf 2 transcription factor causes a marked reduction in constitutive and inducible expression of the glutathione S transferase Gsta 1 , Gsta 2 , Gstm 1 , Gstm 2 , Gstm 3 and Gstm 4 genes in the livers of male and female mice . ^^^ Among the class Alpha and class Mu transferases , constitutive expression of Gsta 1 , Gsta 2 , Gstm 1 , Gstm 2 , Gstm 3 , Gstm 4 and Gstm 6 subunits was reduced in the livers of Nrf 2 mutant mice to between 3 % and 60 % of that observed in WT mice . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
We measured five GST protein subunits ( GSTA1 / 2 composed of GST A 1 1 , A 1 2 and A 2 2 GSTM 1 , GSTM 2 , GSTP 1 , GSTT 1 ) by western blot , GST activity using 1 chloro 2 , 4 dinitrobenzene as substrate and GSTM 2 mRNA expression with RT PCR . ^^^ Cells isolated from colon tissue were identified to be colonocytes and colon fibroblasts , both of which also expressed substantial levels of GSTM 1 and GSTM 2 . ^^^ In HT 29 , butyrate significantly enhanced GSTA1 / 2 ( 3 . 5 fold ) , GSTM 2 ( not detectable in controls ) , GSTP 1 ( 1 . 5 fold ) and GST activity ( 1 . 4 fold ) , but not GSTM 1 or GSTT 1 . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
Western blotting data demonstrated that geniposide induced increased protein levels of GSTM 1 and GSTM 2 ( approximately 1 . 7 and 1 . 8 fold of control , respectively ) , but did not increase those of GSTA 1 . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
This article reports the first absolute quantitative analysis of expression patterns of murine transcripts ( Gsta1 / 2 , Gsta 3 , Gsta 4 , Gstm 1 , Gstm 2 , Gstm 3 , Gsto 1 , Gstp1 / 2 , Gstt 1 , Gstt 2 ) coding for most glutathione S transferases ( GSTs ) of alpha , mu , omega , pi , and theta classes . ^^^
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA
Interacting proteins: P28161 and P09488 Pubmed SVM Score :0.0
NA